Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-CAAM15300.3                          13 END     2          50       15                PREDICTED: similar to A-kinase anchor protein 13 isoform 2 isoform 11 [Mus musculus]
     2   2.0    0Xt7.1-CAAM16499.5.5                        12 END     1          25        8                MGC81410 protein [Xenopus laevis]
     3   2.0    0Xt7.1-CAAM2883.3                            8 END     1          25       12                A-kinase anchor protein 13 isoform 3 [Homo sapiens]

 This cluster: approximate FL confidence score = 0%

 1012090337 Xt7.1-CAAM2883.5 - 4 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAM2883.5 ATCTGAATGTTGCAAAGAATCTTCAGTAGTCAGAACTGGGGATGAACATAATGCAGACTGCGCTATGTGCAGCCACTCTCAGGGCACAGAGGAAAATATTAATGATATTTCTCCTTCTAACAAAGAAAAGGAAGCAAGTTTAAATTCTGATATCCCATGTAGCAATTGCCTAGAAGAAGCCCCCTCCCTTATGGAAGAAAAGAATGCACAAGGTGACCCTTTTCTAGCAGCCTGTCCCAACGCCCATCTTCAGGCAGAATGCAAATCCCAGGATGTGACATGCTCTATTTCTGAGCAGCGGCTACCACTGTTTGCACAGCTTAGTGCAGAACTCATTGTAGCAGAAGTGCTGCAGGAGATCATAGAAAAGATAGATACCACATCACTTCTTACACAGACTGCACAACAACAGACTGTCTGTCTGAATGAAGATCCTAAGCTTCCACCTGCTGGCCAAGCAGTATCAGTGCAGGAGGATAAAGATCAGTCTGTGTGTACTATAGGAGAGTGTAATAAAGTCACTGACACTCCCTCTACTGCCTCTCTGCTTAGTAATTATAATTCTGTGCAAAACCAGGAAGTATTAGCAGTGGAGGATTCTGTTTGTAGTAATGCAAACACTGACATGCAGAAAAACACTCTAACGTGCAAGCAAAGCAGAGAGCAGTTGCAGGTCAACAATGGCATAGAAGATCAGACAGAGCCTGAACCAAATGTGGTTCTGAACGAAACATTTAAAGACGGGGATCACAGTGAAACATTAACTATTTCAGATGTGGTCCAATGCAACCAGCTTGGCACTGATGGGAGAAATGAACTACCGTTGCTGTGCTCTGATTTCATTGAAAGTTTGTCTGCAGGTTATGGGGAGAATACAACCCAGACGAACACAATAAACCTGAAGGAGTCCACAGATAAAGAATGCGTCTCAGAGCCAACAGAAGAAACTGGATTAAAAATGACTTTAGTAATTACATCTGATAATCTATTGGAATCAGAAATGTTTGTTGCTACTTCTGAAAAGGAGGAGCCTGCAGAAAGTGATTGCAAGGAACC
                                                  Xt7.1-CHK-1008244453       ATGTTGCAAAGAATCTTCAGTAGTCAGAACTGGGGATGAACATAATGCAGACTGCGCTATGTGCAGCCACTCTCAGGGCACAGAGGAAAATATTAATGATATTTCTCCTTCTAACAAAGAAAAGGAAGCAAGTTTAAATTCTGATATCCCATGTAGCAATTGCCTAGAAGAAGCCCCCTCCCTTATGGAAGAAAAGAATGCACAAGGTGACCCTTTTCTAGCAGCCTGTCCCAACGCCCATCTTCAGGCAGAATGCAAATCCCAGGATGTGACATGCTCTATTTCTGAGCAGCGGCTACCACTGTTTGCACAGCTTAGTGCAGAACTCATTGTAGCAGAAGTGCTGCAGGAGATCATAGAAAAGATAGATACCACATCACTTCTTACACAGACTGCACAACAACAGACTGTCTGTCTGAATGAAGATCCTAAGCTTCCACCTGCTGGCCAAGCAGTATCAGTGCAGGAGGATAAAGATCAGTCTGTGTGTACTATAGGAGAGTGTAATAAAGTCACTGACACTCCCTCTACTGCCTCTCTGCTTAGTAATTATAATTCTGTGCAAAACCAGGAAGTATTAGCAGTGGAGGATTCTGTTTGTAGTAATGCAAACACTGACATGCAGAAAAACACTCTAACGTGCAAGCAAAGCAGAGAGCAGTTGCAGGTCAACAATGGCATAGAAGATCAGACAGAGCCTGAACCAAATGTGGTTCTGAACGAAACATTTAAAGACGGGGATCACAGTGAAACATTAACTATTTCAGATGTGGTCCAATGCAACCAGCTTGGCACTGATGGGAGAAATGAACTACCGTTGCTGTGCTCTGATTTCATTGAAAGTTTGTCTGCAGGTTATGGGGAGAATACAACCCAGACGAACACAATAAACCTGAAGGAGTCCACAGATAAAGAATGCGTCTCAGAGCCAACAGAAGAAACTGGATTAAAAATGACTTTAGTAATTACATCTGATAATCTATTGGAATCAGAAATGTTTGTTGCTACTTCTGAAAAGGAGGAGCCTGCAGAAAGTGATTGCAA
                                                      consensus depths      1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1
                                                      Xt7.1-CAAM2883.5                                                                 ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG
                                                                   ORF                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ...
