Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAM4430.3                            5 END     5          35      100                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012089258 Xt7.1-CAAK6639.5 - 14 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAK6639.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCTATTGCCCAAGCCTGGAGAGTGCTTTTCCAGAGCCAGTTACCCAGTTAAGACCTCATGAAAATCTTCGAGGAAACTGCGGACTCAGAGATTATGGACACGGAGAAGAATGAAAAAATCCTTTTCCTGACACTGAAGATTGTTTCTCTGCTGACTGGAGAGCTTTCCCTATCACTATGTAGGATTATATTGTTCTGAGACAATCTGAAAATCACCCCAAAAACAGATGCAAGGTGTGTATGTTGGAAGGATTCTGCAAGCACCACACCCCACCTTTGGGTCATTCCACATTCAGGGAAAGCGGCAAGAAGATTCTGGGACTTATAAACAATATTATTTTCCTACTGACTGAAGAGGTCACTGTAAGGTGTGAGGACGTTTCTGTGTATTTCTCCAAGGAAGAATGGGAGTATTTACATGAGAATAAGGCCCTATACAGTGAAGTAATACAAAAGAAGTCATTACCTTTATACTTATTGGACTGGGAAAACGATTTTGATTCTAAGGATAATCTAAACGCAGAATACAGTTGGGATGATATCCCATGCAACAGTGAAGATATGGCTGACGAGTTATCCTATGAAGAAGAAACCCTCCTAAACTCTGCGATTTCCCCTGCAGGACAGAATTCAGCAGATTATGTAACAAATAACGTGTACAGCAAATCTGTTTTATATGAAGATGGAACACAAGCGTGCCCAGATATCAGCATTATAACCATTACGGAGCACATGAAGATACCCAATACAGCCACTGATAAACCATGCAGCCTAAATACCCCTTTGTCAGAAATAAAGGGCAAAGAAAATGGTAAAATTATTACTAACAAGTCCACCTCTGCTTCTCCACTTAAAAAACACACAAAGGCCACATATACCTGCGGTTTGTGCCAGAAGCCTTTTCCCTGTAACAGAGATCTTATTAGGCACCAGAAATTCCACACCGGAGAGAAACCATTCTCATGCTCCGTGTGTGGGAAATGTTACAGAGACAATGCGCTCCTCATTCGGCACCAGAGAATTCACACTGCCGATAGGCTATTCCCCTGCTCTGATTGTGGGAAGTTCTTTGTGGATCACTCCCAGCTGCTTATTCATCAAACAAGTCACACTGGAGCAAAACGACACTCTTGCGCCGAGTGTGGCAAATGGTTTCACTATACATCCGCTCTTATAAAGCACCAGAGAATCCACACCGGGGAGAAGCCGTTTTCCTGTTCTTTTTGTGGGAAGCGCTTTAATGACAACTCCATTCTGACAAGACACGAAAGAATTCACACAGGAGAGAAACCATTTTCCTGTACAGTATGCGGCAAATGCTTCACGCGCCGCTCACACCTAAGCGAGCATCAGAGAAGCCACACGGGTGAGACGCCGTTTATCTGCTCTGAGTGTGGAATAAGCTTTGGGAGGCAAAGACATCTGAAAGCTCATTTTAGAATTCACACAGGTCAAGCCCCTTTATCCTAATATGGGATTATTCTTGACGTGGGTGCATTACTGCAGATGTTATGGTCAAAATGCAGTACATTAAAGATATGATGGCTTATTTACAATGCCCCACACAATCACCACTACATGGGACACTATACAAATAGCTGCAAGCCTCTGTGCTCTGTTTTGGAGAATGGAGATTTGCATTTTCTTCACTAATACAGTGCTGACTTAATGCTGTATTAGTGAGGCACTCAGTGTAGAGTGTCCAGGGGGGAACAAGTCTTTAAAATATATGAAAGTGCAAGTGCGTGATGCTTAATGCTCGTTTTTTTAAGCACTAAGCACCCCCAGGGTTATTTTGGGGATATTTTGTTTTTTAACTTATACAAATACACTATTAGCCCCTAAGGGAAAAAAAATGATTTTGGCCCATTTATATGTATTATTTTATGAATACCTGTTATCATAAAAATATTTTTATTTAACGTCCTATTTATATTTCCCAATAAGTGTGGACATTACCATACACTGTGAAGAAGCAAAAATACATATCAATAAACCCATGGCCATAGTGACATCTCATGCAAAAGTCAGACATAGCTGTACTGTCCTTGTTTTAAGGTGGCCATACCCTTGACTGATACTCATTTTCAGCATGCAGGCCCAATGCACACCTTATTATTATTATTCCATTTGCTCATGTCAACAGCTTCAGCAATTGGAAACACAAAGATGCACTTTGCATTGGTCAACATGGTGCGTGACGGATGAACCGACTGATATCCCGATGGCTGGTATTATTCACCCAACATACATATAGTGAAAAACATACAAAATGATTGTATGGGTACAAGTATGGTTGGCTTTCATAGTAAAAGAAGACTTGCCAAATGTTTTTAAAACTGCCTGTATGGTACAATTTCTCTTTACCATGACTATATGGCATGTAGAGTTGGCACACCACAAACACAGGTATGAATGCCTAGGGCAGGCCTGTATACTTACCATGAAATGGTATTTTCTTTTTTTCAAGATAAAGATTTCTTATTAAACAAACATTGAGGATTCTGTAATCCTTACAGCACTTCAGCATGGTTTAGAGGAGCCAATTAGAAGTAAGTGGCTGTACCGGTCAGACTGCCCCATCTGCAGCCATAACTCATTGCAGGAGTATATGCTTTGCATAACATATTCCATGAGATAAGGGACAGTGCTGAGCCCAGCAAGAGGCCTTGAAGCAATGGTTGGAACTACATCTGTGAAGGGTTTCAGTTCAACCACAACTTTTTTAATGGACTATTTTCACATTTTTTTAGAATATTGACTTGTGAAATGTTTGCCATTTTGAGCAATACTGTAATTTTATAAGCTATTTGGGGTTTGCAGATAAAGGTTTGGATAGTCTGTGTATGTGCTTGTTGAACCTTTTAGTTTGCTGTCTGTACACATAATTTGTGTGTGTTAAACTTGACTTATTTGCTATGTGTGTGTATCTACATTACCGTATGAATTACTGTACCATGCACACAGGTTTGTTTTCATTATAATGTTGGTTTTCATGATGTACAGAATTAA
