Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 22%

 1012094021 Xt7.1-XZT23511.3 - 6 ESTs
                                                                       .....-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT23511.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGATAACATCCCTGGATTGGTAAACAAGCAAAGACAACTATGCCAGAAACACCCAGATATTATGCAAGCTATTGGTGAAGGTGCCAAGGAGTGGATCAGAGAGTGCCAGCATCAATTCCGGCACCACCGCTGGAACTGCAGCACACTGGACAGAGACCACACAGTATTTGGGAGAGCCATGCTGCGAAGCAGCAGGGAAACAGCCTTTGTCTATGCTATTTCCTATGCTGGAGTCGTTTATGCACTTACCCGAGCCTGCAGTCAAGGAGAGCTCAAATCATGTAGCAGCGATCACATTGACTTTGGTATAAAATTTGCCAAAGATTTTGTGGATGCAAAGGAGAAGAGATTGAAAGATGCACGGGCTTTGATGAACTTGCACAATAACCGCTGTGGGAGAATGGCAGTAAAACGATTTATGAATCTTGAATGTAAGTGCCACGGGGTCAGCGGGTCTTGTACATTAAGGACTTGTTGGCGTGCCATGTCAGACTTCCGAAAGACAGGAGATTTTCTAAGGCGAAAATACAATGGGGCAATACAAGTCACGATGAATCAAGATGGAAGTGGGTTCGCTGTGGCAAATCAGAACTTTAGAAAAGCTACCAAAAAAGATCTGGTCTACTTTGAAAACTCCCCTGATTATTGTCTTATGGACAAAACAGCCGGATCCCTGGGTACTGCCGGCAGGGTGTGTGACAAAGTCTCTAGAGGAACCGATGGCTGTGAGGTCATGTGCTGCGGACGGGGCTATGACACCACCCGTGTCACACGTATAACTAAATGCGAGTGCAAATTTCACTGGTGCTGTGCAGATGAAAGATATATAACTATACAGACATTACCAAAACCAACGTAAGAGACACCAAAAAGAGATACATTTCATAAGGAAATAACTGACAGACCCCATGTATACTTTATCATTTTTTGTTTGGACTTTGTGCCTTTTATTAGGGGGATTTCTTTTCTCCACTGGTACATTATACCGAGAGCTGCTTACAAGTCAGCGGGGATTCTATACAATTTCTCATGAACTACAAGATGGTACGCAGCACGAACTGTGAAAAATCCCCTTTGTCGACTAAACAATTGAAAAATATTGGAAATTCCAAGATGGAGGACTTTTGATGCAACTGAGACAAACTCAGTTTTGTAAACTTGCTTCTTGTATGTTGTGTATATGCTTTAATATTTTTTTTAAATACATATAA
                                                  Xt7.1-CHK-1008240899                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACATCCCTGGATTGGTAAACAAGCAAAGACAACTATGCCAGAAACACCCAGATATTATGCAAGCTATTGGTGAAGGTGCCAAGGAGTGGATCAGAGAGTGCCAGCATCAATTCCGGCACCACCGCTGGAACTGCAGCACACTGGACAGAGACCACACAGTATTTGGGAGAGCCATGCTGCGAAGCAGCAGGGAAACAGCCTTTGTCTATGCTATTTCCTATGCTGGAGTCGTTTATGCACTTACCCGAGCCTGCAGTCAAGGAGAGCTCAAATCATGTAGCAGCGATCACATTGACTTTGGTATAAAATTTGCCAAAGATTTTGTGGATGCAAAGGAGAAGAGATTGAAAGATGCACGGGCTTTGATGAACTTGCACAATAACCGCTGTGGGAGAATGGCAGTAAAACGATTTATGAATCTTGAATGTAAGTGCCACGGGGTCAGCGGGTCTTGTACATTAAGGACTTGTTGGCGTGCCATGTCAGACTTCCGAAAGACAGGAGATTTTCTAAGGCGAAAATACAATGGGGCAATACAAGTCACGATGAATCAAGATGGAAGTGGGTTCGCTGTGGCAAATCAGAACTTTAGAAAAGCTACCAAAAAAGATCTGGTCTACTTTGAAAACTCCCCTGATTATTGTCTTATGGACAAAACAGCCGGATCCCTGGGTACTGCCGGCAGGGTGTGTGACAAAGTCTCTAGAGGAACCGATGGCTGTGAGGTCATGTGCTGCGGACGGGGCTATGACACCACCCGTGTCACACGTATAACTAAATGCGAGTGCAAATTTCACTGGTGCTGTGCAGxxxxxxGATATATAACTATACAGACATTACCAAAACCAACGTxxxAGxCACCAAxAAxxGATACATTTCATAAGGAAATAACTGACAGACCCCATGTATACTTTATCATTTTTTGTTTGGACTTTGTGCCTTTTATTAGGGGGATTTTTTTTCTCCACTGGTACATTATACCGAGAGCTGCTTACAAGTCAGCGGGGATTCTATACAATTTCTCATGAACTACAAGATGGTACGCAGCACGAACTGTGAAAAATCCCCTTTGTCGACTAAACAATTGAAAAATATTGGAAATTCCAAGATGGAGGACTTTTGATGCAACTGAGACAAACTCAGTTTTGTAAACTTGCTTCTTGTATGTTGTGTATATGCTTTAATATTTTTTTTAAATACATATAAACTTAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     4     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3
