Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 18%

 1012100565 Xt7.1-TNeu030f21.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TNeu030f21.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTCTGTGTAGGGATTCACAGGCACCTAAAGGGAGAAGAGATCTGAGATTTGGTGCCCTAGCATTCAGTGAGATGGATCCCAGCATCTACTACTGCCCAGAGCTTGCCCCGCAGGAGGTCCCAAGCCTGGAGGGAAGATCAGAAGATTTATTGTATGACGACACTGGCTTTCTCCCTGACTCTGACCTGAGTGGCTTTCAGCTGAGTGCAGGGAAGGGACTGTACCCCAACCCAGAGAGCCTGAGACCCGCCGGGGGTCCGAACAGCAGCACCCCCTCCTCCGAGCCCTTCCCAGAACCATCTCTGTATTACTGGGAGCACTACGCCACAGGTGCAAGCGGCCTTCCGACTCCCGGGAACTCCCTGCCCTGTGAATACCTGCCCTCTTTCCAGACGTTGCTCCCGGCGCTCACAGAGCAAATGCAGAGCCAGCCAGGGCAGCAGGACATGACGCCCCCTACTGGGGACTTGCTGTACCACACCCAGCACCCCTCTCCCTTTGAGGCAATGGAAGAAAGCTACTCGCAGGGCGCGGGTGCCGGCACGGTCGGCGACCAGAGTTTCTCGTGGGCATCGCAGGAATGGCACAGCTGGGACGAAGCTGCCTGGATGGGCTGCAACTCCTTTGAGACCCCGGTTCCCCCCTCCCTCAATGTGAATCCAGGAAGCCAATGTTCCGCCGCAAACAGAGCTCCCCCTGCAGCTTTTCCCCTAAATGACTCTACTCACTACGAAGCCCTCAGCCTGGGCCGTCACCGATCCGGTACAGAAAATGAAAGATACCATCACCCCTACAGTCAGAGCCCTGCCCGGAATAAGGACAAGAAGCCACCCCCAACAGCAAGTTCTGGCCCGATTCAACTCTGGCAGTTCCTCCTGGAATTACTGCAAGATTCCTCCTGTCAGAAGCTTATCAGTTGGACGGGGAACGGCTGGGAGTTTAAACTATCTGACCCCAACGAGGTGGCCAGGCGATGGGGCAGACGGAAGAACAAGCCGCGGATGAACTACGAGAAGCTGAGCCGGGGGCTGCGCTACTATTACCACAAGAACATCATACATAAGACTGGAGGGCAGCGA
                                                  Xt7.1-CHK-1008250182                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTAGGGATTCACAGGCACCTAAAGGGAGAAGAGATCTGAGATTTGGTGCCCTAGCATTCAGTGAGATGGATCCCAGCATCTACTACTGCCCAGAGCTTGCCCCGCAGGAGGTCCCAAGCCTGGAGGGAAGATCAGAAGATTTATTGTATGACGACACTGGCTTTCTCCCTGACTCTGACCTGAGTGGCTTTCAGCTGAGTGCAGGGAAGGGACTGTACCCCAACCCAGAGAGCCTGAGACCCGCCGGGGGTCCGAACAGCAGCACCCCCTCCTCCGAGCCCTTCCCAGAACCATCTCTGTATTACTGGGAGCACTACGCCACAGGTGCAAGCGGCCTGCCGACTCCCGGGAACTCCCTGCCCTGTGAATACCTGCCCTCTTTCCAGACGTTGCTCCCGGCGCTCACAGAGCAAATGCAGAGCCAGCCAGGGCAGCAGGACATGACGCCCCCTACTGGGGACTTGCTGTACCACACCCAGCACCCCTCTCCCTTTGAGGCAATGGAAGAAAGCTACTCGCAGGGCGCGGGTGCCGGCACGGTCGGCGACCAGAGTTTCTCGTGGGCATCGCAGGAATGGCACAGCTGGGACGAAGCTGCCTGGATGGGCTGCAACTCCTTTGAGACCCCGGTTCCCCCCTCCCTCAATGTGAATCCAGGAAGCCAATGTTCCGCCGCAAACAGAGCTCCCCCTGCAGCTTTTCCCCTAAATGACTCTACTCACTACGAAGCCCTCAGCCTGGGCCGTCACCGATCCGGTACAGAAAATGAAAGATACCATCACCCCTACAGTCAGAGCCCTGCCCGGAATAAGGACAAGAAGCCACCCCCAACAGCAAGTTCTGGCCCGATTCAACTCTGGCAGTTCCTCCTGGAATTACTGCAAGATTCCTCCTGTCAGAAGCTTATCAGTTGGACGGGGAACGGCTGGGAGTTTAAACTATCTGACCCCAACGAGGTGGCCAGGCGATGGGGCAGACGGAAGAACAAGCCGCGGATGAACTACGAGAAGCTGAGCCGGGGGCTGCGCTACTATTACCACAAGAACATCATACATAAGACTGGAGGGCAGCGATACGTG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG      72      25                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      69      69                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Bb ==== 3e-020     BAE46385.1 Ets1/2 [Branchiostoma belcheri] ======================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ce ---- 9e-025     NP_001022326.1 T08H4.3 [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 4e-035     BAE06419.1 transcription factor protein [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Dm ---- 2e-035     NP_732858.1 pointed CG17077-PC [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Sp ---- 2e-036     NP_999698.1 ets homolog [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Mm ---- 4e-038     NP_035938.2 E26 avian leukemia oncogene 1, 5' domain isoform 1 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Hs ---- 2e-038     NP_005229.1 v-ets erythroblastosis virus E26 oncogene homolog 1; Avian erythroblastosisvirus E26 (v-ets) oncogene homolog-1; v-ets avian erythroblastosis virus E2oncogene homolog 1; v-ets avian erythroblastosis virus E26 oncogene homolog 1;v-ets erythroblastosis virus [Homo sapiens]  --------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Dr ==== 1e-038     NP_001032452.1 hypothetical protein LOC555766 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Gg ---- 3e-040     XP_001231221.1 PREDICTED: hypothetical protein [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 6e-166     AAH99054.1 MGC115679 protein [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = ?? ==== 6e-166     NP_001089600.1 hypothetical protein LOC734657 [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TNeu030f21.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ...
  5   1   2       bld Gas1 5g                            IMAGE:6987583                