                                                  Xt7.1-CHK-1008233004                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GxCxxxAGCCTGGAGAGTGCTTTTCCAGAGCCAGTTACCCAGTTAAGACCTCATGAAAATCTTCGAGGAAACTGCGGACTCAGAGATTATGGACACGGAGAAGAATGAAAAAATCCTTTTCCTGACACTGAAGATTGTTTCTCTGCTGACTGGAGAGCTTTCCCTATCACTATGTAGGATTATATTGTTCTGAGACAATCTGAAAATCACCCCAAAAACAGATGCAAGGTGTGTATGTTGGAAGGATTCTGCAAGCACCACACCCCACCTTTGGGTCATTCCACATTCAGGGAAAGCGGCAAGAAGATTCTGGGACTTATAAACAATATTATTTTCCTACTGACTGAAGAGGTCACTGTAAGGTGTGAGGACGTTTCTGTGTATTTCTCCAAGGAAGAATGGGAGTATTTACATGAGAATAAGGCCCTATACAGTGAAGTAATACAAAAGAAGTCATTACCTTTATACTTATTGGACTGGGAAAACGATTTTGATTCTAAGGATAATCTAAACGCAGAATACAGTTGGGATGATATCCCATGCAACAGTGAAGATATGGCTGACGAGTTATCCTATGAAGAAGAAACCCTCCTAAACTCTGCGATTTCCCCTGCAGGACAGAATTCAGCAGATTATGTAACAAATAACGTGTACAGCAAATCTGTTTTATATGAAGATGGAACACAAGCGTGCCCAGATATCAGCATTATAACCATTACGGAGCACATGAAGATACCCAATACAGCCACTGATAAACCATGCAGCCTAAATACCCCTTTGTCAGAAATAAAGGGCAAAGAAAATGGTAAAATTATTACTAACAAGTCCACCTCTGCTTCTCCACTTAAAAAACACACAAAGGCCACATATACCTGCGGTTTGTGCCAGAAGCCTTTTCCCTGTAACAGAGATCTTATTAGGCACCAGAAATTCCACACCGGAGAGAAACCATTCTCATGCTCCGTGTGTGGGAAATGTTACAGAGACAATGCGCTCCTCATTCGGCACCAGAGAATTCACACTGCCGATAGGCTATTCCCCTGCTCTGATTGTGGGAAGTTCTTTGTGGATCACTCCCAGCTGCTTATTCATCAAACAAGTCACACTGGAGCAAAACGACACTCTTGCGCCGAGTGTGGCAAATGGTTTCACTATACATCCGCTCTTATAAAGCACCAGAGAATCCACACCGGGGAGAAGCCGTTTTCCTGTTCTTTTTGTGGGAAGCGCTTTAATGACAACTCCATTCTGACAAGACACGAAAGAATTCACACAGGAGAGAAACCATTTTCCTGTACAGTATGCGGCAAATGCTTCACGCGCCGCTCACACCTAAGCGAGCATCAGAGAAGCCACACGGGTGAGACGCCGTTTATCTGCTCTGAGTGTGGAATAAGCTTTGGGAGGCAAAGACATCTGAAAGCTCATTTTAGAATTCACACAGGTCAAGCCCCTTTATCCTAATATGGGATTATTCTTGACGTGGGTGCATTACTGCAGATGTTATGGTCAAAATGCAGTACATTAAAGATATGATGGCTTATTTACAATGCCCCACACAATCACCACTACATGGGACACTATACAAATAGCTGCAAGCCTCTGTGCTCTGTTTTGGAGAATGGAGATTTGCATTTTCTTCACTAATACAGTGCTGACTTAATGCTGTATTAGTGAGGCACTCAGTGTAGAGTGTCCAGGGGGGAACAAGTCTTTAAAATATATGAAAGTGCAAGTGCGTGATGCTTAATGCTCGTTTTTTTAAGCACTAAGCACCCCCAGGGTTATTTTGGGGATATTTTGTTTTTTAACTTATACAAATACACTATTAGCCCCTAAGGGAAAAAAAATGATTTTGGCCCATTTATATGTATTATTTxxxxAATACCTGTTATCATAAAAATATTTTTATTTAACGTCCTATTTATATTTCCCAATAAGTGTGGACATTACCATACACTGTGAAGAAGCAAAAATACATATCAATAAACCCATGGCCATAGTGACATCTCATGCAAAAGTCAGACATAGCTGTACTGTCCTTGTTTTAAGGTGGCCATACCCTTGACTGATACTCATTTTCAGCATGCAGGCCCAATGCACACCTTATTATTATTATTCCATTTGCTCATGTCAACAGCTTCAGCAATTGGAAACACAAAGATGCACTTTGCATTGGTCAACATGGTGCGTGACGGATGAACCGACTGATATCCCGATGGCTGGTATTATTCACCCAACATACATATAGTGAAAAACATACAAAATGATTGTATGGGTACAAGTATGGTTGGCTTTCATAGTAAAAGAAGACTTGCCAAATGTTTTTAAAACTGCCTGTATGGTACAATTTCTCTTTACCATGACTATATGGCATGTAGAGTTGGCACACCACAAACACAGGTATGAATGCCTAGGGCAGGCCTGTATACTTACCATGAAATGGTATTTTCTTTTTTTCAAGATAAAGATTTCTTATTAAACAAACATTGAGGATTCTGTAATCCTTACAGCACTTCAGCATGGTTTAGAGGAGCCAATTAGAAGTAAGTGGCTGTACCGGTCAGACTGCCCCATCTGCAGCCATAACTCATTGCAGGAGTATATGCTTTGCATAACATATTCCATGAGATAAGGGACAGTGCTGAGCCCAGCAAGAGGCCTTGAAGCAATGGTTGGAACTACATCTGTGAAGGGTTTCAGTTCAACCACAACTTTTTTAATGGACTATTTTCACATTTTTTTAGAATATTGACTTGTGAAATGTTTGCCATTTTGAGCAATACTGTAATTTTATAAGCTATTTGGGGTTTGCAGATAAAGGTTTGGATAGTCTGTGTATGTGCTTGTTGAACCTTTTAGTTTGCTGTCTGTACACATAATTTGTGTGTGTTAAACTTGACTTATTTGCTATGTGTGTGTATCTACATTACCGTATGAATTACTGTACCATGCACACAGGTTTGTTTTCATTATAATGTTGGTTTTCATGATGTACAGAATTAAATCTTC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     3     5     3     5     3     5     3     5     3     5     3     5     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     4     5     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     4     4     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     3     1     3     1     3     1     3     1     3     1     3     1     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     2     2     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGATTGTTTCTCTGCTGACTGGA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             G-----------
