Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTbA076d14.3                          8 END     5          62       62                (no blast hit)

 This cluster: approximate FL confidence score = 90%

 1012089188 Xt7.1-TTpA044f04.5 - 8 ESTs
                                                                       .........-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTpA044f04.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCCTGGGAGCTGTCCAGCACTCCATGCTCCTGAAATAACTTGGGCAACAAGTCCGATCTGCCCGCTACTCTGTGCCTCCAGCTCAGGCCCGGGGAGAGGGACCCTGCTGAGCAGGACTCAGGACACTGTTTGAAGATCACATCAAATTCTGCTAATATGTCGGAGATAGTCAGTGTGCATGGGTGGATGGAGGAAGCCCTTAGTTCCCAGGATGAGATGGAGAGGAATCAGCGGCAATCTGCCTATGATATCATTTCAGGTCTGAGTCACGAGGAAAGGTGTAGCATAGATGGAGAAGATGATGATGAAGAAGAAGAGGATGGAGAGAAACCAAAAAAGAGGGGACCCAAAAAAAAGAAGATGACCAAGGCTAGACTGGAGAGGTTTCGTGTGCGCAGAGTAAAAGCCAATGCCAGGGAGCGCACCAGAATGCATGGACTTAATGATGCCCTAGAAAATTTAAGGAGGGTCATGCCTTGCTATTCCAAAACACAAAAGTTGTCTAAAATTGAGACCCTTAGACTGGCCAGAAACTATATATGGGCATTATCTGATATTCTAGAACAAGGTCAAAGTACAGAGGGAAAGGGCTTTCTGGAAATGCTCTGCAAAGGTCTTTCTCAGCCAACAAGCAACTTAGTAGCTGGCTGTATGCAACTTGGACCTCAGGCAATGTTCTTGGATAAACACGAAGAAAAGTCTCATTTATGTGACTCTTCTCTTACTGGTCATACCTATAATTACCAGTCCCCAGGACTACCCAGTCCACCTTATGGAAACATTGATGTTCACCATTTGCACTTGAAACCCCCTTCTTTTAAACCAGTAATGGATCCATCTGTGGTAAGCCATACACTAAACTGCACCACTCCACCCTATGAAGGAGCTTTGACACCCCCGCTCAGCATCAGTGGTAATTTTTCCTTGAAGCAAGATGGTTCACCTGATATGGACAAATCATATGCATTTAGGTCCCCCTACCCAGCTCTTGGGCTTAGTGGATCTCATGGACATGGGTCACACTTTCAAACCGGTGTCCCAAGGTATGAACTACCCATAGAAATGGCTTATGAGCCCTACCAACACCATGCTATATTCACTGAATAAATGTGCTGATCAAATGACTTTTTATAGTTGACCCAAACCTGACTTTTTTGGATGACAATGGCCACCACATCACCACCACCTAAGATGACTGTTGGTCTTATTGTACGTATGTTTTG
                                                  Xt7.1-CHK-1008238439                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGCTGTCCAGCACTCCATGCTCCTGAAATAACTTGGGCAACAAGTCCGATCTGCCCGCTACTCTGTGCCTCCAGCTCAGGCCCGGGGAGAGGGACCCTGCTGAGCAGGACTCAGGACACTGTTTGAAGATCACATCAAATTCTGCTAATATGTCGGAGATAGTCAGTGTGCATGGGTGGATGGAGGAAGCCCTTAGTTCCCAGGATGAGATGGAGAGGAATCAGCGGCAATCTGCCTATGATATCATTTCAGGTCTGAGTCACGAGGAAAGGTGTAGCATAGATGGAGAAGATGATGATGAAGAAGAAGAGGATGGAGAGAAACCAAAAAAGAGGGGACCCAAAAAAAAGAAGATGACCAAGGCTAGACTGGAGAGGTTTCGTGTGCGCAGAGTAAAAGCCAATGCCAGGGAGCGCACCAGAATGCATGGACTTAATGATGCCCTAGAAAATTTAAGGAGGGTCATGCCTTGCTATTCCAAAACACAAAAGTTGTCTAAAATTGAGACCCTTAGACTGGCCAGAAACTATATATGGGCATTATCTGATATTCTAGAACAAGGTCAAAGTACAGAGGGAAAGGGCTTTCTGGAAATGCTCTGCAAAGGTCTTTCTCAGCCAACAAGCAACTTAGTAGCTGGCTGTATGCAACTTGGACCTCAGGCAATGTTCTTGGATAAACACGAAGAAAAGTCTCATTTATGTGACTCTTCTCTTACTGGTCATACCTATAATTACCAGTCCCCAGGACTACCCAGTCCACCTTATGGAAACATTGATGTTCACCATTTGCACTTGAAACCCCCTTCTTTTAAACCAGTAATGGATCCATCTGTGGTAAGCCATACACTAAACTGCACCACTCCACCCTATGAAGGAGCTTTGACACCCCCGCTCAGCATCAGTGGTAATTTTTCCTTGAAGCAAGATGGTTCACCTGATATGGACAAATCATATGCATTTAGGTCCCCCTACCCAGCTCTTGGGCTTAGTGGATCTCATGGACATGGGTCACACTTTCAAACCGGTGTCCCAAGGTATGAACTACCCATAGAAATGGCTTATGAGCCCTACCAACACCATGCTATATTCACTGAATAAATGTGCTGATCAAATGACTTTTTATAGTTGACCCAAACCTGACTTTTTTGGATGACAATGGCCACCACATCACCACCACCTAAGATGACTGTTGGTCTTATTGTACGTAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         2     3     2     3     3     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     7     6     7     6     7     6     7     5     6     5     6     5     6     5     6     5     6     5     6     5     7     5     7     5     7     5     7     5     7     5     7     5     7     3     7     5     7     3     7     3     7     3     7     3     6     3     5     3     4     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH MIN     133     114                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               BLH OVR     157     272                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               EST CLI     -36       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               ORF LNG     157      13                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Bb ---- 3e-010     AAD10038.1 twist protein [Branchiostoma belcheri] ---------====================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Cs ---- 5e-011     BAC81667.1 basic helix-loop-helix factor Mist [Ciona savignyi] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 7e-015     NP_524124.1 target of Poxn; target of Pox-n; biparous [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Bf ---- 1e-016     AAF81766.1 basic helix-loop helix transcription factor AmphiNeurogenin [Branchiostoma floridae] --------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ci ---- 2e-021     BAE06573.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ce ---- 4e-021     NP_498115.1 C. elegans NeuroD homolog CND-1 (cnd-1) [Caenorhabditis elegans] =======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Sp ---- 2e-042     XP_001194335.1 PREDICTED: similar to transcription factor HpNeuroD [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dr ---- 7e-089     NP_739568.1 atonal-like 3 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Xt ---- 3e-093     AAY99628.1 neuroD1 [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Hs ---- 3e-126     NP_067014.1 neurogenic differentiation 4 [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 3e-127     NP_031527.1 neurogenic differentiation 4; atonal homolog 3 (Drosophila) [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Gg ==== 3e-131     NP_990407.1 NeuroM protein [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 1e-172     BAA12738.1 xenopus atonal homolog-3 [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === ?? ==== 1e-172     NP_001081213.1 xenopus atonal homolog-3 [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTpA044f04.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGA---------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------TAAATG---TGA---------------TAG------------TGA---------ATG---ATG------------------------ATG---------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  0   1   1           1030 FLq                    IMAGE:7029266.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGCCCCGGACTCATTGATATTGGGCACAGCGAGTCTGCCTGGGAGCTGTCCAGCACTCCATGCTCCTGAAATAACTTGGGCAACAAGTCCGATCTGCCCGCTACTCTGTGCCTCCAGCTCAGGCCCGGGGAGAGGGACCCTGCTGAGCAGGACTCAGGACACTGTTTGAAGATCACATCAAATTCTGCTAATATGTCGGAGATAGTCAGTGTGCATGGGTGGATGGAGGAAGCCCTTAGTTCCCAGGATGAGATGGAGAGGAATCAGCGGCAATCTGCCTATGATATCATTTCAGGTCTGAGTCACGAGGAAAGGTGTAGCATAGATGGAGAAGATGATGATGAAGAAGAAGAGGATGGAGAGAAACCAAAAAAGAGGGGACCCAAAAAAAAAGAAGATGACCAAGGCTAGACTGGAGAGGTTTCGTGTGCGCAGAGTAAAAGCCAATGCCAGGGAGCGCACCAGAATGCATGGACTTAATGATGCCCTAGAAAATTTAAGGAGGGTCATGCCTTGCTATTCCAAAACACAAAAGTTGTCTAAAATTGAGACCCTTAGACTGGCCAGAAACTATATATGGGCATTATCTGATATTCTAGAACAAGGTCAAAGTACAGAGGGAAAGGGCTTTCTGGAAATGCTCTGCAAAGGTCTTTCTCAGCCAACAAGCAACTTAGTAGCTGGCTGTATGCAACTTGGACCTCAGGCAATGTTCTTGGATAAACACGAAGAAAAGTCTCATTTATGTGACTCTTCTCTTACTGGTCATACCTATAATTACCAGTCCCCAGGACTACCCAGTCCACCTTATGGAAACATTGATGTTCACCATTTGCACTTGAAACCCCCTTCTTTTAAACCAGTAATGGATCCATCTGTGGTAAGCCATACACTAAACTGCACCACTCCACCCTATGAAGGAGCTTTGACACCCCCGCTCAGCATCAGTGGTAATTTTTCCTTGAAGCAAGATGGTTCACCTGATATGGACAAATCATATGCATTTAGGTCCCCCTACCCAGCTCTTGGGCTTAGTGGATCTCATGGACATGGGTCACACTTTCAAACCGGTGTCCCAAGGTATGAACTACCCATAGAAATGGCTTATGAGCCCTACCAACACCATGCTATATTCACTGAATAAATGTGCTGATCAAATGACTTTTTATAGTTGACCCAAACCTGACTTTTTTGGATGACAATGGCCACCACATCACCACCACCTAAGATGACTGTTGGTCTTATTGTACGTATGTTTTGTAGTTTGTTTGTAGGTCACTTTTGAGACTCTTGGAGCCTGAATATAATGCATAGAAAAATCCAGTCAATCACAATGATAGCTACAAATTGTAATGTGAAAACAAAACACTAATGTGAACATTGCTATTTGGTGGAAACGTACCAGCACATACATATAGCCACATATAGTAACATATAATAACAGGAACTCATCTCAGGGGAACAACACTGGGGAGTGCATTGCTCCTCTAAACACCAAGGTTTCCAAATGGTACACACAACATACTGACCCAATGGCAGAGGAGTGTGTTAGTTGTTACTGGTTACTAGCACTCATTTTTACCCCTAAACTGCTCATAGAAGATAAAAATTTACAATGTATGCAAGGACCGATTTAAAGCACAAGTTTATTATGTATCAATTGCACTACAATATCCAATGCTATAAACTACAGTATAGCTGTTTTTTATTTTTTATATTACTGCTATATCACACAGAGCCATACGGTACATGCATATTTAATACAATGTGTATATTTTTTGTTGAGAATCCCATCGCCTACATATCATGAAATACAAAAGGCCAAAAACCCTTCTAACTATTATTTATACCTTTTAATTTATTTTATTATTATTTTGTATTACTGCATTTGTCAAATGATCCTACAACGGAATGCTCTTACTGTTCATGAATGATTGTTTTTGTATTTGTTGGTTTCAAACTGCATCCTTATTTATATCATTATTTATTTTAATAGAATTTTTAAATTAATCTGTTGCTCAAAAAAAAAAAAAAA
  5   1   2       bld Gas8 5g3  out                         st71b23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATTGGTGTAAAAGAAAGTATAGGAATGACACACTAGACAAAGCATATGAAAACTTAAGAGCTACAACTCCCAGCATCCTCAAGCCTTCCTTATATACCACAATAAAAACCAAACTATGCATCCAATTAAATTTTAATTACTCTTTCATGTTTTGTGATTGCAGGACACTGTTTGAAGATCACATCAAATTCTGCTAATATGTCGGAGATAGTCAGTGTGCATGGGTGGATGGAGGAAGCCCTTAGTTCCCAGGATGAGATGGAGAGGAATCAGCGGCAATCTGCCTATGATATCATTTCAGGTCTGAGTCACGAGGAAAGGTGTAGCATAGATGGAGAAGATGATGATGAAGAAGAAGAGGATGGAGAGAAACCAAAAAAGAGGGGACCCAAAAAAAAGAAGATGACCAAGGCTAGACTGGAGAGGTTTCGTGTGCGCAGAGTAAAAGCCAATGCCAGGGAGCGCACCAGAATGCATGGACTTAATGATGCCCTAGAAAATTTAAGGAGGGTCATGCCTTGCTATTCCAAAACACAAAAGTTGTCTAA
  5   1   2       bld 1030 FLq                        IMAGE:7029266.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGCCCCGGACTCATTGATATTGGGCACAGCGAGTCTGCCTGGGAGCTGTCCAGCACTCCATGCTCCTGAAATAACTTGGGCAACAAGTCCGATCTGCCCGCTACTCTGTGCCTCCAGCTCAGGCCCGGGGAGAGGGACCCTGCTGAGCAGGACTCAGGACACTGTTTGAAGATCACATCAAATTCTGCTAATATGTCGGAGATAGTCAGTGTGCATGGGTGGATGGAGGAAGCCCTTAGTTCCCAGGATGAGATGGAGAGGAATCAGCGGCAATCTGCCTATGATATCATTTCAGGTCTGAGTCACGAGGAAAGGTGTAGCATAGATGGAGAAGATGATGATGAAGAAGAAGAGGATGGAGAGAAACCAAAAAAGAGGGGACCCAAAAAAAAAGAAGATGACCAAGGCTAGACTGGAGAGGTTTCGTGTGCGCAGAGTAAAAGCCAATGCCAGGGAGCGCACCAGAATGCATGGACTTAATGATGCCCTAGAAAATTTAAGGAGGGGCATGCCCTTGCTATTCCAAAACACAAAAGTTGTCTAAAATTGAGACCCTTAGACTGGGCCAGAAAACTATATATGGGGCATTATCCGAATATTCTAGAACCAGGGTCAAAGTACCGAAGGAAAAGGGCCTTTCTGGGAAATTGCCTCTGCAAAGGGTTTTTCTTCACCCAACCAGTCAACTTTATAAACCTGGGCTGTATGCCAAATTTGGGACCCTCGGGGCAATGGTCCTTGGAATAAAACCCAATAGAAAAAGCCCTCATTTTAATGTGAACTCCTTACACCT
  5   1   2       bld TbA  5g3  out                  