Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK8345.3                            2 END     2          66      100                LOC779554 protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 89%

 1012094571 Xt7.1-CAAK8345.5 - 3 ESTs
                                                                       ....-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAK8345.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAGGCGAAGAGCATCTGCTGAGCAGCTATGGCACAGGAGAGGAGAGGGAGCAGCAGGGCACAGGAGGCGGATACCTGGCACAGGCAGATGGATTCACACGTACGTTATCCTGATCAATGTGTGTTTGTTGCTCCACCCTCACCTGAGCTTCCTCCCAGACCCACTACTTTACCATCTCCCCGGCTCAGCCCTGCAGGCTCGGGTAGGTCCCAACCTGAAGGATCAAGTAGCTTCCAAACTCCCCTCACAGCGGTACAGTTCTCCACCCGTCCTCTTTTACCTATTGGCTCTTCTGCCCCTGACCGATCCCAACCAGAAGGATCTCAGAGGCTCCATCCTTTAGGATCCCCAATAAATGTAAGAGTGGAATCTGGCAGATCACAGCCTGAGGGATCCTGTCCTAGTCTCTTGTCCCCTACCCGGCAGTACCCACCTTTGCCTCCACCTCCATCCTCTCCTCATCGCTCTCCTGTCCTAAGTCCTAGAGGATCACCTGATGTCCCCAGGACTCTGCACAGAGCACACACTTCTAGACCCCAAGACCAGCATCCAACCCCTGAATGCATTCGACCTTCCCCAGCAAAAGCCGACAAATCCCAAGGTGATAGTACAGTGGATGTAGCAGGGAAGGACTTCAGGATATATGTTATCACATGGAACGTTGGATGTGCTGTGCCACCCTCGGACCTTACTTCCCTCCTCTGCCTCAATGCTAGAGATGATAAAATCGATATGTTTGTTATCGGGCTGCAAGAGGTCAATTCTATGATCAATAAACGCCTGANAGATGCTCTGTTTTCCGATCAGTGGAGCGAGGTCTTTATGGATGTCCTCAGTCCTTTCAGCTATGTTTTGGTCAGCTCCTCATAAGAATGCCAGTTGTCTGCTGCTGGTGTTTTCAAAGTAATTCCACTTGCCTTTCCTCCGGAACTACGACTGACTGCACAAGACTGGCCTCGGAGAATCTGGGTTATTAGGTGGAGTCAGCAATCGAATAATCTCTTTTTGTCCATGTAATGTTTTTCCTTAAT
                                                  Xt7.1-CHK-1008249666                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGAGCATCTGCTGAGCAGCTATGGCACAGGAGAGGAGAGGGAGCAGCAGGGCACAGGAGGCGGATACCTGGCACAGGCAGATGGATTCACACGTACGTTATCCTGATCAATGTGTGTTTGTTGCTCCACCCTCACCTGAGCTTCCTCCCAGACCCACTACTTTACCATCTCCCCGGCTCAGCCCTGCAGGCTCGGGTAGGTCCCAACCTGAAGGATCAAGTAGCTTCCAAACTCCCCTCACAGCGGTACAGTTCTCCACCCGTCCTCTTTTACCTATTGGCTCTTCTGCCCCTGACCGATCCCAACCAGAAGGATCTCAGAGGCTCCATCCTTTAGGATCCCCAATAAATGTAAGAGTGGAATCTGGCAGATCACAGCCTGAGGGATCCTGTCCTAGTCTCTTGTCCCCTACCCGGCAGTACCCACCTTTGCCTCCACCTCCATCCTCTCCTCATCGCTCTCCTGTCCTAAGTCCTAGAGGATCACCTGATGTCCCCAGGACTCTGCACAGAGCACACACTTCTAGACCCCAAGACCAGCATCCAACCCCTGAATGCATTCGACCTTCCCCAGCAAAAGCCGACAAATCCCAAGGTGATAGTACAGTGGATGTAGCAGGGAAGGACTTCAGGATATATGTTATCACATGGAACGTTGGATGTGCTGTGCCACCCTCGGACCTTACTTCCCTCCTCTGCCTCAATGCTAGAGATGATAAAATCGATATGTTTGTTATCGGGCTGCAAGAGGTCAATTCTATGATCAATAAACGCCTGANAGATGCTCTGTTTTCCGATCAGTGGAGCGAGGTCTTTATGGATGTCCTCAGTCCTTTCAGCTATGTTTTGGTCAGCTCxxxAxxAGAATGCCAGTTGTCTGCTGCTGGTGTTTTCAAAGTAATTCCACTTGCCTTTCCTCCGGAACTACGACTGACTGCACAAGACTGGCCTCGGAGAATCTGGGTTATTAGGTGGAGTCAGCAATCGAATAATCTCTTTTTGTCCATGTAATGTTTTTCCTTAATTGCCAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG      28      56                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               BLH MIN      31      38                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               BLH OVR      28     158                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               ORF LNG      28      11                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                                                       PROTEIN --- Ce ---- 4e-007     NP_741367.1 Q/N-rich domain Prion like protein PQN-75 (50.5 kD) (pqn-75) [Caenorhabditiselegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Dm ---- 1e-008     NP_647902.1 CG15021-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Dr ---- 8e-016     XP_694550.1 PREDICTED: similar to phosphatidylinositol (4,5) bisphosphate 5-phosphatase, A, partial [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Xl ---- 3e-016     AAI00200.1 LOC443677 protein [Xenopus laevis] -===============================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Hs ---- 2e-028     NP_055237.1 phosphatidylinositol (4,5) bisphosphate 5-phosphatase, A isoform 1 [Homo sapiens] ----------------------------------------=======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Gg ---- 2e-031     XP_415287.2 PREDICTED: hypothetical protein [Gallus gallus] -----------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - ?? ---- 5e-032     XP_698057.1 PREDICTED: similar to Phosphatidylinositol 4,5-bisphosphate 5-phosphatase A [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 PROTEIN --- Mm ---- 1e-036     NP_766027.1 phosphatidylinositol (4,5) bisphosphate 5-phosphatase, A [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xt ==== 4e-168     AAI22960.1 LOC779554 protein [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAK8345.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGA------ATG---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ...
  0   1   1           Brn3 FLt5                        CAAK8345.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCACAGGAGAGGAGAGGGAGCAGCAGGGCACAGGAGGCGGATACCTGGCACAGGCAGATGGATTCACACGTACGTTATCCTGATCAATGTGTGTTTGTTGCTCCACCCTCACCTGAGCTTCCTCCCAGACCCACTACTTTACCATCTCCCCGGCTCAGCCCTGCAGGCTCGGGTAGGTCCCAACCTGAAGGATCAAGTAGCTTCCAAACTCCCCTCACAGCGGTACAGTTCTCCACCCGTCCTCTTTTACCTATTGGCTCTTCTGCCCCTGACCGATCCCAACCAGAAGGATCTCAGAGGCTCCATCCTTTAGGATCCCCAATAAATGTAAGAGTGGAATCTGGCAGATCACAGCCTGAGGGATCCTGTCCTAGTCTCTTGTCCCCTACCCGGCAGTACCCACCTTTGCCTCCACCTCCATCCTCTCCTCATCGCTCTCCTGTCCTAAGTCCTAGAGGATCACCTGATGTCCCCAGGACTCTGCACAGAGCACACACTTCTAGACCCCAAGACCAGCATCCAACCCCTGAATGCATTCGACCTTCCCCAGCAAAAGCCGACAAATCCCAAGGTGATAGTACAGTGGATGTAGCAGGGAAGGACTTCAGGATATATGTTATCACATGGAACGTTGGATGTGCTGTGCCACCCTCGGACCTTACTTCCCTCCTCTGCCTCAATGCTAGAGATGATAAAATCGATATGTTTGTTATCGGGCTGCAAGAGGTCAATTCTATGATCAATAAACGCCTGAAAGATGCTCTGTTTTCCGATCAGTGGAGCGAGGTCTTTATGGATGTCCTCAGTCCTTTCAGCTATGTTTTGGTCAGCTCAGTAAGAATGCAAGGTTGTCTACTGCTGGTGTTTTCAAAGTATTTCCACTTGCCTTTCCTCCGGGACATACAGACTGACTGCACAAGGACTGGCCTCGGAGGATACTGGGGTAATAAGGGTGGAGTCAGCATTCGATTATCTCTTTTTGGTCACATGGTATGTTTTCTTAATTGCCATTTACCGGCTCATATGGAGAACACTGATCAGCGAGTGGATAATTTTGAAAGCATCTTGCAGCTTCAGCAGTTCCAGGGACCGCTGGCAAATGGTGTTCTGGACCATGACTTGGTGTTCTGGTTTGGAGATCTTAACTTCCGAATAGAGGATCTGGATTTGCATTTTGTGAAATCTGCCATCCAAGGCAACAAGCTGGCTCTGCTGTGGGAGAAGGACCAGTTAAACATGGCAAAAATTTTTGAGCCCGTGCTTAATGGATTCATGGAGGGCTCTCTGACCTTTCCTCCCACATACAAGTTCGATGTGGGGACCAATACCTATGACACAAGCTCTAAGAAAAGAAAGCCGGCCTGGACAGATCGTATTCTGTGGAAAATGAAATGTCCAATCACTCAGAGCCCTGCCAAGCAATTGGGCACCATCAGCACACGGTCTAAAGAATTATCAGTGACCTTACTTAGTTATGGAAGCCACATGCAGTATACAGAGAGTGACCATAAACCTGTGTCCGCTATCTTCTCACTGCAGTTTGCTTCCTGTCTTGCTGCCCCATTGGTCCAATTGTTGGTGCGCGATGAGTGGTTGCAGCCTGATGATGCCCATGTCATCTATCGATGGTGTCCGGGATACATGAAGAGTTCCTGGGATTGGATTGGACTTTATAGAGTGGGATTTAGACATCACAAAGATTATGTTTCTTACGTGTGGGCAAAGTCCGATGAAGAAACAGAGAGAGGGAAACACCAACATGAGGTGGTGTTCAGTGAGGAATTGCTTCCCAAGGGGACCAGCGAATACCTTCTTGGTTATTTTAGCAACAACCTTGGTACACTGATTGGAGTGACTGAGCCATTCCAGATCTGTTTGCCCGACTCTGAGGCAGGTTCTTCCTCTAACAGTTCAGATTCTAGTTCAGAGGAGGAAGATAGCACTCATATTCTTCTACGACCGAAATCCCGTAGCCCCAGTCCAGCCAGTGCCCGTTCACCACGGAGCAGGAGTCCAGCCCTAGCTCGTCTTCATGATCTCATCCTTCCCAACACTTCCCGCCAGAAGAGCCGCAGTCCTTCCCCCAACAGGACCAAGAGTCCCAAACATGACAGGGCCCAACGATCTCGTTCCAGGGAATCTACTCGCCATAGCAAGGGTAAACGAGTGCAGAGCCCCCTTGTGCTCCAGGCTATAACTGTGCCTATTGTGAGGCCAGCAGCTGTAGGCCAAGTCTTCAGTCCCCAGGTTGGAATTTTTCCCTCCCCCAGCTCTCCAAAGCCACAATTAAAGCTGCAGACCCCCTCTAGCCCATGTCACGGAGACTCACACATTGCAACAAAGAGGCAAGAGCTGCTGTAAATTGATCCTCCCTCTGATAAACCTTTGCACTATTATGACATTTTGAAAAATCAACTTGAGACTTGAGTATCAGATCCTAATTGTATATATGTTGGAATGGAATGATTTTAGGGGAAAAATTCTACATTGAACACAAATTTGTTTTAAGTCTTCATTGCCGTGGGTCATGGTTATTTTAGTGGCAGCCAAAGATGCACATTCCAGCTTATCTAAGTTAACGAAAAAAAAAAAAAAA
  5   1   2   14  bld Brn3 5g3  out                        CAAK8379.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGGCGAAGAGCATCTGCTGAGCAGCTATGGCACAGGAGAGGAGAGGGAGCAGCAGGGCACAGGAGGCGGATACCTGGCACAGGCAGATGGATTCACACGTACGTTATCCTGATCAATGTGTGTTTGTTGCTCCACCCTCACCTGAGCTTCCTCCCAGACCCACTACTTTACCATCTCCCCGGCTCAGCCCTGCAGGCTCGGGTAGGTCCCAACCTGAAGGATCAAGTAGCTTCCAAACTCCCCTCACAGCGGTACAGTTCTCCACCCGTCCTCTTTTACCTATTGGCTCTTCTGCCCCTGACCGATCCCAACCAGAAGGATCTCAGAGGCTCCATCCTTTAGGATCCCCAATAAATGTAAGAGTGGAATCTGGCAGATCACAGCCTGAGGGATCCTGTCCTAGTCTCTTGTCCCCTACCCGGCAGTACCCACCTTTGCCTCCACCTCCATCCTCTCCTCATCGCTCTCCTGTCCTAAGTCCTAGAGGATCACCTGATGTCCCCAGGACTCTGCACAGAGCACACACTTCTAGACCCCAAGACCAGCATCCAACCCCTGAATGCATTCGACCTTCCCCAGCAAAAGCCGACAAATCCCAAGGTGATAGTACAGTGGATGTAGCAGGGAAGGACTTCAGGATATATGTTATCACATGGAACGTTGGATGTGCTGTGCCACCCTCGGACCTTACTTCCCTCCTCTGCCTCAATGCTAGAGATGATAAAATCGATATGTTTGTTATCGGGCTGCAAGAGGTCAATTCTATGATCAATAAACGCCTGANAGATGCTCTGTTTTCCGATCAGTGGAGCGAGGTCTTTATGGATGTCCTCAGTCCTTTCAGCTATGTTTTGGTCAGCTCAGTAAGAATGCAAGGTTGTCTACTGCTGGTGTTTTCAAAGTATTTCCACTTGCCTTT
  5   1   2      seed Brn3 FLt5 out                        CAAK8345.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCACAGGAGAGGAGAGGGAGCAGCAGGGCACAGGAGGCGGATACCTGGCACAGGCAGATGGATTCACACGTACGTTATCCTGATCAATGTGTGTTTGTTGCTCCACCCTCACCTGAGCTTCCTCCCAGACCCACTACTTTACCATCTCCCCGGCTCAGCCCTGCAGGCTCGGGTAGGTCCCAACCTGAAGGATCAAGTAGCTTCCAAACTCCCCTCACAGCGGTACAGTTCTCCACCCGTCCTCTTTTACCTATTGGCTCTTCTGCCCCTGACCGATCCCAACCAGAAGGATCTCAGAGGCTCCATCCTTTAGGATCCCCAATAAATGTAAGAGTGGAATCTGGCAGATCACAGCCTGAGGGATCCTGTCCTAGTCTCTTGTCCCCTACCCGGCAGTACCCACCTTTGCCTCCACCTCCATCCTCTCCTCATCGCTCTCCTGTCCTAAGTCCTAGAGGATCACCTGATGTCCCCAGGACTCTGCACAGAGCACACACTTCTAGACCCCAAGACCAGCATCCAACCCCTGAATGCATTCGACCTTCCCCAGCAAAAGCCGACAAATCCCAAGGTGATAGTACAGTGGATGTAGCAGGGAAGGACTTCAGGATATATGTTATCACATGGAACGTTGGATGTGCTGTGCCACCCTCGGACCTTACTTCCCTCCTCTGCCTCAATGCTAGAGATGATAAAATCGATATGTTTGTTATCGGGCTGCAAGAGGTCAATTCTATGATCAATAAACGCCTGANAGATGCTCTGTTTTCCGATCAGTGGAGCGAGGTCTTTATGGATGTCCTCAGTCCTTTCAGCTATGTTTTGGTCAGCTCAGTAAGAATGC
  5   1   2       bld In60                            IMAGE:8949384.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGCTGAGACTACCAGACAGGTATCGATTCGAATTCGTCCCCCCGGCTCAGCCCTGCAGGCTCGGGTAGGTCCCAACCTGAAGGATCAAGTAGCTTCCAAACTCCCCTCACAGCGGTACAGTTCTCCACCCGTCCTCTTTCACCTGTTGGCTCTTCTGCCCCTGACCGATCCCAACCAGAAGGATCTCAGAGGCTCCATCCTTTAGGATCCCCAATAAATGTAAGAGTGGAATCTGGCAGATCACAGCCTGAGGGATCCTGTCCTAGTCTCTTGTCCCCTACCCGGCAGTACCCACCTTTGCCTCCACCTCCATCCTCTCCTCATCGCTCTCCTGTCCTAAGTCCTAGAGGATCACCTGATGTCCCCAGGACTCCGCACAGAGCACACACTTCTAGACCCCAAGACCAGCATCCAACCCCTGAATGCATTCGACCTTCCCCAGCAAAAGCCGACAAATCCCAAGGTGATAGTACAGTGGATGTAGCAGGGAAGGACTTCAGGATATATGTTATCACATGGAATGTTGGATGTGCTGTGCCACCCTCGGACCTTACTTCCCTCCTCTGCCTCAATGCTAGAGATGATAAAAATCGATATGTTTGTTATCGGGGCTGCAAGAGGTCAATTCTATGATCAATAAACGCCTGAAAGATGCTCTGTTTTTCCGATCAGTGGAGCGAGGTCTTTATGGATGTCCTCAGTCCTTTCAGCTATGTTTTGGTCAGCTCATAAGAATGCCAGTTGTCTGCTGCTGGTGTTTTCAAAGTAATTCCACTTGCCTTTCCTCCGGAACTACGACTGACTGCACAAGACTGGCCTCGGAGAATCTGGGTTATTAGGTGGAGTCAGCAATCGAATAATCTCTTTTTGTCCATGTAATGTTTTTCCTTAATTGCCATCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)