                                               BLH MIN     264      80                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     240     691                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     240      97                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Bf ---- 8e-021     CAB92782.1 Krox protein [Branchiostoma floridae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sc ---- 1e-022     NP_012479.1 Zinc-regulated DNA binding protein involved in zinc ion homeostasis; Zap1p[Saccharomyces cerevisiae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 2e-035     NP_500033.1 C2H2 type zinc finger containing protein [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dm ---- 5e-047     NP_477243.1 CG14938-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN -== Ci ==== 2e-053     BAE06772.1 zinc finger protein [Ciona intestinalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Sp ---- 9e-054     XP_792487.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Dr ---- 4e-061     XP_698469.1 PREDICTED: similar to zinc finger protein 91 (HPF7, HTF10) [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Gg ---- 3e-062     XP_001231629.1 PREDICTED: hypothetical protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Mm ---- 6e-064     NP_001032796.1 zinc finger protein 27 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Hs ---- 4e-066     NP_116313.2 zinc finger protein 3 [Homo sapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- ?? ---- 1e-070     NP_001090172.1 negatively regulating zinc finger protein [Xenopus laevis] ------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Xl ---- 6e-071     JC7992 negatively regulating zinc finger protein, NZFP - African clawed frog [Xenopus laevis]  ---------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Xt ---- 4e-086     AAI21550.1 Hypothetical protein MGC146992 [Xenopus tropicalis] -----------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAK6639.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGA---------------------------------------------------------------ATGTAG---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------ATG------------------------------TGA------------------------------------ATG---------------------------------------------------------------------TAA---------------ATG------TAGTGA---------------------------------------------------------------TGA------ATG------------------------------------------------------------------------------------TAA------------------------------------------TGA------------------------------------------------------------------------------TGA---------------------TAA---------------------------------------TAG------------------------------------------------------------------ATG------------------------------ATG------------------------------ATG------------------ATG------------TGA------TGA---------------------------------------------------------------ATG---------ATG---------------------------------------TAA---------------------------------------ATG---------------------------------TGAATG------------------------------ATG---------------------------------------------TGA------------------------------------------------TAG---TAA------------------------------------TAA---------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------ATG------------------------------TAA---------------------------------------------------TGA------TAG---------------------------------------------------------------------------TGA---------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ...
