Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TNeu085m15.3                         30 END     1          25        3                (no blast hit)
     2   1.0    0Xt7.1-TTbA043i14.3                          4 END     1          25       25                MGC83896 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 91%

 1012092601 Xt7.1-CAAN1798.5 - 4 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAN1798.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCCAGGTTAGGTTGCCATCGTCGTCAGCCGAGGTTTGTGTGAAGTACCTACGGCCCCAGAAACAACATGAGCGATCAGGAGCACACGTCCGATGACATGCCTACGATAAAGTCCGAAAACCGGACAGGAGGTGGATACATCCAGAAGGGGCAGGATTCTCAGCCATCTCCTTTGGCCTTGTTGGCTGCCACCTGTAGTAGAATTGAGCCCCCCGAGAATGGAAATGGCAACAGCCAGCAACAGGGTGCTACAGAATTGGATCTGAGTACTGCTCAACTTGCCCAGACAGCAAATGGCTGGCAGATTATTTCTACAGCTGGTTCTGCTTCCAAGGATCAAGCTGGAGGGGACGCTTCTTCTAAAAACCGCCCAATAGCCCCTGGCCAGTTTGTGGTATCTACACCCAGTGTGCAAAATCAGCAGGTTTTGGCCAGTTTGCAGGGTGTGATGCCCAACATTCAGTACCAAGTCATACCACAATTCCAGACTGTTGATGGGCAACAGCTCCAGTTTACCACTGCCCCAGCTCAAGTCAGTGTCCAGCAAGATGCTTCAGGCCAGTTTCAGATCATCCCAGCTACTAACCAGCAGATTATCACCACTAATCGCACTGGTACAGGGAACATACTTGCAATGCCAAACTTATTACAGCAAGCTGTCCCTATTCAGGGTATGGGTCTAACCAACAATGTCCTCTCAGGGCAGACTCAGTACTTAGCTAATGTCGCTGTTGCTCTTAATGGTAACATTACTCTGCTTCCTGTGAATGCAGCATCCCTCACTCCGACATCTCAGTCAGTGACTCTTACTGGAACTCAGGAAAACGACTCTCAGCCAGTTACTTCAGGCGTGGCTATCAGCTCCTCACAATTGGCTTCGCAGGCCAACTCTGGCGCTTACTTTACAAATGCATTCAGCTTCTCCACTACTACCA
                                                  Xt7.1-CHK-1008246726                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTTAGGTTGCCATCGTCxxCxxxCGAGGTTTGTGTGAAGTACCTACGGCCCCAGAAACAACATGAGCGATCAGGAGCACACGTCCGATGACATGCCTACGATAAAGTCCGAAAACCGGACAGGAGGTGGATACATCCAGAAGGGGCAGGATTCTCAGCCATCTCCTTTGGCCTTGTTGGCTGCCACCTGTAGTAGAATTGAGCCCCCCGAGAATGGAAATGGCAACAGCCAGCAACAGGGTGCTACAGAATTGGATCTGAGTACTGCTCAACTTGCCCAGACAGCAAATGGCTGGCAGATTATTTCTACAGCTGGTTCTGCTTCCAAGGATCAAGCTGGAGGGGACGCTTCTTCTAAAAACCGCCCAATAGCCCCTGGCCAGTTTGTGGTATCTACACCCAGTGTGCAAAATCAGCAGGTTTTGGCCAGTTTGCAGGGTGTGATGCCCAACATTCAGTACCAAGTCATACCACAATTCCAGACTGTTGATGGGCAACAGCTCCAGTTTACCACTGCCCCAGCTCAAGTCAGTGTCCAGCAAGATGCTTCAGGCCAGTTTCAGATCATCCCAGCTACTAACCAGCAGATTATCACCACTAATCGCACTGGTACAGGGAACATACTTGCAATGCCAAACTTATTACAGCAAGCTGTCCCTATTCAGGGTATGGGTCTAACCAACAATGTCCTCTCAGGGCAGACTCAGTACTTAGCTAATGTCGCTGTTGCTCTTAATGGTAACATTACTCTGCTTCCTGTGAATGCAGCATCCCTCACTCCGACATCTCAGTCAGTGACTCTTACTGGAACTCAGGAAAACGACTCTCAGCCAGTTACTTCAGGCGTGGCTATCAGCTCCTCACAATTGGCTTCGCAGGCCAACTCTGGCGCTTACTTTACAAATGCATTCAGCTTCTCCACTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     