Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012089938 Xt7.1-TTbA035c12.3 - 10 ESTs
                                                                       ........-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTbA035c12.3                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTAGATGGACTAGTATTAGCCAGCGCGTCATGCAAAAGGTGTTTTGTTTTTTTAATTATTTTTGACCAAATGAGTAGAAAATGGGGATTATGACTTGCTTATGATCTATTTCAGAAAAAAAAAGTTAATTTATGAATTATTTAGCAGTGTCGGAGATGCATTGATATAAGTGCAACGTATTTATTATTTTTAAGGGCAAAACTATTATTTCTTTGTTATATTTTGTATCATTATTTATCCTTGTCTTATTGTATTTATGTGGATGATTGTGAAATTTAATCAGTGCAACTTGGAAAAATGAATCAAGCCCATTGTGGCTACATTTTCTTCTACGTAATTAAAACACCAGAGACTTTAGAGTTGTAATTGCGACTGGTGTTTGAGCCTCAAGATATCCTTGATGTTAAATTTAAGGCAGAAATGTGAATTTCCGCTGAAAATGTAGCTTTTTTCCACAATGGGCCTTTGACATTTTGAAAAGTTCTATTTTCACTTTTATTGTTTCAATTGTCTGATAACATTTCAGCAGTATTTAGAACAAAAGGTATGTAGTGTATCTCAGTAGGCTAAACTAGCAGGACACAATTATGTTCCACAAATCTCTCACCAGCTGCACAATATAGAGGCTCTTGCTATTTGAACCTTTTTGCACATAATAAAAGTTAAAGATTTTGCTAGTTTAGTTTACAACGGATAATTATCCCCCCCAATATGTAAACTGTGAGGAGTCTCTTTTTTATTTGTCAATTAGATTTCTTTGCAATAACAACTCTTCACTTATTTTAAATGCTTGTTTTATACGTTCGTGTGGCTTTCGTTGTAATACCTTCATGAACGTTTGTATATTAGATTGTACATTTGGAATTTAAAGCTTAGCAATTGTAGAAAATTCATTAAAAAAAGATAAAAAACGACAATCAAATGTGTACAAATTGAAAAAAAAAAAAAAGAAGCCCAGTGTTTTTTTGAGTTGAAACACGAAGTATTCTTTAGAAAGGGCTTTTTTAAAACTATGACATTTCGTTTACAGGGTAAGCCTACAGTATTATGAAGGGTTAATTAATATAGGTTGAAATGTTGCATTTTTTTTTTTTAATTTATGACGAATGGAAGTTCAGTGGTGACAATTATTAGCAATGTAATGCAGGCGAGGGTGGAAGGGGCGGTTGTACAGACCCACGGTTATCTGATTATTTTCTATTCAAAGCAATTCTCTTCCTACGCATCCCTGTTTGTTTGGCTAGCTAACATAACTCCTACACTTAACCATGAAAAGAGATCAAATTCCTGTTGAGTGAATATCTGACCTTTAATGTTTTGGTTAAAAAAGGAAAACAGTCAGCCCACTTCAGCACAAGGATACAAATGAACGCACCAACTACGTGTTTATTGTTTTATGAAGTGCAGGAATCACAAATGCAGAGCCATTCACTGTACAACTGCAAAGCATTAATTTGTCCCAATAAAATGGAAGT
                                                  Xt7.1-CHK-1008236334                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGACTAGTATTAGCCAGCGCGTCATGCAAAAGGTGTTTTGTTTTTTTAATTATTTTTGACCAAATGAGTAGAAAATGGGGATTATGACTTGCTTAxxxxxxATTTCAGAAAAAAAAAGTTAATTTATGAATTATTTAGCAGTGTCGGAGATGCATTGATATAAGTGCAACGTATTTATTATTTTTAAGGGCAAAACTATTATTTCTTTGTTATATTTTGTATCATTATTTATCCTTGTCTTATTGTATTTATGTGGATGATTGTGAAATTTAATCAGTGCAACTTGGAAAAATGAATCAAGCCCATTGTGGCTACATTTTCTTCTACGTAATTAAAACACCAGAGACTTTAGAGTTGTAATTGCGACTGGTGTTTGAGCCTCAAGATATCCTTGATGTTAAATTTAAGGCAGAAATGTGAATTTCCGCTGAAAATGTAGCTTTTTTCCACAATGGGCCTTTGACATTTTGAAAAGTTCTATTTTCACTTTTATTGTTTCAATTGTCTGATAACATTTCAGCAGTATTTAGAACAAAAGGTATGTAGTGTATCTCAGTAGGCTAAACTAGCAGGACACAATTATGTTCCACAAATCTCTCACCAGCTGCACAATATAGAGGCTCTTGCTATTTGAACCTTTTTGCACATAATAAAAGTTAAAGATTTTGCTAGTTTAGTTTACAACGGATAATTATCCCCCCCAATATGTAAACTGTGAGGAGTCTCTTTTTTATTTGTCAATTAGATTTCTTTGCAATAACAACTCTTCACTTATTTTAAATGCTTGTTTTATACGTTCGTGTGGCTTTCGTTGTAATACCTTCATGAACGTTTGTATATTAGATxxxxxxTTTGGAATTTAAAGCTTAGCAATTGTAGAAAATTCATTAAAAAAAGATAAAAAACGACAATCAAATGTGTACAAATTGAAAAAAAAAAAAAAGAAGCCCAGTGTTTTTTTGAGTTGAAACACGAAGTATTCTTTAGAAAGGGCTTTTTTAAAACTATGACATTTCGTTTACAGGGTAAGCCTACAGTATTATGAAGGGTTAATTAATATAGGTTGAAATGTTGCATTTTTTTTTTTTAATTTATGACGAATGGAAGTTCAGTGGTGACAATTATTAGCAATGTAATGCAGGCGAGGGTGGAAGGGGCGGTTGTACAGACCCACGGTTATCTGATTATTTTCTATTCAAAGCAATTCTCTTCCTACGCATCCCTGTTTGTTTGGCTAGCTAACATAACTCCTACACTTAACCATGAAAAGAGATCAAATTCCTGTTGAGTGAATATCTGACCTTTAATGTTTTGGTTAAAAAAGGAAAACAGTCAGCCCACTTCAGCACAAGGATACAAATGAACGCACCAACTACGTGTTTATTGTTTTATGAAGTGCAGGAATCACAAATGCAGAGCCATTCACTGTACAACTGCAAAGCATTAATTTGTCCCAATAAAATGGAAGTTACAAC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                        2     4     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     4     2     3     2     3     2     3     2     4     3     5     3     5     3     5     3     5     5     6     4     5     4     5     5     5     4     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5
                                                    Xt7.1-TTbA035c12.3                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGATG---TAG---TAG---------------------------------TAA---------------TGA---------------------------ATG---TAA---------------------------------------------------------TAA---------------------TAA---------------------------------------------------------------ATG---ATG---------------------------------TGA---------------------------------TAA------------------TAG------------------------------------------ATG------------------------------------ATGTAG------------ATG------TGA---------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------TGA------------------------------------------------------TAA------------------------TGA------------------------TAG------------TAA------------------------------------------------------TAA---------------------------ATG---------------------------------------------------TAA---------------------------------------------------------------------------------------------------------ATG---------------------------------TGA---------TAA------------------------------TAA---ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------TGA---------TGA------ATG---------------------------------------------------TGA---------------------------ATG---------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               [ open reading frame                                                                                                                                                                           ]
  5   1   2       bld Tad5                                 XZT42323.5p GTTGTGCAGCTCAGATTCCAGGCAACCACCACCACGGACCGTGTGACCCCCACCCCACATACACAGATCTAAGTTCCCATCACACAACTCAGGGAAGGATGCAGGAGGCCCCCAAACTCACACATCTGTAAGAAACTGTTGGCAGAAGGGAGAAAGAGAAAGAAAGAGCAGCGATATAAAACGTACTCCTTTTAATTACCTCACTTTTTTTCTGAATGGAAATTAATGTACCTTATTGTGATTGTGCCAACGGCTGGAAGGAGGGTCTGGGCTTCTTCAGCAGATCCATCCCTTCCTCCAGACCCTGTAACTAGCCCACCAAGCAATGGACTTTCCTAGGTACTATAAGCATGACAGTGCAATAAAGTGAGAACTAAGGCACAATAAAACTTTAAATAATGTACTTGAAGGTAAGTCTCTTAGATGGACTAGTATTAGCCAGCGCGTCATGCAAAAGGTGTTTTGTTTTTTTAATTATTTTTGACCAAATGAGTAGAAAATGGGGATTATGACTTGCTTATGATCTAATTTCAGAAAAAAAAGTTAATTTATGAATTATTTAGCAGTGTCGGAGATGCATTGATATAAGTGCAACGTATTTATTATTTTTAAGGGCAAAACTATTATTTCTTTGTTATATTTTGTATCATTATTTATCCTTGTCTTATTGTATTTATGTGGATGATTGTGAAATTTAATCAGTGCAACTTGGAAAAATGAATCAAGTCCATTGTGGCTACATTTTCTTCTACGTAATTAAAACACCAGAGACTTTAGAGTTGTAATTGCGACTGGTGTTTGAGCCTNCAGATATCC
  5   1   2       bld TbA       in                   TTbA035c12.p1kSP6                                                                                                                                                                                                                       ATGGAAATTAATGTACCTTATTGTGATTGTGCCAACGGCTGGAAGGAGGGTCTGGGCTTCTTCAGCAGATCCATCCCTTCCTCCAGACCCTGTAACTAGCCCACCAAGCAATGGACTTTCCTAGGTACTATAAGCATGACAGTGCAATAAAGTGAGAACTAAGGCACAATAAAACTTTAAATAATGTACTTGAAGGTAAGTCTCTTAGATGGACTAGTATTAGCCAGCGCGTCATGCAAAAGGTGTTTTGTTTTTTTAATTATTTTTGACCAAATGAGTAGAAAATGGGGATTATGACTTGCTTATGATCTAATTTCAGAAAAAAAAAGTTAATTTATGAATTATTTAGCAGTGTCGGAGATGCATTGATATAAGTGCAACGTATTTATTATTTTTAAGGGCAAAACTATTATTTCTTTGTTATATTTTGTATCATTATTTATCCTTGTCTTATTGTATTTATGTGGATGATTGTGAAATTTAATCAGTGCAACTTGGAAAAATGAATCAAGCCCATTGTGGCTACATTTTCTTCTACGTAATTAAAACACCAGAGACTTTAGAGTTGTAATTGCGACTGGTGTTTGAGCCTCAAGATATCCTTGATGTTAAATTTAAGGCAGAAATGTGAATTTCCGCTGAAAATGTAGCTTTTTTCCACAATGGGCCTTTGACATTTTGAAAAGTTCTATTTTCACTTTTATTGTTTCAATTGTCTGATAACATTTCAGCAGTATTTAGAAACAAAGGTATGTAGTGTATCTCAGTAGGCTAAACTAGCAGGACACAATTATG