  5   1   2       bld Te4       out                       CAAN11685.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGCCGGCGGTGCCTTTCGGCGCGTCCGTGCCTAGCAACCCAAACTGGAACTTCCGGTCACAATTTAGTCGTCTTTGGTCTTACCTGGAGGCTCGGAACGCAAAACAGGAAGTAATTTAGGCTATTGCCCATCTGCGACCGGCACGTCAACAGCCTGGAGAGTGCTTTTCCAGAGCCAGTTACCCAGTTAGGACCTTATGAAAATCTTCGAGGAACCTGCGGACACAGAGATTATGGACACGGAGAAGAATGAAAAAATCCTTTTTCTCACACTGAAGATTGTTTCTCTGCTGACTGGAGAGCTTTCCCTATCACTATGTAGGATTATATTGTTCTGAGACAATCTGACAATCACCCCAAAAACAGATGCAAGGTGTGTATGTTGGAAGGATTCTGCAAGCACCACACCCCACCTTTGGGTCATTCCACATTCAGGGAAAGCGGCAAGAAGATTCTGGGACTTATAAACAATATTATTTTCCTACTGACTGAAGAGGTCACTGTAAGGTGTGAGGACGTTTCTGTGTATTTCTCTAAGGAAGAATGGGAGTATTTACATGAGAATAAGGCCCTATACAGTGAAGTAATACAAAAGAAGTCATTACCTTTATACTTATTGGACTGGGAAAACGATTTTGATTCTAAGGATAATCTAAACGCAGAATACAGTTGGGATGATATCCCATGCAACAGTGAAGATATGGCTGACGAGTTATCCTATGAAGAA
  5   1   2   24 seed Brn3 PIPE ?                          CAAK6639.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCTTTGGTCTTACCTGGAGGCTCGGAACGCAAAACAGGAAGTAATTTAGGCTATTGCCCATCTGCGACCGGCACGTCAACAGCCTGGAGAGTGCTTTTCCAGAGCCAGTTACCCAGTTAGGACCTCATGAAAATCTTCGAGGAACCTGCGGACACAGAGATTATGGACACGGAGAAGAATGAAAAAATCCTTTTTCTCACACTAAAGATTGTTTCTCTGCTGACTGGAGAGGATTATATTGTTCTGAGACAATCTGAAAATCACCCCAAAAACAGATGCAAGGTGTGTATGTTGGAAGGATTCTGCAAGCACCACACCCCACCTTTGGGTCATTCCACATTCAGGGAAAGCGGCAAGAAGATTCTGGGACTTATAAACAATATTATTTTCCTACTGACTGAAGAGGTCACTGTAAGGTGTGAGGACGTTTCTGTGTATTTCTCCAAGGAAGAATGGGAGTATTTACATGAGAATAAGGCCCTATACAGTGAAGTAATACAAAAGAAGTCATTACCTTTATACTTATTGGACTGGGAAAACGATTTTGATTCTAAGGATAATCTAAACGCAGAATACAGTTGGGATGATATCCCATGCAACAGTGAAGATATGGCTGACGAGTTATCCTATGAAGAAGAAACCCTCCTAAACTCTGCGATTTCCCCTGCAGGACAGAATTCAGCAGATTATGTAACAAATAACGTGTACAGCAAATCTGTTTTATATGAAGATGGAACACAAACGTGCCCAGATATCAGCATTATAACCATTACGGAGCACATGAAGATACCCAATACAGCCACTGATAAAGCATGCAGCCTANATACCCCTTTGTCAGAAAT
  5   1   2       bld Gas7 5x3  in                         XZG21126.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTAATTTAGGCTATTGCCCATCTGCGACCGGCACGTCAAGAGCCTGGAGAGTGCTTTTCCAGAGCCAGTTACCCAGTTAAGACCTCATGAAAATCTTCGAGGAAACTGCGGACTCAGAGATTATGGACACGGAGAAGAATGAAAAAATCCTTTTCCTGACACTGAAGATTGTTTCTCTGCTGACTGGAGAGGATTATATTGTTCTGAGACAATCTGAAAATCACCCCAAAAACAGATGCAAGGTGTGTATGTTGGAAGGATTCTGCAAGCACCACACCCCACCTTTGGGTCATTCCACATTCAGGGAAAGCGGCAAGAAGATTCTGGGACTTATAAACAATATTATTTTCCTACTGACTGAAGAGGTCACCTGTAAGGTGTGAGGACGTTTCTGTGTATTTCTCCAAGGAAGAATGGGAGTATTTACATGAGAATAAGGCCCTATACAGTGAAGTAATACAAAAGAAGTCATTACCTTTATACTTATTGCACTGGGAAAACGATTTTGATTCCAAGGACAATCTAAACGCCGA
