Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012091116 Xt7.1-CBSW6669.3 - 11 ESTs
                                                                       -350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CBSW6669.3                                                                                                                                                                                                                                                                                                                                                               ATTAAAGTTCTGTAATTTATTTTTGGGAGTTACATACACCTTTGGTCCAAGCTGGAGGCTCCCTTGATCCTATTATAGATTGAAATTCTGTAATTGGTTTTTAGGGGGTTTATAGACCCTCAGTCAAAGTTGGGGGCTCCTCTGAGACCAAGAAGCATAGGTTTAAGTTCTATTATTCATTTTTGAGAGTTCATGGACCATCAGTAAAAACGGGGGCTCTTCTGAATTGCTTTTAGGAGGCTCATACACCATCAATACAAGTTGGGGGCTCCCCTAATCCCCAGGATTATAAATTGAATTCTGTAATGTTTAGGGAAGTTCCCAGACTTTCAATACAAGTTGGGGGGCTCCTATGATCCAAAAACTTACAGATTAAACGTCTATAATTCCTGTAGAACTTTATTTCCCAAAAGTCCACTAATTTGCACACTGTTTTCGGGCAAAATATACTGATTTTATTCTGACGACGGGACAAGCTTGGAAGGACACGTTTCTCTTTATTCTAAATCCATCTGAACGATACAGAGCGGGAAAAAAAAATCACATATTTTACATATTATTCAAAAATACCTAAAATACATGGAGGTCACATTTATGGGATATCGTGGTCTGCTGTTTTCTATTTCAAAGCTTTTCTGTTTTTTTTGTGACAATATGTATATAAATATATATATATATTCTTTAATACTGCCAGTAATTAAATGTATTTATTTACACATATACTTAGGGGAATTTTTTTTTTTTTTTTTTCACATATAGACATTTTTAGGATTTTTATTTTAAAAAATCCTTTTTGACATTTTATGAATTTTTTTTTTTTTTTTAGAATTTCTTATTCATTTGGTGTCAGGTTTTCTTGGGGTTCTTTATAAGTAATTTAAAGCACATAGTCATGGTCAAGGTACTAAGGTTTCACACGTTACGATATAATGCACTTGAAACAATTCTTTTCATCCCCTGTTTCCGTACAAAAAGGGCATTTTTTAAAAAAAAAACAAAAACAAAAAATTTAAATTAAAGTCCAAACTGAATTCCCTCCCCCCAAAAATGACCCTAAAAAAATACAAGGAAAAATCAAAAATCAATTTTTTCCATCCCTTTATGAAGAATGATGATTACACCGCCGTACTTGCCTTCATGCCACAACAAATATTTATATTTTAGCAGAATTTTTTTTTTTTTTTTTTTTAAAAAGAGATTTAATTTTTACCAATCCAGACTATACATTGGAATTATTTAATGTAAAATATTTTACTTGTCATCAAGAAATGTAAATCTATGTTCTTCTCTTTGTATCTTGTACATGTAATGTACATATTGTGTCGCCCTAATTTGATTTGTATATTTTTACTGGCTTTAAAAAAAAAAAAAAAAAATGCCGCCGAGAGGTACGTGGCCGACGCCATCGTTGAAAGATAGACTATAAAATAATAAAAAAAA
                                                  Xt7.1-CHK-1008235644                                                                                                                                                                                                                                                                                                                                                                     