  5   1   2       bld Tad5      in                         XZT61905.5p                                                                                                                                                                                                                                                                                                                   CTGTAACTAGCCCACCAAGCAATGGACTTTCCTAGGTACTATAAGCATGACAGTGCAATAAAGTGAGAACTAAGGCACAATAAAACTTTAAATAATGTACTTGAAGGTAAGTCTCTTAGATGGACTAGTATTAGCCAGCGCGTCATGCAAAAGGTGTTTTGTTTTTTTAATTATTTTTGACCAAATGAGTAGAAAATGGGGATTATGACTTGCTTATGATCTAATTTCAGAAAAAAAAAGTTAATTTATGAATTATTTAGCAGTGTCGGAGATGCATTGATATAAGTGCAACGTATTTATTATTTTTAAGGGCAAAACTATTATTTCTTTATATTTTGTATCATTATTTATCCTTGTCTTATTGTATTTATGTGGATGATTGTGAAATTTAATCAGTGCAACTTGGAAAAATGAATCAAGCCCATTGTGGCTACATTTTCTTCTACGTAATTAAAACACCAGAGACTTTAGAGTTGTAATTGCGACTGGTGTTTGAGCCTCAAGATATCCTTGATGTTAAATTTAAGGCAGAAATGTGAATTTCCGCTGAAAATGTAGCTTTTTTCCACAATGGGCCTTTGACATTTTGAAAAGTTCTATTTTCACTTTTATTGTTTCAATTGTCTGATAACATTTCAGCAGTATTTAGAACAAAAGGTATGTAGTGTATCTCAGTAGGCTAAACTAGCAGGACACAATTATGTTCCACAAATCTCTCACCAGCTGCACAATATAGAGGCTCTTGCTATTTGAACCTTTTTGCACATAATAAAAGTTAAAGATTTTGCTAGTTTAGTTTACAACGGATAATTATC
  5   1   2      skin Tad5                                 XZT27075.5p                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCTTAGATGGACTAGTATTAGCCAGCGCGTCATGCAAAAGGTGTTTTGTTTTTTTAATTATTTTTGACCAAATGAGTAGAAAATGGGGATTATGACTTGCTTATGATCTAATTTCAGAAAAAAAAGTTAATTTATGAATTATTTAGCAGTGTCGGAGATGCATTGATATAAGTGCAACGTATTTATTATTTTTAAGGGCAAAACTATTATTTCTTTGTTATATTTTGTATCATTATTTATCCTTGTCTTATTGTATTTATGTGGATGATTGTGAAATTTAATCAGTGCAACTTGGAAAAATGAATCAAGTCCATTGTGGCTACATTTTCTTCTACGTAATTAAAACACCAGAGACTTTAGAGTTGTAATTGCGACTGGTGTTTGAGCCTCAAGATATCCTTGATGTTAAATTTAAGGCAGAAATGTGAATTTCCGCTGAAAATGTAGCTTTTTTCCACAATGGGCCTTTGACATTTTGAAAAGTTCTATTTTCACTTTTATTGTTTCAATTGTCTGATAACATTTCAGCAGTATTTAGAACAAAAGGTATGTAGTGTATCTCAGTAGGCTAAACTAGCAGGACACAATTATGTTCCACAAATCTCTCACCAGCTGCACAATATAGAGGCTCTTGCTATTTGAACCTTTTTGCACATAATAAAAGTTAAAGATTTTGCTAGTTTAGTTTACAACGGATAATTATCCCCCCCAATATGTAAACTGTGAGGAGTCTCTTTTTTTATTTGTCAATTAGATTTCTTTGNCATAANCACTCTTCACTTATTTTAAATGCTTGTTTTATACGTTC
