Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     11.6699999999999999    0Xt7.1-CAAM3510.3                            8 END     3          75       37                (no blast hit)

 This cluster: approximate FL confidence score = 93%

 1012099602 Xt7.1-THdA008c05.5 - 4 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-THdA008c05.5 AGCAGCTGAGCGAGGATTAGAGGAAAGAGGGAGAGGTGCACTTCCCTTTACAGTCACGGGGTACAGGGGTGAAGGTGATTCCGAAACGGCACTGGGTGCAGGGAAAACTGATGGGATTGGCTGTTCCGCTAACAGATGTGGCACCTGCTGGAGGAGCGCAGTAGGGGAAGGGTTAATGACAAATAAAGACTATAAGAAGGAGGCCATTTTCAGCACCGGGGGCAATATTAGCTGCTTATTCCCAAGCGAGGAGGATTAACCTGCGAGTCTCATAATTAGGATGGCGTGCTTCTTGCGCTGGTTGCTGCTCCTCTCATTGGCCAGTGCTGCCCTGAGTCTGCCTCTCTGGACAAAGCGCAGTGGTCTCATAGAAATGGAGGACAGCATCCGGCTTGGGGGCAATATTATTCTGACCCCCAGTGAGGCGACGGCTAATTGGAAGCTAATGACAGTGAAGGAAGCTGAGATCAAGGAGGCTGAAAGGACTGGCTTATTTCCTCCCAGCATGCACTTCTTTAAGGCCCGCCCACTCATCCAGCAGAGCAAAATTTTTAGTATTGTGCGTCAGATGCCGAAGGGGGCTGCTTTGCATTTACATGACTTTGCCATTCTCAGTGTGGATTGGCTGGTGAAGAATGCCACCTACATGCAGGACTGCTACATTTGCTTTACCAGGGATGGGGGAGCCAGGTTCTTGTTCTCCAAGCCTGCCCCTGTGGGAATGCTGCCCCCTGGCTGCTCGGAGTGGGTCCTGCTGGAGACTTACAGGAAGAAGCTGGGAGATGTGACCGAGTTTGACAAAGGCCTAATACGGAACCTGACGCTGCTGGCCGAGTCGCCCGAGCCGCACATCCCGTCACAGGATGAGATCTGGAGAAGGTTCGAGGGGGCTTTCATCACCGCTTCGGGGCTCATCTGCTATGCCCCTGTCTTTAAGGAGTATTTCTATGAGAGTCTGAAGGAACTGTATGAAGATAATATCCAGTACATAGAAATGAGAGCCATGCTCCCCCCGGTGTACGAGCTTGATGGAACTGTCCACGACCCGTTCTGGTCCATGGCTTTATACAGGGATGTGACCAATCAGTTTATTGGAGCCCACCCAGACTTCTTGGGTGCTAAAATTATCTACACCGTGCACAGGCATGAAGATCTAGCCCGAGTTACGCAGGCCGTGCACCTCGCAATGGAGCTGATGAAAGAATTCCCCGAAATCATGGCTGGATTTGATTTGGTTGGCCAAGAGGATGCTGGTAATTCCCTATATCAGCTGAGTGATGCCCTCAACATCCCCAGCAAGTTGGGAGTCAAGCTGCCATACTTCTTTCACGCAGGAGAGACCAATTGGCAGGGAAAGGACGTGGATGAGAATGTTCTGGATGCGCTGCTGCTGAACACCACCAGGATAGGCCATGGCTACGCCCTCCTCAAGCACCCGGTGGCCCGGAACTTGTCTCTTAAAATGGAAGTCCCCCTGGAGATCTGCCCTATCTCCAACCAGGTTCTCCTGCTGGTGTCCGACCTCCGCAATCACCCTGCCGCAGTGCTTATGGCTGAAGGGCACCCCCTGGTGGTCAGTTCTGATGACCCATCCATTTTCGGTGCCCAGGGACTTTCCTATGACTTTTATGAAGTTGTTATGGGAATTGGAGGTGCCAAGGCAGATCTGAGGACCCTCAAAAAGCTTGCTGAGAATTCTATCAAGTACAGTGCTTTGTCAAAGGAGGGAAAAGCAAAACTTACAGAAATATGGCAGAGGAAATGGGACAAGTTCATCGAAGATCTTGCCATGAACTCAAA