  5   1   2       bld Neu       in                   TNeu102b01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACGTCAAGAGCCTGGAGAGTGCTTTTCCAGAGCCAGTTACCCAGTTAAGACCTCATGAAAATCTTCGAGGAAACTGCGGACTCAGAGATTATGGACACGGAGAAGAATGAAAAAATCCTTTTCCTGACACTGAAGATTGTTTCTCTGCTGACTGGAGAGCTTTCCCTATCACTATGTAGGATTATATTGTTCTGAGACAATCTGAAAATCACCCCAAAAACAGATGCAAGGTGTGTATGTTGGAAGGATTCTGCAAGCACCACACCCCACCTTTGGGTCATTCCACATTCAGGGAAAGCGGCAAGAAGATTCTGGGACTTATAAACAATATTATTTTCCTACTGACTGAAGAGGTCACTGTAAGGTGTGAGGACGTTTCTGTGTA
  5   1   2       bld Neu  5g                        TNeu142d14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACGTCAAGAGCCTGGAGAGTGCTTTTCCAGAGCCAGTTACCCAGTTAAGACCTCATGAAAATCTTCGAGGAAACTGCGGACTCAGAGATTATGGACACGGAGAAGAATGAAAAAATCCTTTTCCTGACACTGAAGATTGTTTCTCTGCTGACTGGAGAGCTTTCCCTATCACTATGTAGGATTATATTGTTCTGAGACAATCTGAAAATCACCCCAAAAACAGATGCAAGGTGTGTATGTTGGAAGGATTCTGCAAGCACCACACCCCACCTTTGGGTCATTCCACATTCAGGGAAAGCGGCAAGAAGATTCTGGGACTTATAAACAATATTATTTTCCTACTGACTGAAGAGGTCACTGTAAGGTGTGAGGACGTTTCTGTGTATTTCTCCAAGGAAGAATGGGAGTATTTACATGAGAATAAGGCCCTATACAGTGAAGTAATACAAAAGAAGTCATTACCTTTATACTTATTGGACTGGGAAAACGATTTTGATTCTAAGGATAATCTAAACGCAGAATACAGTTGGGATGATATCCCATGCAACAGTGAAGATATGGCTGACGAGTTATCCTATGAAGAAGAAACCCTCCTAAACTCTG
  5   1   2   14  bld Te4  5g3  out                        CAAN8717.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATGAAAATCTTCGAGGAACCTGCGGACACAGAGATTATGGACACGGAGAAGAATGAAAAAATCTCTTTTTCTCACACTAAAGATTGTTTCTCTGCTGACTGGAGAGGATTATATTGTTCTGAGACAATCTGAAAATCACCCCAAAAACAGATGCAAGGTGTGTATGTTGGAAGGATTCTGCAAGCACCACACCCCACCTTTGGGTCATTCCACATTCAGGGAAAGCGGCAAGAAGATTCTGGGACTTATAAACAATATTATTTTCCTACTGACTGAAGAGGTCACTGTAAGGTGTGAGGACGTTTCTGTGTATTTCTCCAAGGAAGAATGGGAGTATTTACATGAGAATAAGGCCCTATACAGTGAAGTAATACAAAAGAAGTCATTACCTTTATACTTATTGGACTGGGAAAACGATTTTGATTCTAAGGATAATCTAAACGCAGAATACAGTTGGGATGATATCCCATGCAACAGTGAAGATATGGCTGACGAGTTATCCTATGAAGAAGAAACCCTCCTAAACTCTGCGATTTCCCCTGCAGGACAGAATTCAGCAGATTATGTAACAAATAACGTGTACAGCAAATCTGTTTTATATGAAGATGGAACACAAACGTGCCCAGATATCAGCATTATAACCATTACGGAGCACATGAAGATACCCAATACAGCCACTGATAAAGCATGCAGCCTANATACCCCTTTGTCAGAAATAAAAGGCAAAGAAAATGGTAAAATTATTACTAACAAGTCCACCTCTGCTTCTCCACTT
