Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 63%

 1012090022 Xt7.1-TTbA079o20.5 - 8 ESTs
                                                                       .....-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTbA079o20.5                                                                                                                                                                                                                                                                                                                                                                                                                      GCCTGCCTGCACCCTGCTCTGCCTGCCTGCCACCTACTCCCCTGCACCCCACACCGTACCCCCCAAAGCCTGGCACTCATGCCTCGATCCTTCCTAGTGGATTCCCTTATCCTAAGGGAGACAAACGAGAAGAAGGTAGAGAGCAGCCCCCCTCTGTTCCCCTATGCAGTGCACCCCACTCACCCACTGCACGGATTGCCAGCCGGGTCCTGCCACTCTCGCAAATCCGGACTCCTCTGTGTCTGCCCAATGTGTGTCACTGCCTCCCACCTACACCCACCTCCACCTGGCATCCCCCTGCTCAAAGCTTCATTCTCTTCCTTTGGCACCCAGTACTGTCCGGCAGGTCTGGGCAGGCAGCACTCAGCCTCTACTGGCATCAACGTTAGCCATGGGCCAGCTCTGTACCAGGCAGCCTACCCACTGCCCGACCCCAGGCAGTTCCACTGCATCTCTGTCGACAGCTCTCCCAGCCAACTGAGCAGCAGTAAGAGGATGCGCACAGCCTTCACCAGCACCCAACTCCTGGAACTGGAGCGGGAATTCGCCTCCAACATGTACCTGTCGCGACTCAGGCGCATTGAAATCGCCACCTACCTGAACCTGTCGGAGAAACAGGTGAAGATCTGGTTCCAAAACAGGAGAGTGAAGCACAAGAAGGAAGGCAAGAGCAGCACCCACAGGGCCAGTCCCCACGGCTGCAAGTGCTCGTCCCTATCCAGCAAGTGCCTGGAGGAGGATGATGAGGATCTGGCTATGTCTCCCAGCTCCTCAGGGAAGGATGACAGGGACCTCTCCCCAAGTCCCTAACCCACAGGACTAGAAGGAAAAAACTCTCAGACAATTAGCACTGCCAATGTAAATGTGTATAATGGCCTTTGTACATAGTGGGATAAATAACTAAATACCAAACAGCCAATGGACAAGCACTGACCCATCAGCACATGATACAGACATTTCCATGTCACCAGCTAATCTCCCTGAGCAAGAAGGGTTCTTATCATTACTAGCAGGGAACCCACCCTACTCTGCTACAGCAAAACTGCATTTGGTTTGGGGGAGATTCGGCCTTCTTCTGAACTACATCTCCCATCATGCACTGACAGCCTTCATTAGCCTTTCCTTCTCAGAAGGTTCTGGGAATTGTAATGAGGCAGACACTGGGCTGTGGGGTTCTGAGGATAGAACAACATCTGTTAATGAATGTACAGAATTTTGCAACAATATAGAAATATTGTAAGATTCTTGAGAATATAAATTTCGTTGGGGAAGGGTGGGGGTATGATCTTTGTATCGTTTGTCAATATCAGAAAGAAAAATATATTTATTTATTTATGTAAAAATGGAAACATAATAATAAAATTCTTT
                                                  Xt7.1-CHK-1008238258                                                                                                                                                                                                                                                                                                                                                                                                                            