GTTCTGTAATTTATTTTTGGGAGTTACATACACCTTTGGTCCAAGCTGGAGGCTCCCTTGATCCTATTATAGATTGAAATTCTGTAATTGGTTTTTAGGGGGTTTATAGACCCTCAGTCAAAGTTGGGGGCTCCTCTGAGACCAAGAAGCATAGGTTTAAGTTCTATTATTCATTTTTGAGAGTTCATGGACCATCAGTAAAAACGGGGGCTCTTCTGAATTGCTTTTAGGAGGCTCATACACCATCAATACAAGTTGGGGGCTCCCCTAATCCCCAGGATTATAAATTGAATTCTGTAATGTTTAGGGAAGTTCCCAGACTTTCAATACAAGTTGGGGGGCTCCTATGATCCAAAAACTTACAGATTAAACGTCTATAATTCCTGTAGAACTTTATTTCCCAAAAGTCCACTAATTTGCACACTGTTTTCGGGCAAAATATACTGATTTTATTCTGACGACGGGACAAGCTTGGAAGGACACGTTTCTCTTTATTCTAAATCCATCTGAACGATACAGAGCGGGAAAAAAAAATCACATATTTTACATATTATTCAAAAATACCTAAAATACATGGAGGTCACATTTATGGGATATCGTGGTCTGCTGTTTTCTATTTCAAAGCTTTTCTGTTTTTTTTGTGACAATATGTATATAAATATATATATATATTCTTTAATACTGCCAGTAATTAAATGTATTTATTTACACATATACTTAGGGGAATTTTTTTTTTTTTTTTTTCACATATAGACATTTTTAGGATTTTTATTTTAAAAAATCCTTTTTGACATTTTATGAATTTTTTTTTTTTTTTTAGAATTTCTTATTCATTTGGTGTCAGGTTTTCTTGGGGTTCTTTATAAGTAATTTAAAGCACATAGTCATGGTCAAGGTACTAAGGTTTCACACGTTACGATATAATGCACTTGAAACAATTCTTTTCATCCCCTGTTTCCGTACAAAAAGGGCATTTTTTAAAAAAAAAACAAAAACAAAAAATTTAAATTAAAGTCCAAACTGAATTCCCTCCCCCCAAAAATGACCCTAAAAAAATACAAGGAAAAATCAAAAATCAATTTTTTCCATCCCTTTATGAAGAATGATGATTACACCGCCGTACTTGCCTTCATGCCACAACAAATATTTATATTTTAGCAGAATTTTTTTTTTTTTTTTTTTTAAAAAGAGATTTAATTTTTACCAATCCAGACTATACATTGGAATTATTTAATGTAAAATATTTTACTTGTCATCAAGAAATGTAAATCTATGTTCTTCTCTTTGTATCTTGTACATGTAATGTACATATTGTGTCGCCCTAATTTGATTTGTATATTTTTACTGGCTTTAAAAAAAAAAAAAAAAAATGCCGCCGAGAGGTACGTGGCCGACGCCATCGTTGAAAGATAGACTATAAAATAATAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                    2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     4     4     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     3     4     4     4     3     4     3     4     3     4     3     4     3     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     3     3     2     2     2     2     2     2     2     2     1     2     1     2     2     2     1     1     1     1     1     1     1     1     1     2     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     4     4
                                                      Xt7.1-CBSW6669.3                                                                                                                                                                                                                                                                                                                                                                           TAA------------------------------------------------------------TAG------------TAA------------------------------------------------------------------------------------------TGA------ATG---------TAA---------------TGA---------------------------------------------------------------------TGA------TAA------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------TGA---------------------------------------------------------------ATG------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------TAG---------------------TAA---------------------TGA------------------------------------------------------------------TAA---------------------------------------------------TAA------TGA---------------------------------------------TAA------------------------------------------------------------ATG---------------------------------------------------ATG---------------------------------ATG---------------------TAG------------------------TAA---------TAA------------------------------------ATGTAA---------------------------------ATG---------------------------ATG---------------------------------------------------------------------------------------------------------TAG---------TAATAA
  5   1   2       bld TbA                            TTbA058f01.p1kSP6 CCCCGGGCTGATCCCAATGAGTATAGATTAAAGTTCTGTAATTTATTTTTGGAAGGTACATAGACCTTTGGTCCAAGTTGGAGACTCCCTTGATCCTATTATAGATTGAAATTCTGTAATTGGTTTTTAGGGGGCTCATAGACCATCAGTCCAAGTTGGGGGCTCTTCTGATCCCAAGGACTATAGATTAAAGTTCTCTAATTCATTTTTGGGAGGCACATAAACCATTAGTCCAAGTTGGGGGCTCATCTAAAACCAAGGAGCATAGGTTTGAGATCTGTTATTAATTTTTGGAGAGTTCATGGGCCATCAAAAAAAAATGGGGGCTCTTCTGATCCCAAGAAATATAGATTAAAGTTCTGTAATTTATTTTTGGGAGTTACATACACCTTTGGTCCAAGCTGGAGGCTCCCTTGATCCTATTATAGATTGAAATTCTGTAATTGGTTTTTAGGGGGTTTATAGACCCTCAGTCAAAGTTGGGGGCTCCTCTGAGACCAAGAAGCATAGGTTTAACTTCTATTATTCATTTTTGAGAGTTCATGGACCATCACTAAAAACGGGGGCTCTTCTGAATTGCTTTTAGGAGGCTCATACACCATCAATACAAGTTGGGGGCTCCCCT
  5   1   2      seed TpA       in                   TTpA057m17.p1kSP6                                                                                                                                                                                                                                                                                                                                                               ATTAAAGTTCTGTAATTTATTTTTGGGAGTTACATAGACCTTTGGTCCAAGCTGGAGGCTCCCTTGATCCTATTATAGATTGAAATTCTGTAATTGGTTTTTAGGGGGTTTATAGACCCTCAGTCAAAGTTGGGGGCTCCTCTGAGACCAAGAAGCATAGGTTTAAGTTCTATTATTCATTTTTGAGAGTTCATGGACCATCAGTAAAAACGGGGGCTCTTCTGAATTGCTTTTAGGAGGCTCATACACCATCAATACAAGTTGGGGGCTCCCCTAATCCCCAGGATTATAAATTGAATTCTGTAATGTTTAGGGAAGTTCCCAGACTTTCAATACAAGTTGGGGGGCTCCTATGATCCAAAAACTTACAGATTAAACGTCTATAATTCCTGTAGAACTTTATTTCCCAAAAGTCCACTAATTTGCACACTGTTTTCGGGCAAAATATACTGATTTTATTCTGACGACGGGACAAGCTTGGAAGGACACGTTTCTCTTTATTCTAAATCCATCTGAACGATACAGAGCGGGAAAAAAAAATCACATATTTTACATATTATTCAAAAATACCTAAAATACATGGAGGTCACATTTATGGGATATCGTGGTCTGCTGTTTTCTATTTCAAAGCTTTTCTGTTTTTTTTGTGACAATATGTATATAAATATATATATATATTCTTTAATACTGCCAGTAATTAAATGTATTTATTTACACATATACTTAGGGGAATTTTTTTTTTTTTTTTTTCACATATAGACATTTTTAGGATTTTTATTTTAAAAAATCCTTTTTGACATTTTATGAATTTTTTTTTTTTTTTTAGAATTTCTTATTCATTTGGTGTCAGGTTTTCTTGGGGTTCTTTATAAGTAATTTAAAG
