Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK5361.3                            7 END     2          66       28                (no blast hit)
     2   2.0    0Xt7.1-TTbA079g06.5                          3 END     1          33       33                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012104523 Xt7.1-CAAL8315.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAL8315.5 AGGGAGACAATTCTTCCAGGCTTCAGCAACCTGCTACATTTATATATATATATATATATATATTTTGTTGCTGGATTTTTTTTTTCAAGTGATGCCTGCCTTTCTCCTGAAGATGGTCATGGTTTGAAGTCAAACTGGTTTTAAAAGTCATTGATCTGCCCACCAGACCTGGCGCCCTCATGGCTTCTGGGGTTGCAGCATGGCTGCCCTTTGCAAGGGCGGCAGCGATTGGGTGGATGCCAGTGGCCAACTGCCCTATGCCATTGGCCCCAGCTGACAAGAACAAAAGACAAGATGAGGTGATAATTCTCAATGTCAGTGGGCGTCGATTCCAGACCTGGAGAACTACCTTAGAGAGGTACCCTGATACACTACTGGGAAGCACTGAAAAGGAATTCTTCTTTAATGAGGAAACCAAGGAATACTTCTTTGACCGTGATCCTGAAGTCTTCAGGTGCATCCTTAACTTTTACAGAACAGGCAAGCTGCATTACCCCAGGTATGAGTGCATCTCTGCTTACGACGAAGAACTTGCTTTTTATGGGATATTGCCTGAAATCATAGGGGACTGCTGCTATGAAGAATACAAAGACAGAAAAAGAGAAAATGCAGAAAGGTTGATGGATGACAATGAATTTGAGAACAATCAAGAAGCCATGCCCTCACTTACTTTACGCCAGACAATGTGGCGCGCCTTTGAAAATCCCCATACCAGCACTTTAGCCTTAGTCTTCTACTATGTAACTGGCTTCTTTATTGCAGTGTCGGTCATCACCAATGTTGTGGAAACTGTGCCCTGTGGCACCGTACCTGGAAATAAGGAGCTTCCATGTGGTGAAAGATATGATGTAGCCTTCTTTTGCCTGGACACTGCATGTGTAATGATTTTCACAGTTGAATACCTTTTGAGACTTTTTGCAGCCCCAAGTCGCTACAGGTTCATGAGAAGTGTCATGAGCATCATTGATGTAGTTGCCATCATGCCATACTACATTGGCTTGGTAATGACCAACAATGAGGATGTGAGTGGTGCTTTCGTCACCTTGCGGGTATTCCGGGTCTTCAGGATTTTCAAGTTCTCTCGCCACTCCCAGGGCTTAAGGATCCTTGGATACACCCTAAAGAGTTGTGCCTCTGAACTGGGATTCCTGCTCTTCTCTTTGACCATGGCAATCATTATCTTTGCCACTGTGATGTTTTATGCTGAGAAAGGGTCATCATCCAGCAAATTCACAAGCATCCCAGCTTCCTTTTGGTATACTATTGTTACCATGACGACACTTGGGTAAGTCGTGATCCCCTTATTATGTTTATTCAACATAGAGAGTTGCTGCAGCCTTGGAACCCTTCGTTTTTCAGGTAGATTTCAGCTCCTCCACAATGACATTTAATGACACTCTCATGGGATTTCAAATGCATTTTCCTTTTTCACTAAGCTGCTTACACAGACACACAAAATCAATTAGAGGAGATAGTGCTGGGGTAAAACAACAGATTATAATTATGTCTTTTCTTTGTGTGTTTCTCACTTGTAGCGGCTTCCTTGATTAGTTGTCTCTTGATGAGATGAAGGTGACTTTTTATATTATGTCTCGGAAATGAGGCAGATTTGTAGGTATACACTAAAATATATGCAATTAGGGAAAATGAAAGCAACATATGTTATGGTGAATTCTTAAAGAAAAAGACAAAATGGAAATGTTATACATATATTTTTTAATGTAATGTGCATTCATACTTAGGTAAAAATTGCCATATTAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008250348       ACAATTCTTCCAGGCTTCAGCAACCTGCTACATTTATATATATATATATATATATATTTTGTTGCTGGATTTTTTTTTTCAAGTGATGCCTGCCTTTCTCCTGAAGATGGTCATGGTTTGAAGTCAAACTGGTTTTAAAAGTCATTGATCTGCCCACCAGACCTGGCGCCCTCATGGCTTCTGGGGTTGCAGCATGGCTGCCCTTTGCAAGGGCGGCAGCGATTGGGTGGATGCCAGTGGCCAACTGCCCTATGCCATTGGCCCCAGCTGACAAGAACAAAAGACAAGATGAGGTGATAATTCTCAATGTCAGTGGGCGTCGATTCCAGACCTGGAGAACTACCTTAGAGAGGTACCCTGATACACTACTGGGAAGCACTGAAAAGGAATTCTTCTTTAATGAGGAAACCAAGGAATACTTCTTTGACCGTGATCCTGAAGTCTTCAGGTGCATCCTTAACTTTTACAGAACAGGCAAGCTGCATTACCCCAGGTATGAGTGCATCTCTGCTTACGACGAAGAACTTGCTTTTTATGGGATATTGCCTGAAATCATAGGGGACTGCTGCTATGAAGAATACAAAGACAGAAAAAGAGAAAATGCAGAAAGGTTGATGGATGACAATGAATTTGAGAACAATCAAGAAGCCATGCCCTCACTTACTTTACGCCAGACAATGTGGCGCGCCTTTGAAAATCCCCATACCAGCACTTTAGCCTTAGTCTTCTACTATGTAACTGGCTTCTTTATTGCAGTGTCGGTCATCACCAATGTTGTGGAAACTGTGCCCTGTGGCACCGTACCTGGAAATAAGGAGCTTCCATGTGGTGAAAGATATGATGTAGCCTTCTTTTGCCTGGACACTGCATGTGTAATGATTTTCACAGTTGAATACCTTTTGAGACTTTTTGCAGCCCCAAGTCGCTACAGGTTCATGAGAAGTGTCATGAGCATCATTGATGTAGTTGCCATCATGCCATACTACATTGGCTTGGTAATGACCAACAATGAGGATGTGAGTGGTGCTTTCGTCACCTTGCGGGTATTCCGGGTCTTCAGGATTTTCAAGTTCTCTCGCCACTCCCAGGGCTTAAGGATCCTTGGATACACCCTAAAGAGTTGTGCCTCTGAACTGGGATTCCTGCTCTTCTCTTTGACCATGGCAATCATTATCTTTGCCACTGTGATGTTTTATGCTGAGAAAGGGTCATCATCCAGCAAATTCACAAGCATCCCAGCTTCCTTTTGGTATACTATTGTTACCATGACGACACTTGGGTAAGTCGTGATCCCCTTATTATGTTTATTCAACATAGAGAGTTGCTGCAGCCTTGGAACCCTTCGTTTTTCAGGTAGATTTCAGCTCCTCCACAATGACATTTAATGACACTCTCATGGGATTTCAAATGCATTTTCCTTTTTCACTAAGCTGCTTACACAGACACACAAAATCAATTAGAGGAGATAGTGCTGGGGTAAAACAACAGATTATAATTATGTCTTTTCTTTGTGTGTTTCTCACTTGTAGCGGCTTCCTTGATTAGTTGTCTCTTGATGAGATGAAGGTGACTTTTTATATTATGTCTCGGAAATGAGGCAGATTTGTAGGTATACACTAAAATATATGCAATTAGGGAAAATGAAAGCAACATATGTTATGGTGAATTCTTAAAGAAAAAGACAAAATGGAAATGTTATACATATATTTTTTAATGTAATGTGCATTCATACTTAGGTAAAAATTGCCATATTAAAAAAAAAAAAAAAAAAAAGCG
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     179     606 
                                               BLH MIN     179     283 
                                               BLH MPR     179     283 
                                               BLH OVR     179     229 
                                               CDS MIN     179     283 
                                               ORF LNG     179      17 
                                                                                                                                                                                                                                                                   PREDICTED = Sp ==== 1e-150     XP_787256.2 PREDICTED: similar to potassium channel protein Shal 1.e [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                             PROTEIN === Ce ==== 8e-152     NP_500975.1 kv4.3 potassium channel (4H148) [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                          PROTEIN === Ci ==== 7e-167     AAS00646.1 potassium channel Kv4; CionaKv4 [Ciona intestinalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                             PROTEIN === Dm ==== 3e-169     NP_524159.1 CG9262-PA [Drosophila melanogaster] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                          PROTEIN === Dr ==== 0          NP_956096.1 potassium voltage-gated channel, Shal-related family, member 3 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 0          AAB94379.1 potassium channel xKv4.3 [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                          PROTEIN === ?? ==== 0          NP_001079287.1 potassium voltage-gated channel, Shal-related subfamily, member 3 [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                          