CTGCACCCTGCTCTGCCTGCCTGCCACCTACTCCCCTGCACCCCACACCGTACCCCCCAAAGCCTGGCACTCATGCCTCGATCCTTCCTAGTGGATTCCCTTATCCTAAGGGAGACAAACGAGAAGAAGGTAGAGAGCAGCCCCCCTCTGTTCCCCTATGCAGTGCACCCCACTCACCCACTGCACGGATTGCCAGCCGGGTCCTGCCACTCTCGCAAATCCGGACTCCTCTGTGTCTGCCCAATGTGTGTCACTGCCTCCCACCTACACCCACCTCCACCTGGCATCCCCCTGCTCAAAGCTTCATTCTCTTCCTTTGGCACCCAGTACTGTCCGGCAGGTCTGGGCAGGCAGCACTCAGCCTCTACTGGCATCAACGTTAGCCATGGGCCAGCTCTGTACCAGGCAGCCTACCCACTGCCCGACCCCAGGCAGTTCCACTGCATCTCTGTCGACAGCTCTCCCAGCCAACTGAGCAGCAGTAAGAGGATGCGCACAGCCTTCACCAGCACCCAACTCCTGGAACTGGAGCGGGAATTCGCCTCCAACATGTACCTGTCGCGACTCAGGCGCATTGAAATCGCCACCTACCTGAACCTGTCGGAGAAACAGGTGAAGATCTGGTTCCAAAACAGGAGAGTGAAGCACAAGAAGGAAGGCAAGAGCAGCACCCACAGGGCCAGTCCCCACGGCTGCAAGTGCTCGTCCCTATCCAGCAAGTGCCTGGAGGAGGATGATGAGGATCTGGCTATGTCTCCCAGCTCCTCAGGGAAGGATGACAGGGACCTCTCCCCAAGTCCCTAACCCACAGGACTAGAAGGAAAAAACTCTCAGACAATTAGCACTGCCAATGTAAATGTGTATAATGGCCTTTGTACATAGTGGGATAAATAACTAAATACCAAACAGCCAATGGACAAGCACTGACCCATCAGCACATGATACAGACATTTCCATGTCACCAGCTAATCTCCCTGAGCAAGAAGGGTTCTTATCATTACTAGCAGGGAACCCACCCTACTCTGCTACAGCAAAACTGCATTTGGTTTGGGGGAGATTCGGCCTTCTTCTGAACTACATCTCCCATCATGCACTGACAGCCTTCATTAGCCTTTCCTTCTCAGAAGGTTCTGGGAATTGTAATGAGGCAGACACTGGGCTGTGGGGTTCTGAGGATAGAACAACATCTGTTAATGAATGTACAGAATTTTGCAACAATATAGAAATATTGTAAGATTCTTGAGAATATAAATTTCGTTGGGGAAGGGTGGGGGTATGATCTTTGTATCGTTTGTCAATATCAGAAAGAAAAATATATTTATTTATTTATGTAAAAATGGAAACATAATAATAAAATTCTTTTTTTTC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                           2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     4     4     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     3     3     2     3     2     2     2     2     2     2
                                               BLH ATG      78     115                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH MIN      78      74                                                                                                                                                                                                                                                                                                                                                                                                                      
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 6e-017     NP_001021164.1 abnormal cell LINeage family member (lin-39) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Xl ---- 2e-019     AAH41731.1 Similar to homeo box A3 [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ci ---- 5e-021     BAE06480.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 4e-022     NP_996087.1 CG11551-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Gg ---- 5e-023     NP_990481.1 Hoxa2 protein [Gallus gallus] --------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Bf ==== 6e-027     AAC39015.1 homeobox protein AmphiGsx [Branchiostoma floridae] ====================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Sp ==== 3e-035     XP_784486.2 PREDICTED: similar to transcription factor Gsx [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = ?? ==== 5e-055     XP_690119.1 PREDICTED: similar to novel homeobox protein [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Hs ==== 4e-102     NP_663632.1 homeobox protein Gsh-1; GS homeo box protein 1 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Mm ==== 5e-103     NP_032204.1 genomic screened homeo box 1 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Dr ==== 2e-106     NP_001012251.1 GS homeobox 1 [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xt ==== 4e-142     ABB05348.1 genomic-screened homeobox 1 [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTbA079o20.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------TAA---------------------------------------------------------------------------TAG---------TAA------------------ATG---------TGA------------TGA------------------------TAA------TGA---------------------------------------------------------------------------------------------------------------------------------TAG------------------------------TAATGA------------------------TGA---TAG------------TAATGAATG------------------------------------------------TAA------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  0   1   1           HeRe FL                   EC2CAA19AG04.FL-Pollet                                                                                                                                                                                                                                                                                                                                    GACTCTGCTGGCCAGCACCCTGCCTCTCACATCGCTCCCAGCCTGGAGGCGCTTCCCTCTACTCTCTGCCTGCCTGCCCCCTGCCTGCCTGCACCCTGCTCTGCCTGCCTGCCACCTACTCCCCTGCACCCCACACCGTACCCCCCAAAGCCTGGCACTCATGCCTCGATCCTTCCTAGTGGATTCCCTTATCCTAAGGGAGACAAACGAGAAGAAGGTAGAGAGCAGCCCCCCTCTGTTCCCCTATGCAGTGCACCCCACTCACCCACTGCACGGATTGCCAGCCGGGTCCTGCCACTCTCGCAAATCCGGACTCCTCTGTGTCTGCCCAATGTGTGTCACTGCCTCCCACCTACACCCACCTCCACCTGGCATCCCCCTGCTCAAAGCTTCATTCTCTTCCTTTGGCACCCAGTACTGTCCGGCAGGTCTGGGTAGGCAGCACTCAGCCTCTACTGGCATCAACGTTAGCCATGGGCCAGCTCTGTACCAGGCAGCCTACCCACTGCCCGACCCCAGGCAGTTCCACTGCATCTCTGTCGACAGCTCTCCCAGCCAATTGAGCAGCAGTAAGAGGATGCGCACAGCCTTCACCAGCACCCAACTCCTGGAACTGGAGCGGGAATTCGCCTCCAACATGTACCTGTCGCGACTCAGGCGCATTGAAATCGCCACCTACCTGAACCTGTCGGAGAAACAGGTGAAGATCTGGTTCCAAAACAGGAGAGTGAAGCACAAGAAGGAAGGCAAGAGCAGCACCCACAGGGCCAGTCCCCACGGCTGCAAGTGCTCGTCCCTATCCAGCAAGTGCCTGGAGGAGGATGATGAGGATCTGGCTATGTCTCCCAGCTCCTCAGGGAAGGATGACAGGGACCTCTCCCCAAGTCCCTAACCCACAGGACTAGAAGGAAAAAACTCTCAGACAATTAGCACTGCCAATGTAAATGTGTATAATGGCCTTTGTACATAGTGGGATAAATAACTAAATACCAAACAGCCAATGGACAAGCACTGACCCATCAGCACATGATACAGACATTTCCATGTCACCAGCTAATCTCCCTGAGCAAGAAGGGTTCTTATCATTACTAGCAGGGAACCCACCCTACTCTGCTACAGCAAAACTGCATTTGGTTTGGGGGAGATTCGGCCTTCTTCTGAACTACATCTCCCATCATGCACTGACAGCCTTCATTAGCCTTTCCTTCTCAGAAGGTTCTGGGAATTGTAATGAGGCAGACACTGGGCTGTGGGGTTCTGAGGATACAACAACATCTGTTAATGAATGTACAGAATTTTGCAACAATATAGAAATATTGTAAGATTCTTGAGAATATAAATTTCGTTGGGGAAGGGTGGGGGTATGATCTTTGTATCGTTTGTCAATATCAGAAAGaataaATATATTTATTTATTTATGTAAAAgatggaaacataataataaaaatttttccc
  5   1   2       bld HeRe FL   in                     EC2CAA19AG04.g1                                                                                                                                                                                                                                                                                                                                    GACTCTGCTGGCCAGCACCCTGCCTCTCACATCGCTCCCAGCCTGGAGGCGCTTCCCTCTACTCTCTGCCTGCCTGCCCCCTGCCTGCCTGCACCCTGCTCTGCCTGCCTGCCACCTACTCCCCTGCACCCCACACCGTACCCCCCAAAGCCTGGCACTCATGCCTCGATCCTTCCTAGTGGATTCCCTTATCCTAAGGGAGACAAACGAGAAGAAGGTAGAGAGCAGCCCCCCTCTGTTCCCCTATGCAGTGCACCCCACTCACCCACTGCACGGATTGCCAGCCGGGTCCTGCCACTCTCGCAAATCCGGACTCCTCTGTGTCTGCCCAATGTGTGTCACTGCCTCCCACCTACACCCACCTCCACCTGGCATCCCCCTGCTCAAAGCTTCATTCTCTTCCTTTGGCACCCAGTACTGTCCGGCAGGTCTGGGTAGGCAGCACTCAGCCTCTACTGGCATCAACGTTAGCCATGGGCCAGCTCTGTACCAGGCAGCCTACCCACTGCCCGACCCCAGGCAGTTCCACTGCATCTCTGTCGACAGCTCTCCCAGCCAATTGAGCAGCAGTAAGAGGATGCGCACAGCCTTCACCAGCACCCAACTCCTGGAACTGGAGCGGGAATTCGCCTCCAACATGTACCTGT
  5   1   2   12  bld Gas7 PIPE in                         XZG19128.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................GCCTGCCTGCACCCTGCTCTGCCTGCCTGCCACCTACTCCCCTGCACCCCACACCGTACCCCCCAAAGCCTGGCACTCATGCCTCGATCCTTCCTAGTGGATTCCCTTATCCTAAGGGAGACAAACGAGAAGAAGGTAGAGAGCAGCCCCCCTCTGTTCCCCTATGCAGTGCACCCCACTCACCCACTGCACGGATTGCCAGCCGGGTCCTGCCACTCTCGCAAATCCGGACTCCTCTGTGTCTGCCCAATGTGTGTCACTGCCTCCCACCTACACCCACCTCCACCTGGCATCCCCCTGCTCAAAGCTTCATTCTCTTCCTTTGGCACCCAGTACTGTCCGGCAGGTCTGGGCAGGCAGCACTCAGCCTCTACTGGCATCAACGTTAGCCATGGGCCAGCTCTGTACCAGGCAGCCTACCCACTGCCCGACCCCAGGCAGTTCCACTGCATCTCTGTCGACAGCTCTCCCAGCCAACTGAGCAGCAGTAAGAGGATGCCCACAGCC