TTbA076d14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTCTGCCTGGGAGCTGTCCAGCACTCCATGCTCCTGAAATAACTTGGGCAACAAGTCCGATCTGCCCGCTACTCTGTGCCTCCAGCTCAGGCCCGGGGAGAGGGACCCTGCTGAGCAGGACTCAGGACACTGTTTGAAGATCACATCAAATTCTGCTAATATGTCGGAGATAGTCAGTGTGCATGGGTGGATGGAGGAAGCCCTTAGTTCCCAGGATGAGATGGAGAGGAATCAGCGGCAATCTGCCTATGATATCATTTCAGGTCTGAGTCACGAGGAAAGGTGTAGCATAGATGGAGAAGATGATGATGAAGAAGAAGAGGATGGAGAGAAACCAAAAAAGAGGGGACCCAAAAAAAAGAAGATGACCAAGGCTAGACTGGAGAGGTTTCGTGTGCGCAGAGTAAAAGCCAATGCCAGGGAGCGCACCAGAATGCATGGACTTAATGATGCCCTAGAAAATTTAAGGAGGGTCATGCCTTGCTATTCCAAAACACAAAAGTTGTCTAAAATTGAGACCCTTAGACTGGCCAGAAACTATATATGGGCATTATCTGATATTCTAGAACAAGGTCAAAGTACAGAGGGAAAGGGCTTTCTGGAAATGCTCTGCAAAGGTCTTTCTCAGCCAACAAGCAACTTAGTAGCTGGCTGTATGNCACTTGGACCTCANNGCATGTTCTTGGATAACACGAAGAAAGTCTCATTTATGTGACTCTTCTCTTACTGGTCATAC
  5   1   2   10  bld Eye  5g3  out                        CCAX9942.b1 ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCACTCCATGCTCCTGAAATAACTTGGGCAACAAGTCCGATCTGCCCGCTACTCTGTGCCTCCAGCTCAGGCCCGGGGAGAGGGACCCTGCTGAGCAGGACTCAGGACACTGTTTGAAGATCACATTAAATTCTGCTAATATGTCGGAGATAGTCAGTGTGCATGGGTGGATGGAGGAAGCCCTTAGTTCCCAGGATGAGATGGAGAGGAATCAGCGGCAATCTGCCTATGATATCATTTCAGGTCTGAGTCACGAGGAAAGGTGTAGCATAGATGGAGAAGATGATGATGAAGAAGAAGAGGATGGAGAGAAACCAAAAAAGAGGGGACCCAAAAAAAAGAAGATGACCAAGGCTAGACTGGAGAGGTTTCGTGTGCGCAGAGTAAAAGCCAATGCCAGGGAGCGCACCAGAATGCATGGACTTAATGATGCCCTAGAAAATTTAAGGAGGGTCATGCCTTGCTATTCCAAAACACAAAAGTTGTCTAAAATTGAGACCCTTAGACTGGCCAGAAACTATATATGGGCATTATCTGATATTCTAGAACAAGGTCAAAGTACAGAGGGAAAGGGCTTTTCTGGAAATGCTCTGCAAAGGTCTTTCTCAGCCAACAAGCAACTTAGTAGCTGGCTGTATGCAACTTGGACCTCAGGCAATGTTCTTGGATAAACACGAAGAAAAGTCTCATTTATGTGACTCTT
  5   1   2       bld TpA  5g                        TTpA039i03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACTCCATGCTCCTGAAAAACTTGGGCAACAAGTCCGATCTGCCCGCTACTCTGTGCCTCCAGCTCAGGCTCGGGGAGAGGGACCCTGCTGAGCAGGACTCAGGACACTGTTTGAAGATCACATCAAATTCTGCTAATATGTCGGAGATAGTCAGTGTGCATGGGTGGATGGAGGAAGCCCTTAGTTCCCAGGATGAGATGGAGAGGAATCAGCGGCAATCTGCCTATGATATCATTTCAGGTCTGAGTCACGAGGAAAGGTGTAGCATAGATGGAGAAGATGATGATGAAGAAGAAGAGGATGGAGAGAAACCAAAAAAGAGGGGACCCAAAAAAAAGAAGATGACCAAGGCTAGACTGGAGAGGTTTCGTGTGCGCAGAGTAAAAGCCAATGCCAGGGAGCGCACCAGAATGCATGGACTTAATGATGCCCTAGAAAATTTAAGGAGGGTCATGCCTTGCTATTCCAAAACACAAAAGTTGTCTAAAATTGAGACCCTTAGACTGGCCAGAAACTATATATGGGCATTATCTGATATTCTAGAACAAGGTCAAAGTACAGAGGGAAAGGGCTTTCTGGAAATGCTCTGCAAAGGTCTTTCTCAGCCAACAAGCAACTTAGTAGCTGGCTGTATGCAACTTGGACCTCANGCAATGTTCTTGGATAACACGAAGAAAGTCTCATTTATGTGACTCTTCTCTTACTGGTCATACCTATAATTACCAGTC