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTCTGTGTAGGGATTCACAGGCACCTAAAGGGAGAAGAGATCTGAGATTTGGTGCCCTAGCATTCAGTGAGATGGATCCCAGCATCTACTACTGCCCAGAGCTTGCCCCGCAGGAGGTCCCAAGCCTGGAGGGAAGATCAGAAGATTTATTGTATGACGACACTGGCTTTCTCCCTGACTCTGACCTGAGTGGCTTTCAGCTGAGTGCAGGGAAGGGACTGTACCCCAACCCAGAGAGCCTGAGACCCGCCGGGGGTCCGAACAGCAGCACCCCCTCCTCCGAGCCCTTCCCAGAACCATCTCTGTATTACTGGGAGCACTACGCCACAGGTGCAAGCGGCCTTCCGACTCCCGGGAACTCCCTGCCCTGTGAATACCTGCCCTCTTTCCAGACGTTGCTCCCGGCGCTCACAGAGCAAATGCAGAGCCAGCCAGGGCAGCAGGACATGACGCCCCCTACTGGGGACTTGCTGTACCACACCCAGCACCCCTCTCCCTTTGAGGCAATGGAAGAAAGCTACTCGCAGGGCGCGGGCGCCGGCACGGTCGGCGACCAGAGTTTCTCGTGGGCATCGCAGGAATGGCACAGCTGGGACGAAGCCGCCTGGATGGGCTGCAACTCCTTTGAGACCCCGGTTCCCCCCTCCCTCAATGTGAATCCAGGAAGCCAATGTTCCGCCGCANACAGAGCTCCCCCTGCAGCTTTTCCCCTAAATGACTCTACTCACTACGAAGCCCTCAGCCTGGGCCGTCACCGATCCGGTACAGANATGAAAGATACCATCACCCCTACAGTCAGAGCCCTGCCCGGAATANGGACAAGGAGCCACCCCCCACAGCAAGTTCTTGCCCCGATTCCACTCTGGCCAGTCCNTCCTGGAATTACTGCAAGAATTCCTCCTGTCAGAAGCTTTATCATTTGGGACGGGGAAACGGCCTGGGAAGTTTTAAACCTATCTGGACCCCAACGAGGGTTGGGCAGGT
  5   1   2   22 seed Tad5 PIPE                            XZT16753.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATTCACAGGCACCTAAAGGGAGAAGAGATCTGAGATTTGGTGCCCCAGCATTCAGTGAGATGGATCCCAGCATCTACTACTGCCCAGAGCTTGCCCCGCAGGAGGTCCCAAGCCTGGAGGGGAGATCAGAAGATTTATTGTATGACGACACTGGCTTTCTCCCTGACTCTGACCTGAGTGGCTTTCAGCTGAGTGCAGGGAAGGGACTGTACCCCAACCCAGAGAGCCTGAGACCCGCCGGGGGTCCGAACAGCAGCACCCCCTCCTCCGAGCCCTTCCCAGAACCATCTCTGTATTACTGGGAGCACTACGCCACAGGTGCAAGCGGCCTGCCGACTCCCGGGAACTCCCTGCCCTGTGAATACCTGCCCTCTTTCCAGACGTTGCTCCCGGCGCTCACAGAGCAAATGCAGAGCCAGCCAGGGCAGCAGGACATGACGCCCCCTACTGGGGACTTGCTGTACCACACCCAGCACCCCTCTCCCTTTGAGGCAATGGAAGAAAGCTACTCGCAGGGCGCGGGTGCCGGCACGGTCGGCGACCAGAGTTTCTCGTGGGCATCGCAGGAATGGCACAGCTGGGACGAAGCTGCCTGGATGGGCTGCAACTCCTTTGAGACCCCGGTTCCCCCC
  5   1   2       bld Neu                            TNeu030f21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGGCCTGCCGACTCCCGGGAACTCCCTGCCCTGTGAATACCTGCCCTCTTTCCAGACGTTGCTCCCGGCGCTCACAGAGCAAATGCAGAGCCAGCCAGGGCAGCAGGACATGACGCCCCCTACTGGGGACTTGCTGTACCACACCCAGCACCCCTCTCCCTTTGAGGCAATGGAAGAAAGCTACTCGCAGGGCGCGGGTGCCGGCACGGTCGGCGACCAGAGTTTCTCGTGGGCATCGCAGGAATGGCACAGCTGGGACGAAGCTGCCTGGATGGGCTGCAACTCCTTTGAGACCCCGGTTCCCCCCTCCTCCAATGTGAATCCAGGAAGCCAATGTTCCGCCGCAAACAGAGCTCCCCCTGCAGCTTTTCCCCTAAATGACTCTACTCACTACGAAGCCCTCAGCCTGGGCCGTCACCGATCCGGTACAGAAAATGAAAGATACCATCACCCCTACAGTCAGAGCCCTGCCCGGAATAAGGACAAGAAGCCACCCCCAACAGCAAGTTCTGGCCCGATTCAACTCTGGCAGTTCCTCCTGGAATTACTGCAAGATTCCTCCTGTCAGAAGCTTATCAGTTGGACGGGGAACGGCTGGGAGTTTAAACTATCTGACCCCAACGAGGTGGCCAGGCGATGGGGCAGACGGAAGAACAAGCCGCGGATGAACTACGAGAAGCTGAGCCGGGGGCTGCGCTACTATTACCACAAGAACATCATACATAAGACTGGAGGGCAGCGATACGTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)