2     3     2     3     2     3     2     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG      68     124                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      68      76                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      68     163                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      68      12                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Dm ---- 4e-007     NP_524794.2 polyhomeotic distal CG3895-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Dr ==== 3e-026     XP_683921.1 PREDICTED: similar to trans-acting transcription factor 3 isoform 1 isoform 1 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Mm ---- 1e-086     NP_038700.2 trans-acting transcription factor 1 [Mus musculus] -----------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 2e-087     NP_612482.2 Sp1 transcription factor [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Gg ==== 3e-093     NP_989935.1 transcription factor [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xl ==== 2e-136     AAH70816.1 MGC83896 protein [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = ?? ==== 2e-136     NP_001084888.1 hypothetical protein LOC431939 [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 2e-157     NP_989139.1 transcription factor [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAN1798.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGA------------------------ATG---------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...
  5   1   1           Neu0 FL                     IMAGE:5384614.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCATCGTCAGCCGAGGTTTGTGTGAAGTACCTACGGCCCCAGAAACAACATGAGCGATCAGGAGCACACGTCCGATGACATGCCTACGATAAAGTCCGAAAACCGGACAGGAGGTGGATACATCCAGAAGGGGCAGGATTCTCAGCCATCTCCTTTGGCCTTGTTGGCTGCCACCTGTAGTAGAATTGAGCCCCCCGAGAATGGAAATGGCAACAGCCAGCAACAGGGTGCTACAGAATTGGATCTGAGTACTGCTCAACTTGCCCAGACAGCAAATGGCTGGCAGATTATTTCTACAGCTGGTTCTGCTTCCAAGGATCAAGCTGGAGGGGACGCTTCTTCTAAAAACCGCCCAATAGCCCCTGGCCAGTTTGTGGTATCTACACCCAGTGTGCAAAATCAGCAGGTTTTGGCCAGTTTGCAGGGTGTGATGCCCAACATTCAGTACCAAGTCATACCACAATTCCAGACTGTTGATGGGCAACAGCTCCAGTTTACCACTGCCCCAGCTCAAGTCAGTGTCCAGCAAGATGCTTCAGGCCAGTTTCAGATCATCCCAGCTACTAACCAGCAGATTATCACCACTAATCGCACTGGTACAGGGAACATACTTGCAATGCCAAACTTATTACAGCAAGCTGTCCCTATTCAGGGTATGGGTCTAACCAACAATGTCCTCTCAGGGCAGACTCAGTACTTAACTAATGTCCCTGTTGCTCTTAATGGTAACATTACTCTGCTTCCTGTGAATGCGGCATCCCTCACTCCAACATCTCAGTCAGTGACTCTTAGTGGAACTCAGGAAAACAACTCTCAGCCAGTTACTTCAGGGGTGGCTATCAGCTCCTCACAATTGGCTTCCCAGGCCAACTCTGGCGCTTACTTTACAAATGCAAACAGCTTCTCCACTACTACCACCCCAAGTAATGTGAGCCTTATGAACTGCAGCAGTGCAGGCAGCACACCTGGCAGCAATGTCCAGGTCCAGACATCTCAGAGATCTACTGGCCAGCTCAGCTTGCTTACTGATTCGGTGCAACAAGGCAATGGAAACATGCAGAAGGACGGTGACCAGAACCAGCAGCAGCAAATTCTCATACAGCCTCAAATAGTTCAGAGTGGGCAGACAATCCAGGCTCTGCAGGCAGCTCAGCTGTCAGGTCAAGCCTTTAGCACACAGGCCATATCCCAAGATGCCCTACAGAATCTTCAGATTCAGACAGTGCCAAACACAGGTCCAATTATTATCCGTACACCTGCTGTAGGGCCTAATGGCCAAGTTACGTGGCAGACCATCCAGCTGCAGAACCTGCAAGTTCAGAATCCACAAGCTCAGACCATCACTCTTGCGCCAATGCAGGGGGTTTCTTTGGGGCAGTCTGGCAGTACTAACACTCTTACATCAATGCCTGCTGGTACAGTAACAGTTAATGCTGCTCAGCTGTCATCCATGCCTGGCCTGCAAACCATTAATCTTGGAGCATTGGGAGCCTCCGGCATCCAAGTGCACCAGCTTCAAGGAGTACCTCTAACAATCACCAATGCTACAGGCGATATTGCCAGTGGTACTATAAGGTAAAGATATTTATGTAAGCATTCGTACAGCCCCCTCCCATTAGCTTAAAGGGGACATATACCATAAATTTTTACAATGCAATAAACCATGTAAAACAGAAAAAAAAAAAAAAAA
  5   1   2       bld Gas  5g                        TGas031i09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCCAGGTTAGGTTGCCATCGTCAGCCCGAGTTTGTGTGAAGTACCTACGGCCCCAGAAACAACATGAGCGCAGATCAGGAGCACACGTCCGATGACATGCCTACGATAAAGTCCGAAAACCGGACAGGAGGTGGATACATCCAGAAGGGGCAGGATTCTCAGCCATCTCCTTTGGCCTTGTTGGCTGCCACCTGTAGTAGAATTGAACCCCCCGAGAATGGAAATGGCAACAGCCAGCAACAGGGTGCTACAGAATTGGATCTGAGTACTGCTCAACTTGCCCAGACAGCAAATGGCTGGCAGATTATTTCTACAGCTGGTTCTGCTTCCAAGGATCAAGCTGGAGGGGACGCTTCTTCTAAAAACCGCCCAATAGCCCCTGGCCAGTTTGTGGTATCTACACCCAGTGTGCAAAATCAGCAGGTTTTGGCCAGTTTGCAGGGTGTGATGCCCAACATTCAGTACCAAGTCATACCACAATTCCAGACTGTTGATGGGCAACAGCTCCAGTTTACCACTGCCCCAGCTCAAGTCAGTGTCCAGCAAGATGCTTCAGGCCAGTTTCAGATCATCCCAGCTACTAACCAGCAGATTATCACCACTAATCGCACTGGTACAGGGAACATACTTGCAATGCCAAACTTATTACAGCAAGCTGTC
  5   1   2       bld Neu0 FL   out                   IMAGE:5384614.