  5   1   2      seed HeRe      in                     EC2CAA38DG02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATTCTCTTCCTTTGGCACCCAGTACTGTCCGGCAGGTCTGGGCAGGCAGCACTCAGCCTCTACTGGCATCAACGTTAGCCATGGGCCAGCTCTGTACCAGGCAGCCTACCCACTGCCCGACCCCAGGCAGTTCCACTGCATCTCTGTCGACAGCTCTCCCAGCCAACTGAGCAGCAGTAAGAGGATGCGCACAGCCTTCACCAGCACCCAACTCCTGGAACTGGAGCGGGAATTCGCCTCCAACATGTACCTGTCGCGACTCAGGCGCATTGAAATCGCCACCTACCTGAACCTGTCGGAGAAACAGGTGAAGATCTGGTTCCAAAACAGGAGAGTGAAGCACAAGAAGGAAGGCAAGAGCAGCACCCACAGGGCCAGTCCCCACGGCTGCAAGTGCTCGTCCCTATCCAGCAAGTGCCTGGAGGAGGATGATGAGGATCTGGCTATGTCTCCCAGCTCCTCAGGGAAGGATGACAGGGACCTCTCCCCAAGTCCCTAACCCACAGGACTAGAAGGAAAAAACTCTCAGACAATTAGCACTGCCAATGTAAATGTGTATAATGGCCTTTGTACATAGTGGGATAAATAACTAAATACCAAACAGCCAATGGACAAGCACTGACCCATCAGCACATGATACAGACATTTCCATGTCACCAGCTAATCTCCCTGAGCAAGAAGGGTTCTTATCATTACTAGCAGGGAACCCACCCTACTCTGCTACAGCAAAACTGC
  5   1   2       bld TbA       in                   TTbA079o20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGCATCTCTGTCGACAGCTCTCCCAGCCAACTGAGCAGCAGTAAGAGGATGCGCACAGCCTTCACCAGCACCCAACTCCTGGAACTGGAGCGGGAATTCGCCTCCAACATGTACCTGTCGCGACTCAGGCGCATTGAAATCGCCACCTACCTGAACCTGTCGGAGAAACAGGTGAAGATCTGGTTCCAAAACAGGAGAGTGAAGCACAAGAAGGAAGGCAAGAGCAGCACCCACAGGGCCAGTCCCCACGGCTGCAAGTGCTCGTCCCTATCCAGCAAGTGCCTGGAGGAGGATGATGAGGATCTGGCTATGTCTCCCAGCTCCTCAGGGAAGGATGACAGGGACCTCTCCCCAAGTCCCTAACCCACAGGACTAGAAGGAAAAAACTCTCAGACAATTAGCACTGCCAATGTAAATGTGTATAATGGCCTTTGTACATAGTGGGATAAATAACTAAATACCAAACAGCCAATGGACAAGCACTGACCCATCAGCACATGATACAGACATTTCCATGTCACCAGCTAATCTCCCTGAGCAAGAAGGGTTCTTATCATTACTAGCAGGGAACCCACCCTACTCTGCTACAGCAAAACTGCATTTGGTTTGGGGGAGATTCGGCCTTCTTCTGAACTACATCTCCCATCATGCACTGACAGCCTTCATTAGCCTTTCCTTCTCAGAAGGTTCTGGGAATTGTAATGAGGCAGACACTGGGNCTGTGGGGGTTCTGAGGATAGAACAACATCTGTTAATGAATGTACAGAATTTTGCAACAATATAGAAATATTGTAAGATTCTTGAGAATA
  3   1   2       bld Gas7 PIPE in                         XZG19128.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAGTGAAGCACAAGAAGGAAGGCAAGAGCAGCACCCACAGGGCCAGTCCCCACGGCTGCAAGTGCTCGTCCCTATCCAGCAAGTGCCTGGAGGAGGATGATGAGGATCTGGCTATGTCTCCCAGCTCCTCAGGGAAGGATGACAGGGACCTCTCCCCAAGTCCCTAACCCACAGGACTAGAAGGAAAAAACTCTCAGACAATTAGCACTGCCAATGTAAATGTGTATAATGGCCTTTGTACATAGTGGGATAAATAACTAAATACCAAACAGCCAATGGACAAGCACTGACCCATCAGCACATGATACAGACATTTCCATGTCACCAGCTAATCTCCCTGAGCAAGAAGGGTTCTTATCATTACTAGCAGGGAACCCACCCTACTCTGCTACAGCAAAACTGCATTTGGTTTGGGGGAGATTCGGCCTTCTTCTGAACTACATCTCCCATCATGCACTGACAGCCTTCATTAGCCTTTCCTTCTCAGAAGGTTCTGGGAATTGTAATGAGGCAGACACTGGGCTGTGGGTTTCTGAGGATAGAACAACATCTGTTAATGAATGTACAGAATTTTGCAACAATATAGAAATATTGTAAGATTCTTGAGAATATAAATTTCGTTGGGGAAGGGTGGGGGTATGATCTTTGTATCGTTTGTCAATATCAGAAAGAAAAATATATTTATTTATTTATGTAAAAATGGAAACATAATAATAAAATTCTTTTTTTTCT