                                                  Xt7.1-CHK-1008246438       TGAGCGAGGATTAGAGGAAAGAGGGAGAGGTGCACTTCCCTTTACAGTCACGGGGTACAGGGGTGAAGGTGATTCCGAAACGGCACTGGGTGCAGGGAAAACTGATGGGATTGGCTGTTCCGCTAACAGATGTGGCACCTGCTGGAGGAGCGCAGTAGGGGAAGGGTTAATGACAAATAAAGACTATAAGAAGGAGGCCATTTTCAGCACCGGGGGCAATATTAGCTGCTTATTCCCAAGCGAGGAGGATTAACCTGCGAGTCTCATAATTAGGATGGCGTGCTTCTTGCGCTGGTTGCTGCTCCTCTCATTGGCCAGTGCTGCCCTGAGTCTGCCTCTCTGGACAAAGCGCAGTGGTCTCATAGAAATGGAGGACAGCATCCGGCTTGGGGGCAATATTATTCTGACCCCCAGTGAGGCGACGGCTAATTGGAAGCTAATGACAGTGAAGGAAGCTGAGATCAAGGAGGCTGAAAGGACTGGCTTATTTCCTCCCAGCATGCACTTCTTTAAGGCCCGCCCACTCATCCAGCAGAGCAAAATTTTTAGTATTGTGCGTCAGATGCCGAAGGGGGCTGCTTTGCATTTACATGACTTTGCCATTCTCAGTGTGGATTGGCTGGTGAAGAATGCCACCTACATGCAGGACTGCTACATTTGCTTTACCAGGGATGGGGGAGCCAGGTTCTTGTTCTCCAAGCCTGCCCCTGTGGGAATGCTGCCCCCTGGCTGCTCGGAGTGGGTCCTGCTGGAGACTTACAGGAAGAAGCTGGGAGATGTGACCGAGTTTGACAAAGGCCTAATACGGAACCTGACGCTGCTGGCCGAGTCGCCCGAGCCGCACATCCCGTCACAGGATGAGATCTGGAGAAGGTTCGAGGGGGCTTTCATCACCGCTTCGGGGCTCATCTGCTATGCCCCTGTCTTTAAGGAGTATTTCTATGAGAGTCTGAAGGAACTGTATGAAGATAATATCCAGTACATAGAAATGAGAGCCATGCTCCCCCCGGTGTACGAGCTTGATGGAACTGTCCACGACCCGTTCTGGTCCATGGCTTTATACAGGGATGTGACCAATCAGTTTATTGGAGCCCACCCAGACTTCTTGGGTGCTAAAATTATCTACACCGTGCACAGGCATGAAGATCTAGCCCGAGTTACGCAGGCCGTGCACCTCGCAATGGAGCTGATGAAAGAATTCCCCGAAATCATGGCTGGATTTGATTTGGTTGGCCAAGAGGATGCTGGTAATTCCCTATATCAGCTGAGTGATGCCCTCAACATCCCCAGCAAGTTGGGAGTCAAGCTGCCATACTTCTTTCACGCAGGAGAGACCAATTGGCAGGGAAAGGACGTGGATGAGAATGTTCTGGATGCGCTGCTGCTGAACACCACCAGGATAGGCCATGGCTACGCCCTCCTCAAGCACCCGGTGGCCCGGAACTTGTCTCTTAAAATGGAAGTCCCCCTGGAGATCTGCCCTATCTCCAACCAGGTTCTCCTGCTGGTGTCCGACCTCCGCAATCACCCTGCCGCAGTGCTTATGGCTGAAGGGCACCCCCTGGTGGTCAGTTCTGATGACCCATCCATTTTCGGTGCCCAGGGACTTTCCTATGACTTTTATGAAGTTGTTATGGGAATTGGAGGTGCCAAGGCAGATCTGAGGACCCTCAAAAAGCTTGCTGAGAATTCTATCAAGTACAGTGCTTTGTCAAAGGAGGGAAAAGCAAAACTTACAGAAATATGGCAGAGGAAATGGGACAAGTTCATCGAAGATCTTGCCATGAACTCAAAGACTTC
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     280      62 
                                               BLH MIN     259     135 
                                               BLH MPR     142     135 
                                               BLH OVR     280     104 
                                               ORF LNG     280      25 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 5e-008     NP_871955.2 C44B7.12 [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                     PREDICTED - Sp ---- 3e-095     XP_001196888.1 PREDICTED: similar to mollusk-derived growth factor; MDGF, partial [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                         