  5   1   2       bld Te4       out                        CAAN5263.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACAAAAGAAGTCATTACCTTTATACTTATTGGACTGGGAAAACGATTTTGATTCTAAGGATAATCTAAACGCAGAATACAGTTGGGATGATATCCCATGCAACAGTGAAGATATGGCTGACGAGTTATCCTATGAAGAAGAAACCCTCCTAAACTCTGCGATTTCCCCTGCAGGACAGAATTCAGCAGATTATGTAACAAATAACGTGTACAGCAAATCTGTTTTATATGAAGATGGAACACAAGCGTGCCCAGATATCAGCATTATAACCATTACGGAGCACATGAAGATACCCAATACAGCCACTGATAAACCATGCAGCCTAAATACCCCTTTGTCAGAAATAAAGGGCAAAGAAAATGGTAAAATTATTACTAACAAGTCCACCTCTGCTTCTCCACTTAAAAAACACACAAAGGCCACATATACCTGCGGTTTGTGCCAGAAGCCTTTTCCCTGTAACAGAGATCTTATTAGGCACCAGAAATTCCACACCGGAGAGAAACCATTCTCATGCTCCGTGTGTGGGAAATGTTACAGAGACAATGCGCTCCTCATTCGGCACCAGAGAATTCACACTGCCGATAGGCTATTCCCCTGCTCTGATTGTGGGAAGTTCTTTGTGGATCACTCCCAGCTGCTTATTCATCAAACAAGTCACACTGGAGCAAAACGACACTCTTGCGCCGAGTGTGGCANATGGTTTCACTATACATCCGCTCTTATAAAGCACCAGAGAATCCACACCGGGGAGAAGCCGTTTTCCTG
  5   1   2       bld Te4       out                       CAAN12588.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGCGATTTCCCCTGCAGGACAGAATTCAGCAGATTATGTAACAAATAACGTGTACAGCAAATCTGTTTTATATGAAGATGGAACACAAGCGTGCCCAGATATCAGCATTATAACCATTACGGAGCACATGAAGATACCCAATACAGCCACTGATAAACCATGCAGCCTAAATACCCCTTTGTCAGAAATAAAGGGCAAAGAAAATGGTAAAATTATTACTAACAAGTCCACCTCTGCTTCTCCACTTAAAAAACACACAAAGGCCACATATACCTGCGGTTTGTGCCAGAAGCCTTTTCCCTGTAACAGAGATCTTATTAGGCACCAGAAATTCCACACCGGAGAGAAACCATTCTCATGCTCCGTGTGTGGGAAATGTTACAGAGACAATGCGCTCCTCATTCGGCACCAGAGAATTCACACTGCCGATAGGCTATTCCCCTGCTCTGATTGTGGGAAGTTCTTTGTGGATCACTCCCAGCTGCTTATTCATCAAACAAGTCACACTGGAGCAAAACGACACTCTTGCGCCGAGTGTGGCAAATGGTTTCACTATACATCCGCTCTTATAAAGCACCAGAGAATCCACACCGGGGAGAAGCCGTTTTCCTGTTCTTTTTGTGGGAAGCGCTTTAATGACAACTCCATTCTGACAAGACACGAAAGAATTCACACAGGAGAGAAACCATTTTCCTGTACAGTATGCGGCAAATGCTTCACGCGCCGCTCACACCTAAGCGAGCATCAGAGAAGCCACACGGGTGAGACGCCGTTTATCTGCTCTGAGTGTGGAATAAGCTTTGGGAGGCAAAGACATCTGAAAGCTCATTTTAGAATCACACAGGTCAAGCCCCTTTATCCTAATATGGG
  5   1   2      skin Te4       in                         CAAN3062.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAGACGCCGTTTATCTGCTCTGAGTGTGGAATAAGCTTTGGGCGGCAAAGACATCTGAAAGCTCATTTTAGAATTCACACAGGTCAAGCCCCTTTATCCTAATATGGGATTATTCTTGACGTGGGTGCATTACTGCAGATGTTATGGTCAAAATGCAGTACATTAAAGATATGATGGCTTATTTACAATGCCCCACACAATCACCACTACATGGGACACTATACAAATAGCTGCAAGCCTCTGTGCTCTGTTTTGGAGAATGGAGATTTGCATTTTCTTCACTAATACAGTGCTGACTTAATGCTGTATTAGTGAGGCACTCAGTGTAGAGTGTCCAGGGGGGAACAAGTCTTTAAAATATATGAAAGTGCAAGTGCGTGATGCTTAATGCTCGTTTTTTTAAGCACTAAGCACCCCCAGGGTTATTTTGGGGATATTTTGTTTTTTAACTTATACAAATACACTATTAGCCCCTAAGGGAAAAAAAATGATTTTGGCCCATTTATATGTATTATTTATGAATACCTGTTATCATAAAAATATTTTTATTTAACGTCCTATTTATATTTCCCAATAAGTGTGGACATTACCATACACTGTGAAGAAGCAAAAATACATATCAATAAACCCATGGCCATAGTGACATCTCATGCAAAAGTCAGACATAGCTGTACTGTCCTTGTTTTAAGGTGGCCATACCCTTGACTGATACTCATTTTCAGCATGCAGGCCCAATGCACACCTTATTNATATTATTCCATTTGCTCATGTCAACAGCTTCAGCAAATGGAAACACAAAGATGCACTTTGCATTTGGTCACATGGTGCGTGACGGATGAACCGACTG
