Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 32%

 1012099840 Xt7.1-CAAK2064.5 - 2 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAK2064.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGGGGCACAGGGAGGGGGGCGGATTGGCACCGGGCAGCAGCGCAACATGGCGAAGGGCAGGCAAGTGAGTGGGCCGGGCTCATCGGCCGAGTATAAGCACCTTGTGGACACCGATGAGGAAGAGGAAGATGAGACAATCTGGAGGAAGGAAACAGAAAGGCCGTGCTCCTTCCCTCCCCATAAGACATTGGCCATAATTTGCTTCATGGTGGTGGTCCTGTGCTTCCTTGTGGCCGGTTTGGCCTATCTGTCTGGAAACTCGGCGTGCACTCTGGCCGATGTGGAAATATCATGTGGGAAAGTGCGCGGGAAGCACTGCGGCAAAGTGTACAACTTTAAGGGGATTCCCTACGCCAGTCCCCCTACTGGCAGTTTGCGTTGGAGGCCGCCCAAGGAACCCACCTGCTGGAATAACACTCTGGACGCCATTGAGTTCAAGTCAATGTGCGCCCAAGTGCGGCCCTTGAGCAAAGACGGCAAAGCAATGGGCTCGGAAGACTGTTTGTACGTGAATGTCTGGACGACGTCAATTGACCATGATTCCAAGCTGCCAGTGATGGTCTGGATCCACGGGGGTTACCTGCATATGCTGAGTGGGTCAGAACCAGGGTACGGCCCAACCTCAGATTTAGCAGAACACGGGCCGGCCGTTCATGTCAGCTTCAACTATCGACTGAATGCCTTTGGGTTTATGGCTTTGCATCTGCTGAGAGAGGGATCTCCCACCAACACCTCTGGCAATTATGGATTCATGGACCAAGTGGCTGCTTTGCGCTGGGTGAAGAAAAACATCATGAAGTTTGGCGGTGACCCTGACAAGGTGACAATCTATGGCCAAAGCTCANGAGGCACCTCTGTTTGGGCGATGATGGTGTCACCTCTAGCCAAAGGTCTCTTC
                                                  Xt7.1-CHK-1008256835                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCACAGGGAGGGGGGCGGATTGGCACCGGGCAGCAGCGCAACATGGCGAAGGGCAGGCAAGTGAGTGGGCCGGGCTCATCGGCCGAGTATAAGCACCTTGTGGACACCGATGAGGAAGAGGAAGATGAGACAATCTGGAGGAAGGAAACAGAAAGGCCGTGCTCCTTCCCTCCCCATAAGACATTGGCCATAATTTGCTTCATGGTGGTGGTCCTGTGCTTCCTTGTGGCCGGTTTGGCCTATCTGTCTGGAAACTCGGCGTGCACTCTGGCCGATGTGGAAATATCATGTGGGAAAGTGCGCGGGAAGCACTGCGGCAAAGTGTACAACTTTAAGGGGATTCCCTACGCCAGTCCCCCTACTGGCAGTTTGCGTTGGAGGCCGCCCAAGGAACCCACCTGCTGGAATAACACTCTGGACGCCATTGAGTTCAAGTCAATGTGCGCCCAAGTGCGGCCCTTGAGCAAAGACGGCAAAGCAATGGGCTCGGAAGACTGTTTGTACGTGAATGTCTGGACGACGTCAATTGACCATGATTCCAAGCTGCCAGTGATGGTCTGGATCCACGGGGGTTACCTGCATATGCTGAGTGGGTCAGAACCAGGGTACGGCCCAACCTCAGATTTAGCAGAACACGGGCCGGCCGTTCATGTCAGCTTCAACTATCGACTGAATGCCTTTGGGTTTATGGCTTTGCATCTGCTGAGAGAGGGATCTCCCACCAACACCTCTGGCAATTATGGATTCATGGACCAAGTGGCTGCTTTGCGCTGGGTGAAGAAAAACATCATGAAGTTTGGCGGTGACCCTGACAAGGTGACAATCTATGGCCAAAGCTCANGAGGCACCTCTGTTTGGGCGATGATGGTGTCACCTCTAGCCAAAGGTCTCTTCCATCGT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG      48      49                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      48      71                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN -== Br ==== 5e-023     AAB18262.1 cholinesterase 1 [Branchiostoma lanceolatum] ==========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Bf ---- 7e-031     AAD05373.1 cholinesterase 1 [Branchiostoma floridae] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Cs ==== 2e-031     CAD29868.1 TPA: actylcholinesterase [Ciona savignyi] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 4e-031     NP_741812.1 carboxyl ester lipase family member (XG923) [Caenorhabditis elegans] -----==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Sp ---- 1e-031     XP_001201362.1 PREDICTED: similar to cholinesterase 1 [Strongylocentrotus purpuratus] ---------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Xt ---- 7e-033     AAH82503.1 Unknown (protein for MGC:89138) [Xenopus tropicalis] ----------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 3e-035     XP_690455.1 PREDICTED: similar to carboxylesterase 2 isoform 1 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Hs ---- 2e-036     NP_003860.2 carboxylesterase 2 isoform 1; intestinal carboxylesterase; livercarboxylesterase-2 [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Gg ==== 2e-037     XP_414148.2 PREDICTED: similar to LOC443703 protein [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dm ---- 2e-038     NP_524261.1 CG1112-PA, isoform A [Drosophila melanogaster] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Mm ---= 1e-038     NP_937814.1 hypothetical protein LOC234669 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xl ==== 8e-138     AAH82391.1 MGC81843 protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === ?? ==== 8e-138     NP_001087864.1 MGC81843 protein [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAK2064.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------ATG---------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------ATGATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ...