                                               BLH ATG     -94      32                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Bb ---- 8e-054     AAF19840.1 secreted protein Wnt8 [Branchiostoma belcheri] -------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 2e-063     NP_501822.1 C. elegans WNT family CWN-2 (40.4 kD) (cwn-2) [Caenorhabditis elegans] ---------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dm ---- 8e-067     NP_476810.1 Wnt oncogene analog 2 CG1916-PA [Drosophila melanogaster] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ---- 4e-075     XP_779946.1 PREDICTED: similar to wingless-related MMTV integration site 5A isoform 1 [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ci ---- 9e-077     BAE06619.1 Wnt signaling ligand [Ciona intestinalis] ---------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Bf ---- 2e-079     AAC80431.1 AmphiWnt4 [Branchiostoma floridae] -------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xt ==== 3e-094     ABO31106.1 Wnt2 [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Hs ---- 1e-135     NP_004176.2 wingless-type MMTV integration site family, member 2B isoform WNT-2B1 [Homo sapiens] -------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Mm ---- 3e-136     NP_033546.2 wingless related MMTV integration site 2b [Mus musculus] --------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dr ---- 2e-141     NP_001037809.1 wingless-type MMTV integration site family, member 2Bb [Danio rerio] --------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Gg ---- 1e-145     NP_989667.1 wingless-type MMTV integration site family, member 2B [Gallus gallus] -------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Xl ---- 4e-160     AAC60218.1 Wnt-2b [Xenopus laevis] ------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- ?? ---- 4e-160     NP_001079279.1 wingless-type MMTV integration site family, member 2B [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT23511.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------ATG---------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------TGA------------------------------------------------------------TAA------------------------ATG---TAA---------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ...