  5   1   2       bld Tail      in                         CBSW6669.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGACCATCAGTAAAAACAGGGGCTCTTCTGAATTGCTTTTAGGAGGCTCATACACCATCAATACAAGTTGGGGGCTCCCCTAATCCCCAGGATTATAAATTGAATTCTGTAATGTTTAGGGAAGTTCCCAGACCTTCAATACAAGTTGGGGGGCTCCTATGATCCAAAAATTTACAGATTAAACATCTATAATTCCTGTAGAACTTTATTTCCCAAAAGTCCACTAATTTGCACACTGTTTTCGGGCAAAATATACTGATTTTATTCTGACGACGGGACAAGCTTGGAAGGACACGTTTCTCTTTATTCTAAATCCATCTGAACGATACAGAGCGGGAAAAAAAAAAATCACATATTTTACATATTATTCAAAAATACCTAAAATACATGGAGGTCACATTTATGGGATATCGTGGTCTGCTGTTTTCTATTTCAAAGCTTTTCTGTTTTTTTTGTGACAATATGTATATAAATATATATATATATTCTTTAATACTGCCAGTAATTAAATGTATTTATTTACACATATACTTAGGGGAATTTTTTTTTTTTTTTTCACATATAGACATTTTTAGGATTTTTATTTTAAAAAATCCTTTTTGACATTTTATGAATTTTTTTTTTTTTTTTAGAATTTCTTATTCATTTGGTGTCAGGTTTTCTTGGGGTTCTTTATAAGTAATTTAAAGCACATAGTCATGGTCAAGGTACTAAGGTTTC
  5   1   2       bld Tad5                                 XZT29504.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGATACACCATCAATACAAGTTGGGGGCTCCCCTAATCCCCAGGATTATAAATTGAATTCTGTAATGTTTAGGGAAGTTCCCAGACTTTCAATACAAGTTGGGGGGCTCCTATGATCCAAAAACTTACAGATTAAACGTCTATAATTCCTGTAGAACTTTATTTCCCAAAAGTCCACTAATTTGCACACTGTTTTCGGGCAAAATATACTGATTTTATTCTGACGACGGGACAAGCTTGGAAGGACACGTTTCTCTTTATTCTAAATCCATCTGAACGATACAGAGCGGGAAAAAAAAATCACATATTTTACATATTATTCAAAAATACCTAAAATACATGGAGGTCACATTTATGGGATATCGTGGTCTGCTGTTTTCTATTTCAAAGCTTTTCTGTTTTTTTTGTGACAATATGTATATAAATATATATATATATTCTTTAATACTGCCAGTAATTAAATGTATTTATTTACACATATACTTAGGGGAATTTTTTTTTTTTTTTTTTCACATATAGACATTTTTAGGATTTTTATTTTAAAAAATCCTTTTTGACATTTTATGAATTTTTTTTTTTTTTTTAGAATTTCTTATTCATTTGGTGTCAGGTTTTCTTGGGGTTCTTTATAAGTAATTTAAAGCACATAGTCATGGTCAAGGTACTAAGGT
  3   1   2       bld TpA       in                    TTpA057m17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCAATACAAGTTGGGGGCTCCCCTAATCCCCAGGATTATAAATTGAATTCTGTAATGTTTAGGGAAGTTCCCAGACTTTCAATACAAGTTGGGGGGCTCCTATGATCCAAAAACTTACAGATTAAACGTCTATAATTCCTGTAGAACTTTATTTCCCAAAAGTCCACTAATTTGCACACTGTTTTCGGGCAAAATATACTGATTTTATTTTGACGACGGGACAAGCTTGGAAGGACACGTTTCTCTTTATTCTAAATCCATCTGAACGATACAGAGCGGGAAAAAAAAATCACATATTTTACATATTATTCAAAAATACCTAAAATACATGGAGGTCACATTTATGGGATATCGTGGTTTGCTGTTTTCTATTTCAAAGCTTTTCTGTTTTTTTTGTGACAATATGTATATAAATATATATATATATTCTTTAATACTGCCAGTAATTAAATGTATTTATTTACACATATACTTAGGGGAATTTTTTTTTTTTTTTTTTCACATATAGACATTTTTAGGATTTTTATTTTAAAAAATCCTTTTTGACATTTTATGAATTTTTTTTTTTTTTTTAGAATTTCTTATTCATTTGGTGTCAGGTTTTCTTGGGGTTCTTTATAAGTAATTTAAAGCACATAGTCATGGTCAAGGTACTAAGGTTTCACACGCTACGATATAATGCACTTGAAACAATTCTTTTCATCCCCCTGTTTCCGTACAAAAAGGGCATATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tail      in                         CBSW6669.