Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012091871 Xt7.1-CAAL8395.3 - 7 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAL8395.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATGAAGAAAGGTATTTGCCCCATATGTTTTAAGAACGAAATGGACTTCTGGAGAGTGGACTTGGACTTGCTGGATGACTGTTGCAAGAGCCACCTGAACGAGAAGAACCTGGAGTTGGAGGAGATAGCCAAGAGAGTGCAAACCATACTGGATGATCTAGGAGGGGACACATCGGAAAGTAAATGGAAAAGGTTCCAGAAATGTCTCTGGAAGTTCATGGAGAAGCCAGAATCCTCCTTCCCAGCCAGAATAACTGCTATTCTCTCTTTTCTTTTCATCTTAATCTCCTCCACTGTAATGTGCATAGGGACCATACCAGAGATGCAAGTTGAGGACCTGCAGGGCAACCATGTGGAGCACCCTACTCTGGATAGCATTGAGACTGTCTGTATTGGGTGGTTCACCTTGGAGTACCTACTGAGGCTGATCTCATCACCCAACAGGCTACATTTTGCCCTCTCATTCATGAACATCATTGATGTCCTGGCTATTCTCCCCTTCTATGTCAGCATTATCTTGACTAACCTAGGGGCCACCATTATGGGACTCACTAATGTCCAGCAGGCTATCCAGGCTCTCAGAATTATGAGAATTGCCAGGATTTTCAAGCTAGCGCGCCATTCCTCAGGGCTGCAGACACTAACCTATGCCCTTAAGAGTAGTTTTAAGGAGCTTGGACTACTATTAATGTATTTAGCCGTGGGGATATTTGTCTTCTCAGCCTTGGGATACACTATGGAACAGAGTCATCCTGACACTCTGTTTAAAAGCATACCCCAGTCATTCTGGTGGGCAATCATCACTATGACCACTGTTGGCTATGGAGACATCTACCCTAAAACCACCCTGGGAAAACTCAATGCCGCCACAAGTTTTCTCTGTGGGGTTATTGCCATTGCCCTCCCAATCCACCCCATCATCAACAATTTTGTGAAGTACTACAACAAGCAGAGAGTACTGGAGACAGCTACCAAACATGAACTGGAACTTATGGAGCTTCATTCCAACGGTGGGTATTTGGGAACCAATGGAAGTTCTAAGGAGCTGTCTGAAGGCAGAGGTCTGTCGGTCGGAGCTCACATGAAGGTTTCTCACAGCGATACATTCATCCAGGCTCTGACAGAGGAGAAACACCACAGAACGAGGCTTCAGAGCTGCAAATAAAACTTATCAGCTTACTCGAACGCTAAAGAAGCAGCAGTGGTTAAAAAACCCTCCTCAAGGGTTCCGGGGACTATTGGGTCACATTTCTTATACAGCAGCAAATCATATCAGATGCAATTCTTTTCCAGAACCAATGAAAACATCCAGATTGTCCTGTGTAAAGACCTACCTAAGTGTCAGTTTTGTGGTATGTACAGCTATTTATGTATGTGACTTGAATAAAAGAAAATGTGTTATTAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008239730                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAAGGTATTTGCCCCATATGTTTTAAGAACGAAATGGACTTCTGGAGAGTGGACTTGGACTTGCTGGATGACTGTTGCAAGAGCCACCTGAACGAGAAGAACCTGGAGTTGGAGGAGATAGCCAAGAGAGTGCAAACCATACTGGATGATCTAGGAGGGGACACATCGGAAAGTAAATGGAAAAGGTTCCAGAAATGTCTCTGGAAGTTCATGGAGAAGCCAGAATCCTCCTTCCCAGCCAGAATAACTGCTATTCTCTCTTTTCTTTTCATCTTAATCTCCTCCACTGTAATGTGCATAGGGACCATACCAGAGATGCAAGTTGAGGACCTGCAGGGCAACCATGTGGAGCACCCTACTCTGGATAGCATTGAGACTGTCTGTATTGGGTGGTTCACCTTGGAGTACCTACTGAGGCTGATCTCATCACCCAACAGGCTACATTTTGCCCTCTCATTCATGAACATCATTGATGTCCTGGCTATTCTCCCCTTCTATGTCAGCATTATCTTGACTAACCTAGGGGCCACCATTATGGGACTCACTAATGTCCAGCAGGCTATCCAGGCTCTCAGAATTATGAGAATTGCCAGGATTTTCAAGCTAGCGCGCCATTCCTCAGGGCTGCAGACACTAACCTATGCCCTTAAGAGTAGTTTTAAGGAGCTTGGACTACTATTAATGTATTTAGCCGTGGGGATATTTGTCTTCTCAGCCTTGGGATACACTATGGAACAGAGTCATCCTGACACTCTGTTTAAAAGCATACCCCAGTCATTCTGGTGGGCAATCATCACTATGACCACTGTTGGCTATGGAGACATCTACCCTAAAACCACCCTGGGAAAACTCAATGCCGCCACAAGTTTTCTCTGTGGGGTTATTGCCATTGCCCTCCCAATCCACCCCATCATCAACAATTTTGTGAAGTACTACAACAAGCAGAGAGTACTGGAGACAGCTACCAAACATGAACTGGAACTTATGGAGCTTCATTCCAACGGTGGGTATTTGGGAACCAATGGAAGTTCTAAGGAGCTGTCTGAAGGCAGAGGTCTGTCGGTCGGAGCTCACATGAAGGTTTCTCACAGCGATACATTCATCCAGGCTCTGACAGAGGAGAAACACCACAGAACGAGGCTTCAGAGCTGCAAATAAAACTTATCAGCTTACTCGAACGCTAAAGAAGCAGCAGTGGTTAAAAAACCCTCCTCAAGGGTTCCGGGGACTATTGGGTCACATTTCTTATACAGCAGCAAATCATATCAGATGCAATTCTTTTCCAGAACCAATGAAAACATCCAGATTGTCCTGTGTAAAGACCTACCTAAGTGTCAGTTTTGTGGTATGTACAGCTATTTATGTATGTGACTTGAATAAAAGAAAATGTGTTATTAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     4     3     4     3     4     4     4     4     4     4     4     4     4     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ci ---- 6e-051     AAS00646.1 potassium channel Kv4; CionaKv4 [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Dr ---- 1e-060     XP_693743.1 PREDICTED: similar to potassium voltage-gated channel delayed rectifier subfamily S member 3 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 9e-063     NP_001023789.1 EXPulsion defective (defecation) family member (exp-2) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 3e-080     NP_523894.2 CG1066-PB, isoform B [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 3e-080     XP_001195169.1 PREDICTED: similar to voltage-gated potassium channel alpha subunit Kv2.2 [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Xl ---- 5e-085     AAC59758.1 potassium channel alpha subunit Kv2.1 [Xenopus laevis]  -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - ?? ---- 9e-152     XP_696552.1 PREDICTED: similar to potassium voltage-gated channel, subfamily F, member 1 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Mm ---- 0          NP_963289.1 potassium voltage-gated channel, subfamily F, member 1 [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Gg ---- 0          XP_426210.2 PREDICTED: similar to potassium channel [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Hs ---- 0          NP_002227.2 potassium voltage-gated channel, subfamily F, member 1 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xt ---- 0          AAI36012.1 Unknown (protein for MGC:122536) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAL8395.