  5   1   2   24 seed Brn3 5g                              CAAK2064.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCGGGGCACAGGGAGGGGGGCGGATTGGCACCGGGCAGCAGCGCAACATGGCGAAGGGCAGGCAAGTGAGTGGGCCGGGCTCATCGGCCGAGTATAAGCACCTTGTGGACACCGATGAGGAAGAGGAAGATGAGACAATCTGGAGGAAGGAAACAGAAAGGCCGTGCTCCTTCCCTCCCCATAAGACATTGGCCATAATTTGCTTCATGGTGGTGGTCCTGTGCTTCCTTGTGGCCGGTTTGGCCTATCTGTCTGGAAACTCGGCGTGCACTCTGGCCGATGTGGAAATATCATGTGGGAAAGTGCGCGGGAAGCACTGCGGCAAAGTGTACAACTTTAAGGGGATTCCCTACGCCAGTCCCCCTACTGGCAGTTTGCGTTGGAGGCCGCCCAAGGAACCCACCTGCTGGAATAACACTCTGGACGCCATTGAGTTCAAGTCAATGTGCGCCCAAGTGCGGCCCTTGAGCAAAGACGGCAAAGCAATGGGCTCGGAAGACTGTTTGTACGTGAATGTCTGGACGACGTCAATTGACCATGATTCCAAGCTGCCAGTGATGGTCTGGATCCACGGGGGTTACCTGCATATGCTGAGTGGGTCAGAACCAGGGTACGGCCCAACCTCAGATTTAGCAGAACACGGGCCGGCCGTTCATGTCAGCTTCAACTATCGACTGAATGCCTTTGGGTTTATGGCTTTGCATCTGCTGAGAGAGGGATCTCCCACCAACACCTCTGGCAATTATGGATTCATGGACCAAGTGGCTGCTTTGCGCT
  5   1   2       bld Ovi1      ?                         CABI12056.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCGGCACGAGGGCCGAGTATAAGCACCTTGTGGACACCGATGAGGAAGAGGAAGATGAGACAATCTGGAGGAAGGAAACAGAAAGGCCGTGCTCCTTCCCTCCCCATAAGACATTGGCCATAATTTGCTTCATGGTGGTGGTCCTGTGCTTCCTTGTGGCCGGTTTGGCCTATCTGTCTGGAAACTCGGCGTGCACTCTGGCCGATGTGGAAATATCATGTGGGAAAGTGCGCGGGAAGCACTGCGGCAAAGTGTACAACTTTAAGGGGATTCCCTACGCCAGTCCCCCTACTGGCAGTTTGCGTTGGAGGCCGCCCAAGGAACCCACCTGCTGGAATAACACTCTGGACGCCATTGAGTTCAAGTCAATGTGCGCCCAAGTGCGGCCCTTGAGCAAAGACGGCAAAGCAATGGGCTCGGAAGACTGTTTGTACGTGAATGTCTGGACGACGTCAATTGACCATGATTCCAAGCTGCCAGTGATGGTCTGGATCCACGGGGGTTACCTGCATATGCTGAGTGGGTCAGAACCAGGGTACGGCCCAACCTCAGATTTAGCAGAACACGGGCCGGCCGTTCATGTCAGCTTCAACTATCGACTGAATGCCTTTGGGTTTATGGCTTTGCATCTGCTGAGAGAGGGATCTCCCACCAACACCTCTGGCAATTATGGATTCATGGACCAAGTGGCTGCTTTGCGCTGGGTGAAGAAAAACATCATGAAGTTTGGCGGTGACCCTGACAAGGTGACAATCTATGGCCAAAGCTCANGAGGCACCTCTGTTTGGGCGATGATGGTGTCACCTCTAGCCAAAGGTCTCTTCCATCGTGCCAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)