  3   1   2      skin Gas7 5x3  in                         XZG21126.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTACAATGCCCCACACAATCACCACTACATGGGACACTATACAAATAGCTGCAAGCCTCTGTGCTCTGTTTTGGAGAATGGAGATTTGCGTTTTCTTCACTAATACAGTGCTGACTTAATGCTGTATTAGTGAGGCACTCAGTGTAGAGCGTCCAGGGGGGAACAAGTCTTTAAAATATATGAAAGTGCAAGTGCATGATGCTTAATGCTCATTTTTCTAAGCACTAAGCACCCCCAGGGTTATTTTTGGCATATTTTGTTTTTTAACTTCTACAAATACACTATTAGCCCCTAAGGAAAAAAAAAATGATTTTGGCCCATTTATATGTATTATTTATGAATACCTGTTATCATAAAAATATTTTTATTTAACGTCCTATTTATATTTCCCAATAAGTGTGGACATTACCATACACTGTGAAGAAGCAAAAATACATATCAATAAACCCATGGCTATAGTGACATCTCATGCAAAAGTCAGACATAGCTGTACTGTCCTTGTTTTAAGGTGGCCATACCCTTGACTGATACTCATTTTCAGCATGCAGGCCCAATGCACACCTTATTATTATTATTCCATTTGCTCATGTCAACAGCTTCAGCAAATGGAAACACAAAGATGCACTTTGCATTGGTCAACATGGTGCGTGACGGATGAACCGACTGATATCCCGATGGCTGGTATTATTCACCCAAAAAAAAAT
  5   1   2      shim Te3       out                        CAAM4430.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATAAACCCATGGCCATAGTGACATGTATTTTTGCTTCTTCACAGTGTATGGTAATGTCCACACTTATTGGGAAATATAAATAGGACGTTACCATACACTGTGAAGAAGCAAAAATACATATCAATAAACCCATGGCCATAGTGACATCTCATGCAAAAGTCAGACATAGCTGTACTGTCCTTGTTTTAAGGTGGCCATACCCTTGACTGATACTCATTTTCAGCATGCAGGCCCAATGCACACCTTATTATTATTATTCCATTTGCTCATGTCAACAGCTTCAGCAATTGGAAACACAAAGATGCACTTTGCATTGGTCAACATGGTGCGTGACGGATGAACCGACTGATATCCCGATGGCTGGTATTATTCACCCAACATACATATAGTGAAAAACATACAAAATGATTGTATGGGTACAAGTATGGTTGGCTTTCATAGTAAAAGAAGACTTGCCAAATGTTTTTAAAACTGCCTGTATGGTACAATTTCTCTTTACCATGACTATATGGCATGTAGAGTTGGCACACCACAAACACAGGTATGAATGCCTAGGGCAGGCCTGTATACTTACCATGAAATGGTATTTTCTTTTTTTCAAGATAAAGATTTCTTATTAAACAAACATTGAGGATTCTGTAATCCTTACAGCACTTCAGCATGGTTTAGAGGAGCCAATTAGAAGTAAGTGGCTGTACCGGTCAGACTGCCCCATCTGCAGCCATAACACATTGCAGGAGTATATGCTTTGCATAACATATTCCATGAGATAAGGGACAGTGCTGAGCCCAGCAAGAGGCCTTGAAAGCATGGTTGGAACTACATCTGTGAAGGGTTTCAGTTCAACCACAACTTTTTTAATGGACTATTTTCACATTT