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAATTTTTTTTTTTTTTTTCACATATAGACATTTTTAGGATTTTTATTTTAAAAAATCCTTTTTGACATTTTATGAATTTTTTTTTTTTTTTTAGAATTTCTTATTCATTTGGTGTCAGGTTTTCTTGGGGTTCTTTATAAGTAATTTAAAGCACATAGTCATGGTCAAGGTACTAAGGTTTCACACGTTACGATATAATGCACTTGAAACAATTCTTTTCATCCCCTGTTTCCGTACAAAAAGGGCATTTTTTAAAAAAAAAACAAAAACAAAAAATTTAAATTAAAGTCCAAACTGAATTCCCTCCCCCCAAAAATGACCCTAAAAAAATACAAGGAAAAATCAAAAATCAATTTTTTCCATCCCTTTATGAAGAATGATGATTACACCGCCGTACTTGCCTTCATGCCACAACAAATATTTATATTTTAGCAGAATTTTTTTTTTTTTTTTTTTTAAAAAGAGATTTAATTTTTACCAATCCAGACTATACATTGGAATTATTTAATGTAAAATATTTTACTTGTCATCAAGAAATGTAAATCTATGTTCTTCTCTTTGTATCTTGTACATGTAATGTACATATTGTGTCGCCCTAATTTGATTTGTATATTTTTACTGGTTTTAAAAAAAAAAAAAAAAAATGCCGCCGAGAGGTACGTGGCCGACGCCATCGTTGAAAGATAGACTATAAAATAATAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT60130.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACGCGTCCGGACCCTAAAAAAATACAAGGAAAAATCAAAAATCAATTTTTTCCATCCCTTTATGAAGAATGATGATTACACCGCCGTACTTGCCTTCATGCCACAACAAATATTTATATTTTAGCAGAATTTTTTTTTTTTTTTTTTTTAAAAAGAGATTTAATTTTTACCAATCCAGACTATACATTGGAATTATTTAATGTAAAATATTTTACTTGTCATCAAGAAATGTAAATCTATGTTCTTCTCTTTGTATCTTGTACATGTAATGTACATATTGTGTCGCCCTAATTTGATTTGTATATTTTTACTGGCTTTAAAAAAAAAAAAAAAAAATGCCGCCGAGAGGTACGTGGCCGACGCCATCGTTGAAAGATAGACTATAAAAT
  5   1   2      skin Tad5      in                         XZT60130.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACCCTAAAAAAATACAAGGAAAAATCAAAAATCAATTTTTTCCATCCCTTTATGAAGAATGATGATTACACCGCCGTACTTGCCTTCATGCCACAACAAATATTTATATTTTAGCAGAATTTTTTTTTTTTTTTTTTTTAAAAAGAGATTTAATTTTTACCAATCCAGACTATACATTGGAATTATTTAATGTAAAATATTTTACTTGTCATCAAGAAATGTAAATCTATGTTCTTCTCTTTGTATCTTGTACATGTAATGTACATATTGTGTCGCCCTAATTTGATTTGTATATTTTTACTGGCTTTAAAAAAAAAAAAAAAAAATGCCGCCGAGAGGTACGTGGCCGACGCCATCGTTGAAAGATAGACTATAAAATAATAAAAAAAAAAAAAAAGG
  5   1   2       bld Neu                            TNeu048d11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTTTTTTTTTTTTTTTTTTTTTTAGGCGATCTTTCAACGATGGCGTCGGCCACGTACCTCTCGGCGGCATTTTTTTTTTTTTTTTTTTAAAAAGAGATTTAATTTTTACCAATCCAGACTATACATTGGAATTATTTAATGTAAAATATTTTACTTGTCATCAAGAAATGTAAATCTATGGTGTGTGGCTTTGTATCTTGTTCATGTCATGTGCATATTGGGCCCCCCTCATTGGGTTGGCCTCTTTTTACTGGCTTTAAAAGAT
  3  -1   2       bld TpA       in                    TTpA059g22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTTTTTTTTTTTTTTTTTTTAAAAGAGATTTAATTTTTACCAATCCAGACTATACATTGGAATTATTTAATGTAAAATATTTTACTTGTCATCAAGAAATGTAAATCTATGTTCTTCTCTTTGTATCTTGTACATGTAATGTACATATTGTGTCGCCCTAATTTGATTTGTATATTTTTACTGGCTTTAAAAAAAAAAAAAAAAAATGCCGCCGAGAGGTACGTGGCCGACGCCATCGTTGAAAGATAGACTATAAAATAATAAAAAAAAAAAAAATT
  5  -1   2       bld TpA       in                   TTpA059g22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAAAGAGATTTAATTTTTACCAATCCAGACTATACATTGGAATTATTTAATGTAAAATATTTTACTTGTCATCAAGAAATGTAAATCTATGTTTTTCTCTTTGTATCTTGTACATGTAATGTACATATTGTGTCGCCCTAATTTGATTTGTATATTTTTACTGGCTTTAAAAAAAAAAAAAAAAAATGCCGCCGAGAGGTACGTGGCCGACGCCATCGTTGAAAGATAGACTATAAAATAATAAAAAAAAAAAAAATTAAAAAAAAAAAAAAAAAAAACCCNGGGGCCCCGGGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)