  5   1   2      seed Te3       out                       CAAM15300.5p ATCTGAATGTTGCAAAGAATCTTCAGTAGTCAGAACTGGGGATGAACATAATGCAGACTGCGCTATGTGCAGCCACTCTCAGGGCACAGAGGAAAATATTAATGATATTTCTCCTTCTAACAAAGAAAAGGAAGCAAGTTTAAATTCTGATATCCCATGTAGCAATTGCCTAGAAGAAGCCCCCTCCCTTATGGAAGAAAAGAATGCACAAGGTGACCCTTTTCTAGCAGCCTGTCCCAACGCCCATCTTCAGGCAGAATGCAAATCCCAGGATGTGACATGCTCTATTTCTGAGCAGCGGCTACCACTGTTTGCACAGCTTAGTGCAGAACTCATTGTAGCAGAAGTGCTGCAGGAGATCATAGAAAAGATAGATACCACATCACTTCTTACACAGACTGCACAACAACAGACTGTCTGTCTGAATGAAGATCCTAAGCTTCCACCTGCTGGCCAAGCAGTATCAGTGCAGGAGGATAAAGATCAGTCTGTGTGTACTATAGGAGAGTGTAATAAAGTCACTGACACTCCCTCTACTGCCTCTCTGCTTAGTAATTATAATTCTGTGCAAAACCAGGAAGTATTAGCAGTGGAGGATTCTGTTTGTAGTAATGCAAACACTGACATGCAGAAAAACACTCTAACGTGCAAGCAAAGCAGAGAGCAGTTGCAGGTCAACAATGGCATAGAAGATCAGACAGAGCCTGAACCAAATGTGGTTCTGAACGAAACATTTAAAGACGGGGATCACAGTGAAACATTAACTATTTCAGATGTGGTCCAATGCAACCAGCTTGGCACTGATGGGAGAAATGAACTACCGTTGCTGTGCTCTGATTTC
  3   1   2       bld Gas7      out                        XZG27825.3p                       TCAGTAGTCAGAACTGGGGATGAACATAATGCAGACTGCGCTATGTGCAGCCACTCTCAGGGCACAGAGGAAAATATTAATGATATTTCTCCTTCTAACAAAGAAAAGGAAGCAAGTTTAAATTCTGATATCCCATGTAGCAATTGCCTAGAAGAAGCCCCCTCCCTTATGGAAGAAAAGAATGCACAAGGTGACCCTTTTCTAGCAGCCTGTCCCAACGCCCATCTTCAGGCAGAATGCAAATCCCAGGATGTGACATGCTCTATTTCTGAGCAGCGGCTACCACTGTTTGCACAGCTTAGTGCAGAACTCATTGTAGCAGAAGTGCTGCAGGAGATCATAGAAAAGATAGATACCACATCACTTCTTACACAGACTGCACAACAACAGACTGTCTGTCTGAATGAAGATCCTAAGCTTCCACCTGCTGGCCAAGCAGTATCAGTGCAGGAGGATAAAGATCAGTCTGTGTGTACTATAGGAGAGTGTAATAAAGTCACTGACACTCCCTCTACTGCCTCTCTGCTTAGTAATTATAATTCTGTGCAAAACCAGGAAGTATTAGCAGTGGAGGATTCTGTTTGTAGTAATGCAAACACTGACATGCAGAAAAACACTCTAACGTGCAAGCAAAGCAGAGAGCAGTTGCAGGTCAACAATGGCAAGAAGAGCAAAGAAAAAGAAAAAGACAGGGATAAGACGAAAGAAAAGGACAGGGAACCCAAAGAAAAAGAAAAGGATAAGAAGAGCAAAAAAAAAAAAAAAGG
