Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAO10541.3                          14 END     2          28       14                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012089992 Xt7.1-CBXT3704.5 - 7 ESTs
                                                                       ....-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CBXT3704.5                                                                                                                                                                                                                                                                         AAAACACTAGAAAACCTCAATGTACAGTTAGAGGAAAGTAAAAGAATGGAGAAATCTAAGAGTAACAGCCAAGCCATTTTTAAACGCTACCTTAATAAGATGTTGATTGAGGCTGGACGCATAGGACTTCCAGATGAATCTTACCCTGATGCTCACTATGATGCACAGGTTGTGTTCACAGTGGAGATGCTAGCAGAAATTCAGAGTTTCCTTAATGATGGAGACTGGAATGTGGGAGCACTTGATGATGCGCTGAGCAGCACTTTAGTGCAATTCAAGCACCATAATGAGGAAGAGTGGAAGTGGAAATTTGAGGACAGTTTTGGAATAGATGTATACACATTATTTATGCTCATCCTATGCGTGTTGTGCTTAGTTATGCTGATAGCCACAGAGATCTGGACTTATATTGCTTTGTTCACCCAGTTAAAACGCCTCCTTATGTTGAGCACTGTCATCAGCTTTGGCTGGAACTGGATGTACTTATATAGGGTTGCCTTTGCTGAGCGCCAGGCAGAACTAGCAAAGATGCAAAACTTTGACAAATGCAGTGAGAAGATCAGCTGGTCCGAAAGCCTGTTTGATTGGCTGAAGGGAGCTGCCACATTCCAAAATGATCCTTGTGAGGATTACTTTAAAGCTTTGATAGTTAGTCCTACGCTGATGGTCCCACCTACTAAGGCACTTGCCCTCACATTTACCAACTTTGTAACAGAACCACTCAAACATATCGGAAAAGGAATTGGGGAGTTTTTGAATGCTTTGCTATCAGAGATCCCTTTATTTTTTCAAGTTCCTGTACTCATTTTTATTGCAGTTCTTTTGGTGGCATTCTTTTATGGGGCTGGCACAGCCGTCATGAACCCAATAAACCATTTCAGGCGATTACCAGGCCCAGACAGAGAGAGACCATTGCCTGTAGAGCCTGCAAGGCCAAATCAGAATAGGTTTATTGAGGATGTGCACCCACCAGCTCCCCAGGGTGGGCACCACAACCAGCTACCTCCAGGAGAGAGGGGCAGAGACAACGATTTGCCAGGTCGTGAAAGAGAGAGAACTTTGCCTATAGAGCCTGCAAGGCAACATCTAAATGGTTTTATTGAAGATTTGCGTGCACCACTTCCCCAGGGTGGGCACAACAACCTGCTACCCCAAATGGTGAAGAGCAGTGACAGTGATGAGGTGAATATGCAAAGGCAACAACCTCCTGATGATACAGATGGCAGCAACAGTGCACCAGTGATCACTTTTGCAGCTCCAGCGGATGCAGAGCAAGTTACAAGTGACAATACAAGACGGCCCTTGGATAAGGAAGAGCACTCGGTAAAGGAATCTGTACAAGAAACAGGGTATGATGACAGGCCAGAAACAGAGAGCCCTGAGGCTGAAGCACAAATACATCAAAGTCCTGGTGTGGAAACCCTGAGA
                                                  Xt7.1-CHK-1008239628                                                                                                                                                                                                                                                                               CTAGAAAACCTCAATGTACAGTTAGAGGAAAGTAAAAGAATGGAGAAATCTAAGAGTAACAGCCAAGCCATTTTTAAACGCTACCTTAATAAGATGTTGATTGAGGCTGGACGCATAGGACTTCCAGATGAATCTTACCCTGATGCTCACTATGATGCACAGGTTGTGTTCACAGTGGAGATGCTAGCAGAAATTCAGAGTTTCCTTAATGATGGAGACTGGAATGTGGGAGCACTTGATGATGCGCTGAGCAGCACTTTAGTGCAATTCAAGCACCATAATGAGGAAGAGTGGAAGTGGAAATTTGAGGACAGTTTTGGAATAGATGTATACACATTATTTATGCTCATCCTATGCGTGTTGTGCTTAGTTATGCTGATAGCCACAGAGATCTGGACTTATATTGCTTTGTTCACCCAGTTAAAACGCCTCCTTATGTTGAGCACTGTCATCAGCTTTGGCTGGAACTGGATGTACTTATATAGGGTTGCCTTTGCTGAGCGCCAGGCAGAACTAGCAAAGATGCAAAACTTTGACAAATGCAGTGAGAAGATCAGCTGGTCCGAAAGCCTGTTTGATTGGCTGAAGGGAGCTGCCACATTCCAAAATGATCCTTGTGAGGATTACTTTAAAGCTTTGATAGTTAGTCCTACGCTGATGGTCCCACCTACTAAGGCACTTGCCCTCACATTTACCAACTTTGTAACAGAACCACTCAAACATATCGGAAAAGGAATTGGGGAGTTTTTGAATGCTTTGCTATCAGAGATCCCTTTATTTTTTCAAGTTCCTGTACTCATTTTTATTGCAGTTCTTTTGGTGGCATTCTTTTATGGGGCTGGCACAGCCGTCATGAACCCAATAAACCATTTCAGGCGATTACCAGGCCCAGACAGAGAGAGACCATTGCCTGTAGAGCCTGCAAGGCCAAATCAGAATAGGTTTATTGAGGATGTGCACCCACCAGCTCCCCAGGGTGGGCACCACAACCAGCTACCTCCAGGAGAGAGGGGCAGAGACAACGATTTGCCAGGTCGTGAAAGAGAGAGAACTTTGCCTATAGAGCCTGCAAGGCAACATCTAAATGGTTTTATTGAAGATTTGCGTGCACCACTTCCCCAGGGTGGGCACAACAACCTGCTACCCCAAATGGTGAAGAGCAGTGACAGTGATGAGGTGAATATGCAAAGGCAACAACCTCCTGATGATACAGATGGCAGCAACAGTGCACCAGTGATCACTTTTGCAGCTCCAGCGGATGCAGAGCAAGTTACAAGTGACAATACAAGACGGCCCTTGGATAAGGAAGAGCACTCGGTAAAGGAATCTGTACAAGAAACAGGGTATGATGACAGGCCAGAAACAGAGAGCCCTGAGGCTGAAGCACAAATACATCAAAGTCCTGGTGTGGAAACCCTGAGAAGCACA
                                                      consensus depths                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2
                                                                                                                                      PREDICTED - Gg ---- 3e-094     XP_422186.2 PREDICTED: similar to Clcc1 protein [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                             PREDICTED - Mm ---- 1e-096     NP_663518.1 Mid-1-related chloride channel 1; similar to Mid-1-related chloride channel 1[Mus musculus] ------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                   PROTEIN --- Hs ---- 3e-099     NP_001041675.1 Mid-1-related chloride channel 1 isoform 1 [Homo sapiens] ----------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Xl ---- 0          CAA63477.1 unknown transmembrane protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - ?? ---- 0          NP_001081605.1 hypothetical protein LOC397947 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CBXT3704.5                                                                                                                                                                                                                                                                                                                      ATG---------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG------------------------------------------------------------ATG---------------------------------ATG------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ...