PROTEIN --- Dm ---- 4e-103     NP_649006.2 CG5998-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Dr ---- 9e-158     XP_696865.1 PREDICTED: similar to Cecr1 protein [Danio rerio] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Hs ---- 2e-169     NP_059120.2 cat eye syndrome critical region protein 1 isoform a precursor [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                 PREDICTED = Gg ==== 5e-178     NP_001025938.1 hypothetical protein LOC418160 [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xl ==== 0          AAY42597.1 insect-derived growth factor-B-like protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                               PROTEIN === ?? ==== 0          NP_001090531.1 insect-derived growth factor-B-like protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-THdA008c05.5                                                                                                                                                                                ATG------------------------------------------------------------------------------TAA---------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ...
  5   1   1   24  add Brn3 5g                             CAAK11199.5p AGCAGCTGAGCGAGGATTAGAGGAAAGAGGGAGAGGTGCACTTCCCTTTACAGTCACGGGGTACAGGGGTGAAGGTGATTCCGAAACGGCACTGGGTGCAGGGAAAACTGATGGGATTGGCTGTTCCGCTAACAGATGTGGCACCTGCTGGAGGAGCGCAGTAGGGGAAGGGTTAATGACAAATAAAGACTATAAGAAGGAGGCCATTTTCAGCACCGGGGGCAATATTAGCTGCTTATTCCCAAGCGAGGAGGATTAACCTGCGAGTCTCATAATTAGGATGGCGTGCTTCTTGCGCTGGTTGCTGCTCCTCTCATTGGCCAGTGCTGCCCTGAGTCTGCCTCTCTGGACAAAGCGCAGTGGTCTCATAGAAATGGAGGACAGCATCCGGCTTGGGGGCAATATTATTCTGACCCCCAGTGAGGCGACGGCTAATTGGAAGCTAATGACAGTGAAGGAAGCTGAGATCAAGGAGGCTGAAAGGACTGGCTTATTTCCTCCCAGCATGCACTTCTTTAAGGCCCGCCCACTCATCCAGCAGAGCAAAATTTTTAGTATTGTGCGTCAGATGCCGAAGGGGGCTGCTTTGCATTTACATGACTTTGCCATTCTCAGTGTGGATTGGCTGGTGAAGAATGCCACCTACATGCAGGACTGCTACATTTGCTTTACCAGGGATGGGGGAGCCAGGTTCTTGTTCTCCAAGCCTGCCCCTGTGGGAATGCTGCCCCCTGGCTGCTCGGAGTGGGTCCTGCTGGAGACTTACAGGAAGAAGCTGGGAGATGTGACCGAGTTTGANCAAGCCTAATACGGAACTGACGCTGCTGGCCG