  3   1   2      skin TbA       in                    TTbA035c12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                     AGATGGACTAGTATTAGCCAGCGCGTCATGCAAAAGGTGTTTTGTTTTTTTAATTATTTTTGACCAAATGAGTAGAAAATGGGGATTATGACTTGCTTATGATCTAATTTCAGAAAAAAAAAGTTAATTTATGAATTATTTAGCAGTGTCGGAGATGCATTGATATAAGTGCAACGTATTTATTATTTTTAAGGGCAAAACTATTATTTCTTTGTTATATTTTGTATCATTATTTATCCTTGTCTTATTGTATTTATGTGGATGATTGTGAAATTTAATCAGTGCAACTTGGAAAAATGAATCAAGCCCATTGTGGCTACATTTTCTTCTACGTAATTAAAACACCAGAGACTTTAGAGTTGTAATTGCGACTGGTGTTTGAGCCTCAAGATATCCTTGATGTTAAATTTAAGGCAGAAATGTGAATTTCCGCTGAAAATGTAGCTTTTTTCCACAATGGGCCTTTGACATTTTGAAAAGTTCTATTTTCACTTTTATTGTTTCAATTGTCTGATAACATTTCAGCAGTATTTAGAACAAAAGGTATGTAGTGTATCTCAGTAGGCTAAACTAGCAGGACACAATTATGTTCCACAAATCTCTCACCAGCTGCACAATATAGAGGCTCTTGCTATTTGAACCTTTTTGCACATAATAAAAGTTAAAGATTTTGCTAGTTTAGTTTACAACGGATAATTATCCCCCCCAATATGTAAACTGTGAGGAGTCTCTTTTTTATTTGTCAATTAGATTTCTTTGCAATAACAACTCTTCACTTATTTTAAATGCTTGTTTTATACGTTCGTGTGGCTTTCGTTGTAATACCTTCATGAACGTTTGTATATTAGATGTACATTTGGAATTTAAAGCTTAGCAATTGTAGAAAATTCATTAAAAAAAAAAAAAAAAAGCG
  5   1   2       bld Tad5                                 XZT44457.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTAGTTTAGTTTACAACGGATAATTATCCCCCCCAATATGTAAACTGTGAGGAGTCTCTTTTTTTATTTGTCAATTAGATTTCTTTGCAATAACAACTCTTCACTTATTTTAAATGCTTGTTTTATACGTTCGTGTGGCTTTCGTTGTAATACCTTCATGAACGTTTGTATATTAGATGTACATTTGGAATTTAAAGCTTAGCAATTGTAGAAAATTCATTAAAAAAAGATAAAAAACGACAATCAAATGTGTACAAATTGAAAAAAAAAAAAAAGAAGCCCAGTGTTTTTTTGAGTTGAAACACGAAGTATTCTTTAGAAAGGGCTTTTTTAAAACTATGACATTTCGTTTACAGGGTAAGCCTACAGTATTATGAAGGGTTAATTAATATAGGTTGAAATGTTGCATTTTTTTTTTTTTAATTTATGAGGAATGGAAGTTCAGTGGTGACAATTATTAGCAATGTAATGCAGGCGAGGGTGGAAGGGGCGGTTGTACAGACCCACGGTTATCTGATTATTTTCTATTCAAAGCAATTCTCTTCCTACGCATCCCTGTTTGTTTGGCTAGCTAACATAACTCCTACACTTAACCATGAAAAGAGATCAAATTCCTGTTGAGTGAATATCTGACCTTTAATGTTTTGGTTAAAAAAGGAAAACAGTCAGCCCACTTCAGCACAAGGATACAAATGAACGCACCAACTACGTGTTTATTGTTTTATGAAGTGCAGGAATCACAAATGCAGAGCCATTCACTGTACAACTGCAAAGCATTAATTTGTCCCAATAAAATGGAAGTTACAAC
  3   1   2      seed Tad5      in                         XZT61905.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTAAATGCTTGTTTTATACGTTCGTGTGGCTTTCGTTGTAATACCTTCATGAACGTTTGTATATTAGATGTACATTTGGAATTTAAAGCTTAGCAATTGTAGAAAATTCATTAAAAAAAGATAAAAAACGACAATCAAATGTGTACAAATTGAAAAAAAAAAAAAAGAAGCCCAGTGTTTTTTTGAGTTGAAACACGAAGTATTCTTTAGAAAGGGCTTTTTTAAAACTATGACATTTCGTTTACAGGGTAAGCCTACAGTATTATGAAGGGTTAATTAATATAGGTTGAAATGTTGCATTTTTTTTTTTTAATTTATGACGAATGGAAGTTCAGTGGTGACAATTATTAGCAATGTAATGCAGGCGAGGGTGGAAGGGGCGGTTGTACAGACCCACGGTTATCTGATTATTTTCTATTCAAAGCAATTCTCTTCCTACGCATCCCTGTTTGTTTGGCTAGCTAACATAACTCCTACACTTAACCATGAAAAGAGATCAAATTCCTGTTGAGTGAATATCTGACCTTTAATGTTTTGGTTAAAAAAGGAAAACAGTCAGCCCACTTCAGCACAAGGATACAAATGAACGCACCAACTACGTGTTTATTGTTTTATGAAGTGCAGGAATCACAAATGCAGAGCCATTCACTGTACAACTGCAAAGCATTAATTTGTCCCAATAAAATGGAAGTTACAACGGC