  5   1   2       bld Egg       out                  TEgg038m01.p1kSP6                                                                                                                                                 CCGGAGTGCGGGAGCAAATGACCTCCGCATATGCTCCGTCATCCCTGAACGCAGGCCGAGTGATCAACATCGGGATGTGCGCACATAACATGCGTCAGCAAAATATCAGTGAATGTGAAAAAAACACTAGAAAACCTCAATGTACAGTTAGAGGAAAGTAAAAGAATGGAGAAATCTAAGAGTAACAGCCAAGCCATTTTTAAACGCTACCTTAATAAGATGTTGATTGAGGCTGGACGCATAGGACTTCCAGATGAATCTTACCCTGATGCTCACTATGATGCACAGGTTGTGTTCACAGTGGAGATGCTAGCAGAAATTCAGAGTTTCCTTAATGATGGAGACTGGAATGTGGGAGCACTTGATGATGCGCTGAGCAGCACTTTAGTGCAATTCAAGCACCATAATGAGGAAGAGTGGAAGTGGAAATTTGAGGACAGTTTTGGAATAGATGTATACACATTATTTATGCTCATCCTATGCGTGTTGTGCTTAGTTATGCTGATAGCCACAGAGATCTGGACTTATATTGCTTTGTTCACCC
  5   1   2       bld Egg                            TEgg082d07.p1kSP6                                                                                                                                                 GCCGGGGGCGCCGGGGGGAAAAATAAACCCCAGGATGCTACAATCCAGCCTGCACAGAAAGCAAATGAACAGCATCAAAATGTGGACATAACATGGTCAGCAAAATATCAGGAATGTAAAAAAACACTAGAAAACCTCAATGTACAGTTAGAGGAAAGTAAAAGAATGGAGAAATCTAAGAGTAACAGCCAAGCCATTTTTAAACGCTACCTTAATAAGATGTTGATTGAGGCTGGACGCATAGGACTTCCAGATGAATCTTACCCTGATGCTCACTATGATGCACAGGTTGTGTTCACAGTGGAGATGCTAGCAGAAATTCAGAGTTTCCTTAATGATGGAGACTGGAATGTGGGAGCACTTGATGATGCGCTGAGCAGCACTTTAGTGCAATTCAAGCACCATAATGAGGAAGAGTGGAAGTGGAAATTTGAGGACAGTTTTGGAATAGATGTATACACATTATTTATGCTCATCCTATGCGTGTTGTGCTTAGTTATGCTGATAGCCACAGAGATCTGGACTTATATTGCTTTGTTCACCCAGTTAAACGCCTCCTTATGTTGAGCACTGTCATCAGCTTTGGCTGGAACTGGATGTACTTATATAAGGTTGCCTTTGCTGAGCGCCAGGCAGAACTAGCAAAGATGCAAAACTTTGA
  5   1   2       bld Egg       out                  TEgg026g16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTTTTGGAATAGATGTATACACATTATTTATGCTCATCCTATGTGTGTTGTGCTTAGTTATGCTGATAGCCACAGAGATCTGGACTTATATTGCTTTGTTCACCCAGTTAAAACGCCTCCTTATGTTGAGCACTGTCATCAGCTTTGGCTGGAACTGGATGTACTTATATAGGGTTGCCTTTGCTGAGCGCCAGGCAGAACTAGCAAAGATGCAAAACTTTGACAAATGCAGTGAGAAGATCAGCTGGTCCGAAAGCCTGTTTGATTGGCTGAAGGGAGCTGCCACATTCCAAAATGATCCTTGTGAGGATTACTTTAAAGCTTTGATAGTTAGTCCTACGCTGATGGTCCCACCTACTAAGGCACTTGCCCTCACATTTACCAACTTTGTAACAGAACCACTCAAACATATCGGAAAAGGAATTGGGGAGTTTTTGAATGCTTTGCTATCAGAGATCCCTTTATTTTTTCAAGTTCCTGTACTCATTTTTATTGCAGTTCTTTTGGTGGCATTCTTTTATGGGGCTG
  3  -1   2       bld Ova1      out                        CABE2940.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGAAAGATGTATACACATTATTTATGCTCATCCTATGCGTGTTGTGCTTAGTTATGCTGATAGCCACAGAGATCTGGACTTATATTGCTTTGTTCACCCAGTTAAAACGCCTCCTTATGTTGAGCACTGTCATCAGCTTTGGCTGGAACTGGATGTACTTATATAAGGTTGCCTTTGCTGAGCGCCAGGCAGAACTAGCAAAGATGCAAAACTTTGACAAATGCAGTGAGAAGATCAGCTGGTCCGAAAGCCTGTTTGATTGGCTGAAGGGAGCTGCCACATTCCAAAATGATCCTTGTGAGGATTACTTTAAAGCTTTGATAGTTAGTCCTACGCTGATGGTCCCACCTACTAAGGCACTTGCCCTCACATTTACCAACTTTGTAACAGAACCACTCAAACATATCGGAAAAGGAATTGGGGAGTTTTTGAATGCTTTGCTATCAGAGATCCCTTTATTTTTTCAAGTTCCTGTACTCATTTTTATTGCAGTTCTTTTGGTGGCATTCTTTTATGGGGCTGGCACAGCCGTCATGAACCCAATAAACCATTTCAGGCGATTACCAGGCCCAGACAGAGAGAGACCATTGCCTGTAGAGCCTGCAAGGCCAAATCAGAATAGGTTTATTGAGGATGTGCACCCACCAGCTCCCCAGGGTGGGCACCACAACCAGCTACCTCCAGGAGAGAGGGGCAGAGACAACGATTTGCCAGGTCGTGAAAGAGAGAGAACTTTGCCTATAGAGCCTGCAAGGCAACATCTAAATGGTTTTATTGAAGATTTGCGTGCACCACTTCCCCAGGGTGGGCACAACAACCTGCTACCCCAAATGGTGAAGAGCAGTGACAGTGATGAGGTGAATATGCAAA