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCATCGTCAGCCGAGGTTTGTGTGAAGTACCTACGGCCCCAGAAACAACATGAGCGATCAGGAGCACACGTCCGATGACATGCCTACGATAAAGTCCGAAAACCGGACAGGAGGTGGATACATCCAGAAGGGGCAGGATTCTCAGCCATCTCCTTTGGCCTTGTTGGCTGCCACCTGTAGTAGAATTGAGCCCCCCGAGAATGGAAATGGCAACAGCCAGCAACAGGGTGCTACAGAATTGGATCTGAGTACTGCTCAACTTGCCCAGACAGCAAATGGCTGGCAGATTATTTCTACAGCTGGTTCTGCTTCCAAGGATCAAGCTGGAGGGGACGCTTCTTCTAAAAACCGCCCAATAGCCCCTGGCCAGTTTGTGGTATCTACACCCAGTGTGCAAAATCAGCAGGTTTTGGCCAGTTTGCAGGGTGTGATGCCCAACATTCAGTACCAAGTCATACCACAATTCCAGACTGTTGATGGGCAACAGCTCCAGTTTACCACTGCCCCAGCTCAAGTCAGTGTCCAGCAAGATGCTTCAGGCCAGTTTCAGATCATCCCAGCTACTAACCAGCAGATTATCACCACTAATCGCACTGGTACAGGGAACATACTTGCAATGCCAAACTTATTACAGCAAGCTGTCCCTATTCAGGGTATGGGTCTAACCAACA
  5   1   2   34 seed Te4  5x3  out                        CAAN1798.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATCGTCAGCCGAGGTTTGTGTGAAGTACCTACGGCCCCAGAAACAACATGAGCGATCAGGAGCACACGTCCGATGACATGCCTACGATAAAGTCCGAAAACCGGACAGGAGGTGGATACATCCAGAAGGGGCAGGATTCTCAGCCATCTCCTTTGGCCTTGTTGGCTGCCACCTGTAGTAGAATTGAGCCCCCCGAGAATGGAAATGGCAACAGCCAGCAACAGGGTGCTACAGAATTGGATCTGAGTACTGCTCAACTTGCCCAGACAGCAAATGGCTGGCAGATTATTTCTACAGCTGGTTCTGCTTCCAAGGATCAAGCTGGAGGGGACGCTTCTTCTAAAAACCGCCCAATAGCCCCTGGCCAGTTTGTGGTATCTACACCCAGTGTGCAAAATCAGCAGGTTTTGGCCAGTTTGCAGGGTGTGATGCCCAACATTCAGTACCAAGTCATACCACAATTCCAGACTGTTGATGGGCAACAGCTCCAGTTTACCACTGCCCCAGCTCAAGTCAGTGTCCAGCAAGATGCTTCAGGCCAGTTTCAGATCATCCCAGCTACTAACCAGCAGATTATCACCACTAATCGCACTGGTACAGGGAACATACTTGCAATGCCAAACTTATTACAGCAAGCTGTCCCTATTCAGGGTATGGGTCTAACCAACAATGTCCTCTCAGGGCAGACTCAGTACTTAACTAATGTCCCTGTTGCTCTTAATGGTAACATTACTCTGCTTCCTGTGAATGCGGCATCCCTCACTCCAACATCTCAGTCAGTGACTCTTAGTGGAACTCAGGAAAACAACTCTCAGC
  5   1   2       bld TbA  5g3  out                  TTbA043i14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATGAGCGATCAGGAGCACACGTCCGATGACATGCCTACGATAAAGTCCGAAAACCGGACAGGAGGTGGATACATCCATAAGGGGCAGGATTCTCAGCCATCTCCTTTGGCCTTGTTGGCTGCCACCTGTAGTAGAATTGAGCCCCCCGAGAATGGAAATGGCAACAGCCAGCAACAGGGTGCTACAGAATTGGATCTGAGTACTGCTCAACTTGCCCAGACAGCAAATGGCTGGCAGATTATTTCTACAGCTGGTTCTGCTTCCAAGGATCAAGCTGGAGGGGACGCTTCTTCTAAAAACCGCCCAATAGCCCCTGGCCAGTTTGTGGTATCTACACCCAGTGTGCAAAATCAGCAGGTTTTGGCCAGTTTGCAGGGTGTGATGCCCAACATTCATTACCGAGTCATACCACAATTCCAGACTGTTGATGGGCAACAGCTCCAGTTTACCACTGCCCCAGCTCATGTCAGTGTCCAGCAAGATGCTTCAGGCCAGTTTCAGATCATCCCAGCTACTAACCAGCAGATTATCACCACTAATCGCACTGGTACAGGGAACATACTTGCAATGCCAAACTTATTACAGGAAGCTGTCCCTATTCAGGGTATGGGTCTAACCAACAATGTCCTCTCAGGGCAGACTCAGTACTTAGCTAATGTCGCTGTTGCTCTTAATGGTAACATTACTCTGCTTCCTGTGAATGCAGCATCCCTCACTCCGACATCTCAGTCAGTGACTCTTACTGGAACTCAGGAAAACGACTCTCAGCCAGTTACTTCAGGCGTGGCTATCAGCTCCTCACAATTGGCTTCGCAGGCCAACTCTGGCGCTTACTTTACAAATGCATTCAGCTTCTCCACTACTACCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)