  5   1   1       add Brn3      out                        CAAK5437.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGTGCACTTCCCTTTACAGTCACGGGGTACAGGGGTGAAGGTGATTCCGAAACGGCACTGGGTGCAGGGAAAACTGATGGGATTTGCTTTACCAGGGATGGGGGAGTCAGGTTCTTGTTCTCCAAGCCTGCCCCTGTGGGAATGCTGCCCCCTGGCTGCTCGGAGTGGGTCCTGCTGGAGACTTACAGGAAGAAGCTGGGAGATGTGACCGAGTTTGACAAAGGCCTAATACGGAACCTGACGCTGCTGGCCGAGTCGCCCGAGCCGCACATCCCGTCACAGGATGAGATCTGGAGAAGGTTCGAGGGGGCTTTCATCACCGCTTCGGGGCTCATCTGCTATGCCCCTGTCTTTAAGGAGTATTTCTATGAGAGTCTGAAGGAACTGTATGAAGATAATATCCAGTACATAGAAATGAGAGCCATGCTCCCCCCGGTGTACGAGCTTGATGGAACTGTCCACGACCCGTTCTGGTCCATGGCTTTATACAGGGATGTGACCAATCAGTTTATTGGAGCCCACCCAGACTTCTTGGGTGCTAAAATTATCTAcaccatctctccctactatacctgctatcccacagccccagtcccttcccagaggctattatcctcccactgttactataggcaccatctctccctactatacctgctatcccacagccccagtcccttcccagaggctattatccccccactgttactataggcaccatctctccctattatacctgctatcccacagccccagtcccttcccagaggctattatccc
  5   1   2      seed HdA       out                  THdA008c05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCCCGGGGTGAAGGAACTGTATGAAGATAATATCCAGTACATAGAAATGAGAGCCATGCTCCCCCCGGTGTACGAGCTTGATGGAACTGTCCACGACCCGTTCTGGTCCATGGCTTTATACAGGGATGTGACCAATCAGTTTATTGGAGCCCACCCAGACTTCTTGGGTGCTAAAATTATCTACACCGTGCACAGGCATGAAGATCTAGCCCGAGTTACGCAGGCCGTGCACCTCGCAATGGAGCTGATGAAAGAATTCCCCGAAATCATGGCTGGATTTGATTTGGTTGGCCAAGAGGATGCTGGTAATTCCCTATATCAGCTGAGTGATGCCCTCAACATCCCCAGCAAGTTGGGAGTCAAGCTGCCATACTTCTTTCACGCAGGAGAGACCAATTGGCAGGGAAAGGACGTGGATGAGAATGTTCTGGATGCGCTGCTGCTGAACACCACCAGGATAGGCCATGGCTACGCCCTCCTCAAGCACCCGGTGGCCCGGAACTTGTCTCTTAAAATGGAAGTCCCCCTGGAGATCTGCCCTATCTCCAACCAGGTTCTCCTGCTGGTGTCCGACCTCCGCAATCACCCTGCCGCAGTGCTTATGGCTGAAGGGCACCCCCTGGTGGTCAGTTCTGATGACCCATCCATTTTCGGTGCCCAGGGACTTTCCTATGACATTTAT
  5   1   2       bld Fat1      out                         CABC474.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACGAGCTTGATGGAACTGTCCACGACCCGTTCTGGTCCATGGCTTTATACAGGGATGTGACCAATCAGTTTATTGGAGCCCACCCAGACTTCTTGGGTGCTAAAATTATCTACACCGTGCACAGGCATGAAGATCTAGCCCGAGTTACGCAGGCCGTGCACCTCGCAATGGAGCTGATGAAAGAATTCCCCGAAATCATGGCTGGATTTGATTTGGTTGGCCAAGAGGATGCTGGTAATTCCCTATATCAGCTGAGTGATGCCCTCAACATCCCCAGCAAGTTGGGAGTCAAGCTGCCATACTTCTTTCACGCAGGAGAGACCAATTGGCAGGGAAAGGACGTGGATGAGAATGTTCTGGATGCGCTGCTGCTGAACACCACCAGGATAGGCCATGGCTACGCCCTCCTCAAGCACCCGGTGGCCCGGAACTTGTCTCTTAAAATGGAAGTCCCCCTGGAGATCTGCCCTATCTCCAACCAGGTTCTCCTGCTGGTGTCCGACCTCCGCAATCACCCTGCCGCAGTGCTTATGGCTGAAGGGCACCCCCTGGTGGTCAGTTCTGATGACCCATCCATTTTCGGTGCCCAGGGACTTTCCTATGACTTTTATGAAGTTGTTATGGGAATTGGAGGTGCCAAGGCAGATCTGAGGACCCTCAAAAAGCTTGCTGAGAATTCTATCAAGTACAGTGCTTTGTCAAAGGAGGGAAAAGCAAAACTTACAGAAATATGGCAGAGGAAATGGGACAAGTTCATCGAAGATCTTGCCATGAACTCAAAGACTTCAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)