  5   1   2       bld Brn4                                 CAAL9670.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATGGCCATAGTGACATCTCATGCAAAAGTCAGACATAGCTGTACTGTCCTTGTTTTAAGGTGGCCATACCCTTGACTGATACTCATTTTCAGCATGCAGGCCCAATGCACACCTTATTATTATTATTCCATTTGCTCATGTCAACAGCTTCAGCAATTGGAAACACAAAGATGCACTTTGCATTGGTCAACATGGTGCGTGACGGATGAACCGACTGATATCCCGATGGCTGGTATTATTCACCCAACATACATATAGTGAAAAACATACAAAATGATTGTATGGGTACAAGTATGGTTGGCTTTCATAGTAAAAGAAGACTTGCCAAATGTTTTTAAAACTGCCTGTATGGTACAATTTCTCTTTACCATGACTATATGGCATGTAGAGTTGGCACACCACAAACACAGGTATGAATGCCTAGGGCAGGCCTGTATACTTACCATGAAATGGTATTTTCTTTTTTTCAAGATAAAGATTTCTTATTAAACAAACATTGAGGATTCTGTAATCCTTACAGCACTTCAGCATGGTTTAGAGGAGCCAATTAGAAGTAAGTGGCTGTACCGGTCAGACTGCCCCATCTGCAGCCATAACACATTGCAGGAGTATATGCTTTGCATAACATATTCCATGAGATAAGGGACAGTGCTGAGCCCAGCAAGAGGCCTTGAAAGCATGGTTGGAACTACATCTGTGAAGGGTTTCAGTTCAACCACAACTTTTTTAATGGACTATTTTCACATTTTTT
  3   1   2       bld Te4       in                         CAAN3062.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACATACATATAGTGAAAAACATACAAAATGATTGTATGGGTACAAGTATGGTTGGCTTTCATAGTAAAAGAAGACTTGCCAAATGTTTTTAAAACTGCCTGTATGGTACAATTTCTCTTTACCATGACTATATGGCATGTAGAGTTGGCACACCACAAACACAGGTATGAATGCCTAGGGCAGGCCTGTATACTTACCATGAAATGGTATTTTCTTTTTTTCAAGATAAAGATTTCTTATTAAACAAACATTGAGGATTCTGTAATCCTTACAGCACTTCAGCATGGTTTAGAGGAGCCAATTAGAAGTAAGTGGCTGTACCGGTCAGACTGCCCCATCTGCAGCCATAACTCATTGCAGGAGTATATGCTTTGCATAACATATTCCATGAGATAAGGGACAGTGCTGAGCCCAGCAAGAGGCCTTGAAGCAATGGTTGGAACTACATCTGTGAAGGGTTTCAGTTCAACCACAACTTTTTTAATGGACTATTTTCACATTTTTTTAGAATTTTGACTTCTGAAATGTTTGCCATGTTGAGCAATACTGTAATTTTATAAGCTATTTGGGGTTTGCAGATAAAGGTTTGGATAGTCTGTGTATGTGCTTGTTGAACCTTTTAGTTTGCTGTCTGTACACATAATTTGTGTGTGTTAAACTTGACATATGTGCTATGTGTGTGTATCTACATTACTGTATGAATTACTGTACCATGCACACAGGTTTGTTTTCATTATAATGTTGGTTTTCATGATGTACAGAATTAAATCTTCAGTGGTGTATAT
  3   1   2       bld Neu       in                    TNeu102b01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTATGGGTACAAGTATGGTTGGCTTTCATAGTAAAAGAAGACTTGCCAAATGTTTTTAAAACTGCCTGTATGGTACAATTTCTCTTTACCATGACTATATGGCATGTACAGTTGGCACACCACAAACACAGGTATGAATGCCTAGGGCAGGCCTGTATACTTACCATGAAATGGTATTTTCTTTTTTTCAAGATAAAGATTTCTTATTAAACAAACATTGAGGATTCTGTAATCCTTACAGCACTTCAGCATGGTTTAGAGGAGCCAATTAGAAGTAAGTGGCTGTACCGGTCAGACTGCCCCATCTGCAGCCATAACTCATTGCAGGAGTATATGCTTTGCATAACATATTCCATGAGATAAGGGACAGTGCTGAGCCCAGCAAGAGGCCTTGAAGCAATGGTTGGAACTACATCTGTGAAGGGTTTCAGTTCAACCACAACTTTTTTAATGGACTATTTTCACATTTTTTTAGAATATTGACTTGTGAAATGTTTGCCATTTTGAGCAATACTGTAATTTTATAAGCTATTTGGGGTTTGCAGATAAAGGTTTGGATAGTCTGTGTATGTGCTTGTTGAACCTTTTAGTTTGCTGTCTGTACACATAATTTGTGTGTGTTAAACTTGACTTATTTGCTATGTGTGTGTATCTACATTACCGTATGAATTACTGTACCATGCACACAGGTTTGTTTTCATTATAATGTTGGTTTTCATGATGTACAGAATTAAATCTTCAGTGATGTATATAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)