  5   1   2      skin HdA  5g3  in                   THdA041j12.p1kSP6 AGCCAAGAAGACAGAAGCAAAGAAGAAACTTACATCATCACTGTCTGTCCTCCTCATCACAACCTCCAAAAGAAAGTTCTCTCCAACATCATCCAGAGCCTCTTTCCCCAGCTTCATCTCCAGAGACAGACAGCAGCCAAATACCCTTCTCTCTCAGAATTACTGATACATTCTAAATCAAAACTAGATTTCTCTTTTTTTTAGCTACTTGTGAATTATATTTGACATCTCTGCAAGCCCAATATCCCCAAATCCCACAGCTGTCTTCCCTTTGTTTAATCCTTTAAATCTTTTCTTTAATGCACAATTTATTACCTGTTTTGTGAGATCTTGAACTAAAATGCTGCAAGACAGAATTTCAGATTTGCAGAGCCACTTGTAAAATATTGTGGTTTATTAAAAATTTCTAATTTTTTTTTGGGGGGGGGGGATGAAGAGACATGAGAGATTCTGGCAAAGCTATAAACTGCTATTAATTCTACATTCAAGATCAAATTAGCTGTCACTCTTACCTGCCTTGTACTCTGGATTACTTGCTGTCAGCTTTCGGGAAACTCTTTTTTTCTCTGGTGGATACTATGGTGAGTTTAACCCACTGTGGAGAAGCATTGAGGATTCACGCTAAAACGTCCCATGTTGCAGGATTAAGGCATTGCCAAAGGACTGTGGTTTCATCAGACATCATCGCAGCCACCTCTAGGATGCATTTTGCTTATATTTTAATACTGCTGATTCTGACTCCAAGAGTTGACTCATCCTGGTGGTATATTGGTGCACTAGGAGCAAGGGTTATCTGTGATAACATCCCTGGATTGGTAAACAAGCAAAGACAACTATGCCAGAAACACCCAGATATTATGCAAGCTATTGGT
  5   1   2       bld Tad5      in                         XZT23511.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGATAACATCCCTGGATTGGTAAACAAGCAAAGACAACTATGCCAGAAACACCCAGATATTATGCAAGCTATTGGTGAAGGTGCCAAGGAGTGGATCAGAGAGTGCCAGCATCAATTCCGGCACCACCGCTGGAACTGCAGCACACTGGACAGAGACCACACAGTATTTGGGAGAGCCATGCTGCGAAGCAGCAGGGAAACAGCCTTTGTCTATGCTATTTCCTATGCTGGAGTCGTTTATGCACTTACCCGAGCCTGCAGTCAAGGAGAGCTCAAATCATGTAGCAGCGATCACATTGACTTTGGTATAAAATTTGCCAAAGATTTTGTGGATGCAAAGGAGAAGAGATTGAAAGATGCACGGGCTTTGATGAACTTGCACAATAACCGCTGTGGGAGAATGGCAGTAAAACGATTTATGAATCTTGAATGTAAGTGCCACGGGGTCAGCGGGTCTTGTACATTAAGGACTTGTTGGCGTGCCATGTCAGACTTCCGAAAGACAGGAGATTTTCTAAGGCGAAAATACAATGGGGCAATACAAGTCACGATGAATCAAGATGGAAGTGGGTTCGCTGTGGCAAATCAGAACTTTAGAAAAGCTACCAAAAAAGATCTGGTCTACTTTGAAAACTCCCCTGATTATTGTCTTATGGACAAAACAGCCGGATCCCTGGGTACTGCCGGCAGGGTGTGTGACAAAGTCTCTAGAGGAACCGATGGCTGTGAGGTCATGTGCTGCGGACGGGGCTATGACACCACCCGTGTCACACGTATAACTAAATGCGAGTGCAAATTTCACTGGTGCTGTGCAGTACGTTGC
  5   1   2       bld Tad5      in                         XZT40750.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGCACACTGGACAGAGACCACACAGTATTTGGGAGAGCCATGCTGCGAAGCAGCAGGGAAACAGCCTTTGTCTATGCTATTTCCTATGCTGGAGTCGTTTATGCACTTACCCGAGCCTGCAGTCAAGGAGAGCTCAAATCATGTAGCTGCGATCCAAAAAAAAGAGGCCGCTCAAAGGATGAAAGAGGGGAGTTTGACTGGGGAGGCTGCAGCGATCACATTGACTTTGGTATAAAATTTGCCAAAGATTTTGTGGATGCAAAGGAGAAGAGATTGAAAGATGCACGGGCTTTGATGAACTTGCACAATAACCGCTGTGGGAGAATGGCAGTAAAACGATTTATGAATCTTGAATGTAAGTGCCACGGGGTCAGCGGGTCTTGTACATTAAGGACTTGTTGGCGTGCCATGTCAGACTTCCGAAAGACAGGAGATTTTCTAAGGCGAAAATACAATGGGGCAATACAAGTCACGATGAATCAAGATGGAAGTGGGTTCGCTGTGGCAAATCAGAACTTTAGAAAAGCTACCAAAAAAGATCTGGTCTACTTTGAAAACTCCCCTGATTATTGTCTTATGGACAAAACAGCCGGATCCCTGGGTACTGCCGGCAGGGTGTGTGACAAAGTCTCTAGAGGAACCGATGGCTGTGAGGTCATGTGCTGCGGACGGGGCTATGACACCACCCGTGTCACACGTATAACTAAATGCGAGTGCAAATTTCACTGGTGCTGTGCAGTACGTTGCAAAGAATGTGAGGAGACTGTGGATGTGCATACATGCAAGGCACCAAAAAGAGCAGAGTGGCTAGACCAAACATGAGCCCTTCAAGTTCTCACTACTGGACAAGATGCCGCANGCCCC