  5   1   2      seed TpA  5g3  out                  TTpA044f04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCTGCTCCTGAAAAACTTGGGCAACAAGTCCGATCTGCCCGCTACTCTGTGCCTCCAGCTCAGGCCCGGGGAGAGGGACCCTGCTGAGCAGGACTCAGGACACTGTTTGAAGATCACATCAAATTCTGCTAATATGTCGGAGATAGTCAGTGTGCATGGGTGGATGGAGGAAGCCCTTAGTTCCCAGGATGAGATGGAGAGGAATCAGCGGCAATCTGCCTATGATATCATTTCAGGTCTGAGTCACGAGGAAAGGTGTAGCATAGATGGAGAAGATGATGATGAAGAAGAAGAGGATGGAGAGAAACCAAAAAAGAGGGGACCCAAAAAAAAGAAGATGACCAAGGCTAGACTGGAGAGGTTTCGTGTGCGCAGAGTAAAAGCCAATGCCAGGGAGCGCACCAGAATGCATGGACTTAATGATGCCCTAGAAAATTTAAGGAGGGTCATGCCTTGCTATTCCAAAACACAAAAGTTGTCTAAAATTGAGACCCTTAGACTGGCCAGAAACTATATATGGGCATTATCTGATATTCTAGAACAAGGTCAAAGTACAGAGGGAAAGGGCTTTCTGGAAATGCTCTGCAAAGGTCTTTCTCAGCCAACAAGCAACTTAGTAGCTGGCTGTATGCAACTTGGACCTCAGGCAATGTTCTTGGATAAACACGAAGAAAAGTCTCATTTATGTGACTCTTCTCTTACTGGTCATACCTATAATTACCAGTCCCCAGGACTACCCAGTCCACCTTATGGAAACATTGATGTTCACCATTTGCACTTGAAACCCCCTTCTTTTAACCAGTAATGGATCCATCTGTGGTAGCCATACACTAAACTGCACCACTCCACCCTATGAAGGAGCTTTGACACCCCCGCTCAGCATC
  5   1   2       bld HdA                           THdA018m15.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGCCCTAGAAAATTTAAGAGAGGGTCATGCCTTGCTATTCCAAAACACAAAAGTTGTCTAAAATTGAGACCCTTAGACTGGCCAGAAACTATATATGGGCATTATCTGATATTCTAGAACAAGGTCAAAGTACAGAGGGAAAGGGCTTTCTGGAAATGCTCTGCAAAGGTCTTTCTCAGCCAACAAGCAACTTAGTAGCTGGCTGTATGCAACTTGGACCTCAAGCAATGTTCTTGGATAAACACGAAGAAAAGTCTCATTTATGTGACTCTTCTCTTACTGGTCATACCTATAATTACCAGTCCCCAGGACTACCCAGTCCACCTTATGGAAACATTGATGTTCACCATTTGCACTTGAAACCCCCTTCTTTTAAACCAGTAATGGATCCATCTGTGGTAAGCCATACACTAAACTGCACCACTCCACCCTATGAAGGAGCTTTGACACCCCCGCTCAGCATCAGTGGTAATTTTTCCTTGAAGCAAGATGGTTCACCTGATATGGACAAATCATATGCATTTAGGTCCCCCTACCCAGCTCTTGGGCTTAGTGGATCTCATGGACATGGGTCACACTTTCAAACCGGTGTCCCAAGGTATGAACTACCCATAGAAATGGCTTATGAGCCCTACCAACACCATGCTATATTCACTGAATAAATGTGCTGATCAAATGACTTTTTATAGTTGACCCAAACCTGACTTTTTTGGATGACAATGGCCACCACATCACCACCACCTAAGATGACTAGTGGTCTTATTGTACGTATGTTTTGT
  5   1   2       bld Tad0      out                      IMAGE:6982468                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCGGGATGGGAAAGGGCTTTCTGGAAATGCTCTGCAAAGGTCTTTCTCAGCCAACAAGCAACTTAGTAGCTGGCTGTATGCAACTTGGACCTCAGGCAATGTTCTTGGATAAACACGAAGAAAAGTCTCATTTATGTGACTCTTCTCTTACTGGTCATACCTATAATTACCAGTCCCCAGGACTACCCAGTCCACCTTATGGAAACATTGATGTTCACCATTTGCACTTGAAACCCCCTTCTTTTAAACCAGTAATGGATCCATCTGTGGTAAGCCATACACTAAACTGCACCACTCCACCCTATGAAGGAGCTTTGACACCCCCGCTCAGCATCAGTGGTAATTTTTCCTTGAAGCAAGATGGTTCACCTGATATGGACAAATCATATGCATTTAGGTCCCCCTACCCAGCTCTTGGGCTTAGTGGATCTCATGGACATGGGTCACACTTTCAAACCGGTGTCCCAAGGTATGAACTACCCATAGAAATGGCTTATGAGCCCTACCAACACCATGCTATATTCACTGAATAAATGTGCTGATCAAATGACTTTTTATAGTTGACCCAAACCTGACTTTTTTGGATGACAATGGCCACCACATCACCACCACCTAAGATGACTGTTGGTCTTATTGTACGTATGTTTTGTAGTTTGTTTGTAGGTCACTTTTGAGACTCTTGGAGCCTGAATATAATGCATAGAANAATCCAGTCAATCACAATGATAGCTACAAATTGTAATGTGANAACAAACACTAATGTGAACATTGCTATTGGNTGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)