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------ATGTGA------TAA------ATG------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   2      skin Brn3 FL   in                         CAAK3777.5p                                                                                                                                                                                                                                                                                                                                              CGATTCGCTTGCTACTAAGTTTCAGCCGATCTCCGCTGGTTGGATAACTCCATAAAATCGCTTTGTATCGGTCAGAGGGAGAAAAAGCAGAGGGGCAGCAGGCTGGGGGTGAATGATGTACCGGGAGAGAGAGAGGAGCCGGGGGCGCAGCGGGCAGAGCCCAGAGGAATGAACTATGAGCGCAAAGGGCTCAGGGATTCGGAGTAAGGCGCAGCGGTGCCAGGGCTGGAGGCGCAATCGCACCCATTGTATGCCCTGATCTGCCTGCACTTTGCACCCTGAAATCTTCTATCTTTCCTACAGTCCTTGCCTTTGCGCCATTCTGCAGCCAACTAACTTACTAACGGTGCGCCCCTGAGCCTTCTCCTGTGGGCATCATGGTACCGGCTAGCAGCCTGGAAGAGCTCAGCGGGGATGGGTCCGACTGCAGCGAAGAAGTGGAAATCACAGTGAATGTTGGAGGAATAAGGCAGGTTCTCTATGGAGATGTCCTGAACCGGTACCCAGAGACCAGGCTGGCCGAGTTGGTCAACTGCATGGCCGGGGGGTATGATGCCATCTTCTCCCTGTGCGATGATTACGACCCCGGCAAGAAGGAGTTTTACTTTGACCGCGACCCCGACGCCTTCAAGTGTATCATAGAGGTCTACCTGTATGGGGAGGTCCACATGAAGAAAGGTATTTGCCCCATATGTTTTAAGAACGAAATGGACTTCTGGAGAGTGGACTTGGACTTGCTGGATGACTGTTGCAAGAGCCACCTGAACGAGAAGAACCTGGAGTT
  5   1   2       bld Tad5                                 XZT29738.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATGAAGAAAGGTATTTGCCCCATATGTTTTAAGAACGAAATGGACTTCTGGAGAGTGGACTTGGACTTGCTGGATGACTGTTGCAAGAGCCACCTGAACGAGAAGAACCTGGAGTTGGAGGAGATAGCCAAGAGAGTGCAAACCATACTGGATGATCTAGGAGGGGACACATCGGAAAGTAAATGGAAAAGGTTCCAGAAATGTCTCTGGAAGTTCATGGAGAAGCCAGAATCCTCCTTCCCAGCCAGAATAACTGCTATTCTCTCTTTTCTTTTCATCTTAATCTCCTCCACTGTAATGTGCATAGGGACCATACCAGAGATGCAAGTTGAGGACCTGCAGGGCAACCATGTGGAGCACCCTACTCTGGATAGCATTGAGACTGTCTGTATTGGGTGGTTCACCTTGGAGTACCTACTGAGGCTGATCTCATCACCCAACAGGCTACATTTTGCCCTCTCATTCATGAACATCATTGATGTCCTGGCTATTCTCCCCTTCTATGTCAGCATTATCTTGACTAACCTAGGGGCCACCATTATGGGACTCACTAATGTCCAGCAGGCTATCCAGGCTCTCAGAATTATGAGAATTGCCAGGATTTTCAAGCTAGCGCGCCATTCCTCAGGGCTGCAGACACTAACCTATGCCCTTAAGAGTAGTTTTAAGGAGCTTGGACTACTATTAATGTATTTAGCCGTGGGGATATTTGTCTTCTCAGCCTTGNGATACACTATGGAACAGAGTCATCCTGACACTCTGTTTAAAAGCATACCCCAGTCATTCTGGTGGGCAATCATCACTATGACCACTGTTGGCTATGGAGACATCTACCCTAA