  3   1   1       add Tad5      in                         XZT40750.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTATTTATGTAATTCTGCAAGGCACTAAATATGGGACTTCACTTTCCAGGATATACTGCGGTCCGTCAGATCTAGGTCAACAGAGAACCAGATATTTCTGTATGAGAAGTTTAAAATAAAAGCAGTGGTCCACAACTGTTCTCACAAAACAGCTGGTGGTAGTTCACAGACCTTCAAAATTTATAGATCTCTTTTTACTCTAGCTATTTTTTCCATAATGGAGATTCATTTTTCCATTCAAACCCCACTTGAAAGACATTCTATAAACATTAATAAATTAATTGAGAAAAACCACCAGTATCAGTAAAATAATACAGCCTCAGATTAGGTCATTATTATTCTAGGAAGTAATAAGGAAGCTCTACAACAGGGAAAAAAAACAAACCTTGGTGTTTATGAAAGATATATAACTATACAGACATTACCAAAACCAACGTAAGAGATCTCATCAATTGATACATTTCATAAGGAAATAACTGACAGACCCCATGTATACTTTATCATTTTTTGTTTGGACTTTGTGCCTTCTATTAGGGGGATTTCTTTTCTCCACTGGTACATTATACCGAGAGCTGCTTACAAGTCAGCGGGGATTCTATACAATTTCTCATGAACTACAAGATGGTACGCAGCACGAACTGTGAAAAATCCCCTTTGTCGACTAAACAATTGAAAAATATTGGAAATTCCAAGATGGAGGACTTTTGATGCAACTGAGACAAACTCAGTTTTGTAAACTTGCTTCTTGTATGTTGTGTATATGCTTTAATATTTTTTTTAAATACATATAAACTTATATTGC
  3   1   2      seed Tad5      in                         XZT23511.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAATCTTGAATGTAAGTGCCACGGGGTCAGCGGGTCTTGTACATTAAGGACTTGTTGGCGTGCCATGTCAGACTTCCGAAAGACAGGAGATTTTCTAAGGCGAAAATACAATGGGGCAATACAAGTCACGATGAATCAAGATGGAAGTGGGTTCGCTGTGGCAAATCAGAACTTTAGAAAAGCTACCAAAAAAGATCTGGTCTACTTTGAAAACTCCCCTGATTATTGTCTTATGGACAAAACAGCCGGATCCCTGGGTACTGCCGGCAGGGTGTGTGACAAAGTCTCTAGAGGAACCGATGGCTGTGAGGTCATGTGCTGCGGACGGGGCTATGACACCACCCGTGTCACACGTATAACTAAATGCGAGTGCAAATTTCACTGGTGCTGTGCAGTACGTTGCAAAGAATGTGAGGAGACTGTGGATGTGCATACATGCAAGGCACCAAAAAGAGCAGAGTGGCTAGACCAAACATGAGCCCTTCAAGTTCTCACTACTGGACAAGATGCCGCAGGCCCCGCAGAATTCTGGGTGGGGATTTCTTTTCTCCACTGGTACATTATACCGAGAGCTGCTTACAAGTCAGCGGGGATTCTATACAATTTCTCATGAACTACAAGATGGTACGCAGCACGAACTGTGAAAAATCCCCTTTGTCGACTAAACAATTGAAAAATATTGGAAATTCCAAGATGGAGGACTTTTGATGCAACTGAGACAAACTCAGTTTTGTAAACTTGCTTCTTGTATGTTGTGTATATGCTTTAATATTTTTTTTAAATACATATAAACTTATATTGC
  3   1   1       add HdA  5g3  in                    THdA041j12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAACAGAGAACCAGATATTTTTGTATGAGAAGTTTAAAATAAAAGCAGTGGTCCACAACTGTTTTCACAAAACAGCTGGTGGTAGTTCACAGCCCTTCAAAATTTATAGATCTCTTTTTACTCTAGCTATTTTTTCCATAAGGGAGATTCATTTTTCCATTCAAACCCCACTTGAAAGACATTCTTTAAACATTAATAAATTAATTGGGAAAAACCCCCAGTTTCAGTAAAATAATACAGCCTCAGATTAGGTCATTTTTTTTTTAGGAAGTAATAAGGAAGCTTTCCAACAGGGAAAAAAAACAAACCTTGGTGTTTATGAAAGATATATAACTATACAGACATTACCAAAACCAACGTAAGAGATTTCATCAATTGATACATTTCATAAGGAAATAACTGACAGACCCCATGTATACTTTATCATTTTTTGTTTGGACTTTGTGCCTTTTATTAGGGGGATTTTTTTTTTCCACTGGTACATTATACCGAGAGCTGCTTACAAGTCAGCGGGGATTTTATACAATTTTTCATGAATTACAAGATGGTACGCAGCACGAACTGTGAAAAATCCCCTTTGTGGATTAAACAATTGAAAAATATTGGAAATTCCAAGATGGAGGACTTTTGATGCAACTGAGACAAACTCAGTTTTGTAAACTTGCTTTTTGTATGTTGGGTATATGCTTTAATATTTTTTTTAAATACATATAAACTTTTTTGGCAACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)