  5   1   2       bld Te3       out                        CAAM2883.5p                                                                                                                                                                                                       AAAGAATGCACAAGGTGACCCTTTTCTAGCAGCCTGTCCCAACGCCCATCTTCAGGCAGAATGCAAATCCCAGGATGTGACATGCTCTATTTCTGAGCAGCGGCTACCACTGTTTGCACAGCTTAGTGCAGAACTCATTGTAGCAGAAGTGCTGCAGGAGATCATAGAAAAGATAGATACCACATCACTTCTTACACAGACTGCACAACAACAGACTGTCTGTCTGAATGAAGATCCTAAGCTTCCACCTGCTGGCCAAGCAGTATCAGTGCAGGAGGATAAAGATCAGTCTGTGTGTACTATAGGAGAGTGTAATAAAGTCACTGACACTCCCTCTACTGCCTCTCTGCTTAGTAATTATAATTCTGTGCAAAACCAGGAAGTATTAGCAGTGGAGGATTCTGTTTGTAGTAATGCAAACACTGACATGCAGAAAAACACTCTAACGTGCAAGCAAAGCAGAGAGCAGTTGCAGGTCAACAACGGCATAGAAGATCAGACAGAGCCTGAACCAAATGTGGTTCTGAACGAAACATTTAAAGACGGGGATCACAGTGAAACATTAACTATTTCAGATGTGGTCCAATGCAACCAGCTTGGCACTGATGGGAGAAATGAACTACCGTTGCTGTGCTCTGATTTCATTGAAAGTTTGTCTGCAGGTTATGGGGAGAATACAACCCAGACGAACACAATAAACCTGAAGGAGTCCACAGATAAAGAATGCGTCTCAGAGCCAACAGAAGANACTGGATTAAAAATGACTTTAGTAATTACATCTGATAATCTATTGGAATCAGAAATGTTTGTTGCTACTTCTGAAAAGGAGGAGCCTGCAGAAAGTGATTGCAAGGAACCAT
  5   1   2       bld Te3       out                        CAAM5585.5p                                                                                                                                                                                                                                                              GCAGAATGCAAATCCCAGGATGTGACATGCTCTATTTCTGAGCAGCGGCTACCACTGTTTGCACAGCTTAGTGCAGAACTCATTGTAGCAGAAGTGCTGCAGGAGATCATAGAAAAGATAGATACCACATCACTTCTTACACAGACTGCACAACAACAGACTGTCTGTCTGAATGAAGATCCTAAGCTTCCACCTGCTGGCCAAGCAGTATCAGTGCAGGAGGATAAAGATCAGTCTGTGTGTACTATAGGAGAGTGTAATAAAGTCACTGACACTCCCTCTACTGCCTCTCTGCTTAGTAATTATAATTCTGTGCAAAACCAGGAAGTATTAGCAGTGGAGGATTCTGTTTGTAGTAATGCAAACACTGACATGCAGAAAAACACTCTAACGTGCAAGCAAAGCAGAGAGCAGTTGCAGGTCAACAATGGCATAGAAGATCAGACAGAGCCTGAACCAAATGTGGTTCTGAACGAAACATTTAAAGACGGGGATCACAGTGAAACATTAACTATTTCAGATGTGGTCCAATGCAACCAGCTTGGCACTGATGGGAGAAATGAACTACCGTTGCTGTGCTCTGATTTCATTGAAAGTTTGTCTGCAGGTTATGGGGAGAATACAACCCAGACGAACACAATAAACCTGAAGGAGTCCACAGATAAAGAATGCGTCTCAGAGCCAACAGAAGAAACTGGATTAAAAATGACTTTAGTAATTACATCTGATAATCTATTGGAATCAGAAATGTTTGTTGCTACTTCTGAAAAGGAGGAGCCTGCAGAAGTTGATTGCAAGGAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)