  5   1   2       bld Brn4      in                         CAAL8395.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCTTTTTTTTTCATCTTAATCTCCTCCACTGTAATGTGCATAGGGACCATACCAGAGATGCAAGTTGAGGACCTGCAGGGCAACCATGTGGAGCACCCTACTCTGGATAGCATTGAGACTGTCTGTATTGGGTGGTTCACCTTGGAGTACCTACTGAGGCTGATCTCATCACCCAACAGGCTACATTTTGCCCTCTCATTCATGAACATCATTGATGTCCTGGCTATTCTCCCCTTCTATGTCAGCATTATCTTGACTAACCTAGGGGCCACCATTATGGGACTCACTAATGTCCAGCAGGCTATCCAGGCTCTCAGAATTATGAGAATTGCCAGGATTTTCAAGCTAGCGCGCCATTCCTCAGGGCTGCAGACACTAACCTATGCCCTTAAGAGTAGTTTTAAGGAGCTTGGACTACTATTAATGTATTTAGCCGTGGGGATATTTGTCTTCTCAGCCTTGGGATACACTATGGAACAGAGTCATCCTGACACTCTGTTTAAAAGCATACCCCAGTCATTCTGGTGGGCAATCATCACTATGACCACTGTTGGCTATGGAGACATCTACCCTAAAACCACCCTGGGAAAACTCAATGCCGCCACAAGTTTTCTCTGTGGGGTTATTGCCATTGCCCTCCCAATCCACCCCATCATCAACAATTTTGTGAAGTACTACAACAAGCAGAGAGTACTGGAGACAGCTACCAAACATGAACTGGAACTTATGGAGCTTCATTCCAACGGTGGGTATTTGGGAACAATGGAAGTTCTAAGGAGCTGTCTGAAGGCAGAGGTCTGTCGNTCGGAGCTCACAT
  3   1   2      seed Brn4      in                         CAAL8395.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGATTTATGAGAATTGCCAGGATTTTCAAGCTAGCGCGCCATTCCTCAGGGCTGCAGACACTAACCTATGCCCTTAAGAGTAGTTTTAAGGAGCTTGGACTACTATTAATGTATTTAGCCGTGGGGATATTTGTCTTCTCAGCCTTGGGATACACTATGGAACAGAGTCATCCTGACACTCTGTTTAAAAGCATACCCCAGTCATTCTGGTGGGCAATCATCACTATGACCACTGTTGGCTATGGAGACATCTACCCTAAAACCACCCTGGGAAAACTCAATGCCGCCACAAGTTTTCTCTGTGGGGTTATTGCCATTGCCCTCCCAATCCACCCCATCATCAACAATTTTGTGAAGTACTACAACAAGCAGAGAGTACTGGAGACAGCTACCAAACATGAACTGGAACTTATGGAGCTTCATTCCAACGGTGGGTATTTGGGAACCAATGGAAGTTCTAAGGAGCTGTCTGAAGGCAGAGGTCTGTCGGTCGGAGCTCACATGAAGGTTTCTCACAGCGATACATTCATCCAGGCTCTGACAGAGGAGAAACACCACAGAACGAGGCTTCAGAGCTGCAAATAAAACTTATCAGCTTACTCGAACGCTAAAGAAGCAGCAGTGGTTAAAAAAACCCTCCTCAAGGGTTCTGGGGACTATTGGGTCACATTTCTTATACAGCAGCAAATAATATCAGATGCAATTCTTTTCCAGAACCAATGAAAACATCCAGATTGTCCCGTGTAAAGACCTACCTAAGTGTCAGTTTTGTGGTATGTACAGCTATTTATGTATGTGACTTAAATAAAAGAAAATGTGTTATT