  3   1   2       bld TbA       in                    TTbA079o20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGGAAGGCAAGAGCAGCACCCACAGGGCCAGTCCCCACGGCTGCAAGTGCTCGTCCCTATCCAGCAAGTGCCTGGAGGAGGATGATGAGGATCTGGCTATGTCTCCCAGCTCCTCAGGGAAGGATGACAGGGACCTCTCCCCAAGTCCCTAACCCACAGGACTAGAAGGAAAAAACTCTCAGACAATTAGCACTGCCAATGTAAATGTGTATAATGGCCTTTGTACATAGTGGGATAAATAACTAAATACCAAACAGCCAATGGACAAGCACTGACCCATCAGCACATGATACAGACATTTCCATGTCACCAGCTAATCTCCCTGAGCAAGAAGGGTTTTTATCATTACTAGCAGGGAACCCACCCTACTTTGTTACAGCAAAACTGCATTTGGTTTGGGGGAGATTCGGCCTTTTTTTGAACTACATCTCCCATCATGCACTGACAGCCTTCATTAGCCTTTCCTTCTCAGAAGGTTCTGGGAATTGTAATGAGGCAGACACTGGGCTGTGGGGTTTTGAGGATAGAACAACATCTGTTAATGAATGTACAGAATTTTGCAACAATATAGAAATATTGTAAGATTCTTGAGAATATAAATTTCGTTGGGGAAGGGTGGGGGTATGATCTTTGTATCGTTTGTCAATATCAGAAAGAAAAATATATTTATTTATTTATGTAAAAATGGAAACATAATAATAAAATTCTTTTTTTTCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld HeRe FL   in                     EC2CAA19AG04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGCAGCACCCACAGGGCCAGTCCCCACGGCTGCAAGTGCTCGTCCCTATCCAGCAAGTGCTTGGAGGGAGGATGATGAGGATCTGGCTATGTCTCCCAGCTCCTCAGGGAAGGATGACAGGGACCTCTCCCCAAGTCCCTAACCCACAGGACTAGAAGGAAAAAACTCTCAGACAATTAGCACTGCCAATGTAAATGTGTATAATGGCCTTTGTACATAGTGGGATAAATAACTAAATACCAAACAGCCAATGGACAAGCACTGACCCATCAGCACATGATACAGACATTTCCATGTCACCAGCTAATCTCCCTGAGCAAGAAGGGTTCTTATCATTACTAGCAGGGAACCCACCCTACTCTGCTACAGCAAAACTGCATTTGGTTTGGGGGAGATTCGGCCTTCTTCTGAACTACATCTCCCATCATGCACTGACAGCCTTCATTAGCCTTTCCTTCTCAGAAGGTTCTGGGAATTGTAATGAGGCAGACACTGGGCTGTGGGGTTCTGAGGATACAACAACATCTGTTAATGAATGTACAGAATTTTGCAACAATATAGAAATATTGTAAGATTCTTGAGAATATAAATTTCGTTGGGGAAGGGTGGGGGTATGATCTTTGTATCGTTTGTCAATATCAGAAAGAAGAAATATATTTATTTA
  3   1   2       bld HeRe      in                     EC2CAA38DG02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAATGACCCATCAGCACATGATACAGACATTTCCATGTCACCAGTTAATCTCCCTGAGCAAGAAGGGTTCTTATCATTACTAGCAGGGAACCCACCCTACTCTGCTACAGCAAAACTGCATTTGGTTTGGGGGAGATTCGGCCTTCTTCTGAACTACATCTCCCATCATGCACTGACAGCCTTCATTAGCCTTTCCTTCTCAGAAGGTTCTGGGGATTGTAATGAGGCAGACACTGGGCTGTGGGGTTCTGAGGATACAACAACATCTGTTAATGAATGTACAGAATTTTGCAACAATATAGAAATATTGTAAGATTCTTGAGAATATAAATTTCGTTGGGGAAGGGTGGGGGTATGATCTTTGTATAATTTGTCAATATCAGAAAGAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)