  3   1   2       bld Tad5      in                         XZT71715.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACGCGTCCGAGATGTACATTTGGAATTTAAAGCTTAGCAATTGTAGAAAATTCATTAAAAAAAGATAAAAAACGCCAATCAAATGTGTACAAATTGAAAAAAAAAAAAAAGAAGCCCAGTGTTTTTTTGAGTTGAAACACGAAGTATTCTTTAGAAAGGGCTTTTTTAAAACTATGACATTTCGTTTACAGGGTAAGCCTACAGTATTATGAAGGGTTAATTAATATAGGTTGAAATGTTGCATTTTTTTTTTTTAATTTATGACGAATGGAAGTTCAGTGGTGACAATTATTAGCAATGTAATGCAGGCGAGGGTGGAAGGGGCGGTTGTACAGACCCACGGTTATCTGATTATTTTCTATTCAAAGCAATTCTCTTCCTACGCATCCCTGTTTGTTTGGCTAGCTAACATAACTCCTACACTTAACCATGAAAAGAGATCAAATTCCTGTTGAGTGAATATCTGACCTTTAATGTTTTGGTTAAAAAAGGAAAACAGTCAGCCCACTTCAGCACAAGGATACAAATGAACGCACCAACTACGTGTTTATTGTTTTATGAAGTGCAGGAATCACAAATGCAGAGCCATTCACTGTACAACTGCAAAGCATTAATTTGTCCCAATAAAATGGAAGTTACAACGGCT
  5   1   2       bld Tad5      in                         XZT71715.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGATGTACATTTGGAATTTAAAGCTTAGCAATTGTAGAAAATTCATTAAAAAAAGATAAAAAACGACAATCAAATGTGTACAAATTGAAAAAAAAAAAAAAGAAGCCCAGTGTTTTTTTGAGTTGAAACACGAAGTATTCTTTAGAAAGGGCTTTTTTAAAACTATGACATTTCGTTTACAGGGTAAGCCTACAGTATTATGAAGGGTTAATTAATATAGGTTGAAATGTTGCATTTTTTTTTTTTAATTTATGACGAATGGAAGTTCAGTGGTGACAATTATTAGCAATGTAATGCAGGCGAGGGTGGAAGGGGCGGTTGTACAGACCCACGGTTATCTGATTATTTTCTATTCAAAGCAATTCTCTTCCTACGCATCCCTGTTTGTTTGGCTAGCTAACATAACTCCTACACTTAACCATGAAAAGAGATCAAATTCCTGTTGAGTGAATATCTGACCTTTAATGTTTTGGTTAAAAAAGGAAAACAGTCAGCCCACTTCAGCACAAGGATACAAATGAACGCACCAACTACGTGTTTATTGTTTTATGAAGTGCAGGAATCACAAATGCAGAGCCATTCACTGTACAACTGCAAAGCATTAATTTGTCCCAATAAAATGGAAGTTACAACGGC
  5   1   2       bld TbA                            TTbA027a02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTAAAAAAAGATAAAAAACGACAATCAAATGTGTACAAATTGAAAAAAAAAAAAAAGATGCCCAGTAGTTTTTTCGAGTTGAAACACGAAGTATTCTTTAGAAAGGGCTTTTTTAAAACTATGACATTTCGTTTACAGGGTAAGCCTACAGTATTATGAAGGGTTAATTAATATAGGTTGAAATGTTGCATTTTTTTTTTTAATTTATGACGAATGGAAGTTCAGTGGTGACAATTATTAGCAATGTAATGCAGGCGAGGGTGGAAGGGGCGGTTGTACAGACCCACGGTTATCTGATTATTTTCTATTCAAAGCAATTCTCTTCCTACGCATCCCTGTTTGTTTGGCTAGCTAACATAACTCCTACACTTAACCATGAAAAGAGATCAAATTCCTGTTGAGTGAATATCTGACCTTTAATGTTTTGGTTAAAAAAGGAAAACAGTCAGCCCACTTCAGCACAAGGATACAAATGAACGCACCAACTACGTGTTTATTGTTTTATGAAGTGCAGGAATCACAAATGCAGAGCCATTCACTGTACAACTGCAAAGCATTAATTTGTCCCAATAAAATGGAAGTTACAACGGCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)