  3   1   2       bld Brn3 FL   in                         CAAK3777.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCAGACACTAACCTATGCCCTTAAGAGTAGTTTAAGGAGCTTGGACTACTATTAATGTATTTAGCCGTGGGGATATTTGTCTTCTCAGCCTTGGGATACACTATGGAACAGAGTCATCCTGACACTCTGTTTAAAAGCATACCCCAGTCATTCTGGTGGGCAATCATCACTATGACCACTGTTGGCTATGGAGACATCTACCCTAAAACCACCCTGGGAAAACTCAATGCCGCCACAAGTTTTCTCTGTGGGGTTATTGCCATTGCCCTCCCAATCCACCCCATCATCAACAATTTTGTGAAGTACTACAACAAGCAGAGAGTACTGGAGACAGCTACCAAACATGAACTGGAACTTATGGAGCTTCATTCCAACGGTGGGTATTTGGGAACCAATGGAAGTTCTAAGGAGCTGTCTGAAGGCAGAGGTCTGTCGGTCGGAGCTCACATGAAGGTTTCTCACAGCGATACATTCATCCAGGCTCTGACAGAGGAGAAACACCACAGAACGAGGCTTCAGAGCTGCAAATAAAACTTATCAGCTTACTCGAACTCTAGAGAAGCAGCAGTGGTTAAAAAAACCCTCCTCAAGGGTTCTGGGGACTATTGGGTCACATTTCTTATACAGCAGCAAATAATATCAGATGCAATTCTTTTCCAGAACCAATGAAAACATCCAGATTGTCCCGTGTAAAGACCTACCTAAGTGTCAGTTTTGTGGTATGTACAGCTATTTATGTATGTGACTTAAATAAAAGAAAATGTGTTATT
  5   1   2       bld Tbd1      in                        CBXT16100.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGTCTTCTCAGCCTTGGGGTACACTATGGAACAGAGTCATCCTGACACTCTGTTTAAAAGCATACCCCAGTCATTCTGGTGGGCAATCATCACTATGACCACTGTTGGCTATGGAGACATCTACCCTAAAACCACCCTGGGAAAACTCAATGCCGCCACAAGTTTTCTCTGTGGGGTTATTGCCATTGCCCTCCCAATCCACCCCATCATCAACAATTTTGTGAAGTACTACAACAAGCAGAGAGTACTGGAGACAGCTACCAAACATGAACTGGAACTTATGGAGCTTCATTCCAATGGTGGGTATTTGGGAACCAATGGAAGTTCTAAGGAGCTGTCTGAAGGCAGAGGTCTGTCGGTCGGAGCTCACATGAAGGTTTCTCACAGCGATACATTCATCCAGGCTCTGACAGAGGAGAAACACCACAGAACGAGGCTTCAGAGCTGCAAATAAAACTTATCAGCTTACTCGAACGCTAAAGAAGCAGCAGTGGTTAAAAAACCCTCCTCAAGGGTTCCGGGGACTATTGGGTCACATTTCTTATACAGCAGCAAATCATATCAGATGCAATTCTTTTCCAGAACCAATGAAAACATCCAGATTGTCCTGTGTAAAGACCTACCTAAGTGTCAGTTTTGTGGTATGTACAGCTATTTATGTATGTGACTTGAATAAAAGAAAATGTGTTATTAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                        CBXT16100.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGTCTTCTCAGCCTTGGGGTACACTATGGAACAGAGTCATCCTGACACTCTGTTTAAAAGCATACCCCAGTCATTCTGGTGGGCAATCATCACTATGACCACTGTTGGCTATGGAGACATCTACCCTAAAACCACCCTGGGAAAACTCAATGCCGCCACAAGTTTTCTCTGTGGGGTTATTGCCATTGCCCTCCCAATCCACCCCATCATCAACAATTTTGTGAAGTACTACAACAAGCAGAGAGTACTGGAGACAGCTACCAAACATGAACTGGAACTTATGGAGCTTCATTCCAATGGTGGGTATTTGGGAACCAATGGAAGTTCTAAGGAGCTGTCTGAAGGCAGAGGTCTGTCGGTCGGAGCTCACATGAAGGTTTCTCACAGCGATACATTCATCCAGGCTCTGACAGAGGAGAAACACCACAGAACGAGGCTTCAGAGCTGCAAATAAAACTTATCAGCTTACTCGAACGCTAAAGAAGCAGCAGTGGTTAAAAAACCCTCCTCAAGGGTTCCGGGGACTATTGGGTCACATTTCTTATACAGCAGCAAATCATATCAGATGCAATTCTTTTCCAGAACCAATGAAAACATCCAGATTGTCCTGTGTAAAGACCTACCTAAGTGTCAGTTTTGTGGTATGTACAGCTATTTATGTATGTGACTTGAATAAAAGAAAATGTGTTATTAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)