  5   1   2      seed Tbd1      in                         CBXT3704.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCACATTCCAAAATGATCCTTGTGAGGATTACTTTAAAGCTTTGATAGTTAGTCCTACGCTGATGGTCCCACCTACTAAGGCACTTGCCCTCACATTTACCAACTTTGTAACAGAACCACTCAAACATATCGGAAAAGGAATTGGGGAGTTTTTGAATGCTTTGCTATCAGAGATCCCTTTATTTTTTCAAGTTCCTGTACTCATTTTTATTGCAGTTCTTTTGGTGGCATTCTTTTATGGGGCTGGCTCAGCCGTCATGAACCCAATAAACCATTTCAGGCGATTACCAGGCCCAGAGAGAGAGAGACCATTGCCTGTAGAGCCTGCAAGGCCAAATCAGAATAGGTTTATTGAGGATGTGCACCCACCAGCTCCCCAGGGTGGGCACCACAACCAGCTACCTCCAGGAGAGAGGGGCAGAGACAACGATTTGCCAGGTCGTGAAAGAGAGAGAACTTTGCCTATAGAGCCTGCAAGGCAACATCTAAATGGTTTTATTGAAGATTTGCGTGCACCACTTCCCCAGGGTGGGCACAACAACCTGCTACCCCAAATGGTGAAGAGCAGTGACAGTGATGAGGTGAATATGCAAAGGCAACAACCTCCTGATGATACAGATGGCAGCAACAGTGCACCAGTGATCACTTTTGCAGCTCCAGCGGATGCAGAGCAAGTTACAAGTGACAATACAAGACGGCCCTTGGATAAGGAAGAGCACTCGGTAAAGGAATCTGTACAAGAAACAGGGTATGATGACAGGCCAGAAACAGAGAGCCCTGAGGCTGA
  5   1   2       bld In66                            IMAGE:8962548.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGGGGGTTTGGGCACAAGCCGTCATGAACCCAATAAACCATTTCAGGCGATTACCAGGCCCAGACAGAGAGAGACCATTGCCTGTAGAGCCTGCAAGGCCAAATCAGAATAGGTTTATTGAGGATGTGCACCCACCAGCTCCCCAGGGTGGGCACCACAACCAGCTACCTCCAGGAGAGAGGGGCAGAGACAACGATTTGCCAGGTCGTGAAAGAGAGAGAACTTTGCCTATAGAGCCTGCAAGGCAACATCTAAATGGTTTTATTGAAGATTTGCGTGCACCACTTCCCCAGGGTGGGCACAACAACCTGCTACCCCAAATGGTGAAGAGCAGTGACAGTGATGAGGTGAATATGCAAAGGCAACAACCTCCTGATGATACAGATGGCAGCAACAGTGCACCAGTGATCACTTTTGCAGCTCCAGCGGATGCAGAGCAAGTTACAAGTGACAATACAAGACGGCCCTTGGATAAGGAAGAGCACTTGGTAAAGGAATCTGTACAAGAAACAGGGTATGATGACAGGCCAGAAACAGAGAGCCCTGAGGCTGAAGCACAAATACATCAAAGTCCTGGTGTGGAAACCCTGAGAAGCACAGGGACAGAACTGTGCTCTAAGCATATGGATTCAAGACAGAGATGCACATGAACATATAGATGGAATAATTGAAGGGCAAAAAGAGCACAGGCCAATATGAAAGAGGCCAGAAACGCAACTGCCAGTGGAAATATGGACTTCACAAATGATCTGATGATGGAGAGAGCCAGTATTATGAACCCAGCCCTAGAGTGACTACTGACACTAAACTTTCATGTGCTTTCCTTTGCTTAACATCAACATAAATTCAGTCTGGCTGGTAACATGGCCACACTCTAGCAGG
  3   1   2       bld Tbd1      in                         CBXT3704.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTCAGCCGTCATGAACCCAATAAACCATTTCAGGCGATTACCAGGCCCAGAGAGAGAGAGACCATTGCCTGTAGAGCCTGCAAGGCCAAATCAGAATAGGTTTATTGAGGATGTGCACCCACCAGCTCCCCAGGGTGGGCACCACAACCAGCTACCTCCAGGAGAGAGGGGCAGAGACAACGATTTGCCAGGTCGTGAAAGAGAGAGAACTTTGCCTATAGAGCCTGCAAGGCAACATCTAAATGGTTTTATTGAAGATTTGCGTGCACCACTTCCCCAGGGTGGGCACAACAACCTGCTACCCCAAATGGTGAAGAGCAGTGACAGTGATGAGGTGAATATGCAAAGGCAACAACCTCCTGATGATACAGATGGCAGCAACAGTGCACCAGTGATCACTTTTGCAGCTCCAGCGGATGCAGAGCAAGTTACAAGTGACAATACAAGACGGCCCTTGGATAAGGAAGAGCACTCGGTAAAGGAATCTGTACAAGAAACAGGGTATGATGACAGGCCAGAAACAGAGAGCCCTGAGGCTGAAGCACAAATACATCAAAGTCCTGGTGTGGAAACCCTGAGAAGCACAGTAAGGACCTGTTAGCAAATGATATGCTGCTTAGGCAGCTCCAAATGTGCACCAAGGCTTTTGACTCATGTCAAATGTAAGGCTGTTTGTATTACTAAATGTGGATATATATTATTGTTAAACATTCCTGTTGCTCAGTTTAGAGACATTTATAAAGGAATCAAGAAGACACTTTTAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)