PROTEIN === Gg ==== 0          NP_989657.1 potassium voltage-gated channel, Shal-related subfamily, member 3 [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                          PROTEIN === Mm ==== 0          NP_064315.1 potassium voltage-gated channel, Shal-related family, member 3 [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                          PROTEIN === Hs ==== 0          NP_004971.2 potassium voltage-gated channel, Shal-related subfamily, member 3 isoform 1 [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                          PROTEIN === Xt ==== 0          AAI36063.1 Unknown (protein for MGC:122788) [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAL8315.5                                                                                          TGA---------------TGA---------------------------------------------------------------------ATG------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------ATG------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------ATG------------TAA---------------------------------------------------------------------------------------------------TAATGA---------------------------------------------------------------------TAG------TAG---------------------------------------------------------TAG---------TGA------------TGATGA---------------------------------ATG------------------------------ATG------------ATG---------------ATG---------TAA---------------------------------------------ATG------------TAG
                                                                   ORF                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ...
  0   1   1           Brn3 FL                         CAAK11525.FL-MGC AGGGAGACAATTCTTCCAGGCTTCAGCAACCTGCTACATTTATATATATATATATATATATATTTTGTTGCTGGATTTTTTTTTTCAAGTGATGCCTGCCTTTCTCCTGAAGATGGTCATGGTTTGAAGTCAAACTGGTTTTAAAAGTCATTGATCTGCCCACCAGACCTGGCGCCCTCATGGCTTCTGGGGTTGCAGCATGGCTGCCCTTTGCAAGGGCGGCAGCGATTGGGTGGATGCCAGTGGCCAACTGCCCTATGCCATTGGCCCCAGCTGACAAGAACAAAAGACAAGATGAGGTGATAATTCTCAATGTCAGTGGGCGTCGATTCCAGACCTGGAGAACTACCTTAGAGAGGTACCCTGATACACTACTGGGAAGCACTGAAAAGGAATTCTTCTTTAATGAGGAAACCAAGGAATACTTCTTTGACCGTGATCCTGAAGTCTTCAGGTGCATCCTTAACTTTTACAGAACAGGCAAGCTGCATTACCCCAGGTATGAGTGCATCTCTGCTTACGACGAAGAACTTGCTTTTTATGGGATATTGCCTGAAATCATAGGGGACTGCTGCTATGAAGAATACAAAGACAGAAAAAGAGAAAATGCAGAAAGGTTGATGGATGACAATGAATTTGAGAACAATCAAGAAGCCATGCCCTCACTTACTTTACGCCAGACAATGTGGCGCGCCTTTGAAAATCCCCATACCAGCACTTTAGCCTTAGTCTTCTACTATGTAACTGGCTTCTTTATTGCAGTGTCGGTCATCACCAATGTTGTGGAAACTGTGCCCTGTGGCACCGTGCCTGGAAATAAGGAGCTTCCATGTGGTGAAAGATATGATGTAGCCTTCTTTTGCCTGGACACTGCATGTGTAATGATTTTCACAGTTGAATACCTTTTGAGACTTTTTGCAGCCCCAAGTCGCTACAGGTTCATGAGAAGTGTCATGAGCATCATTGATGTAGTTGCCATCATGCCATACTACATTGGCTTGGTAATGACCAACAATGAGGATGTGAGTGGTGCTTTCGTCACCTTGCGGGTATTCCGGGTCTTCAGGATTTTCAAGTTCTCTCGCCACTCCCAGGGCTTAAGGATCCTTGGATACACCCTAAAGAGTTGTGCCTCTGAACTGGGATTCCTGCTCTTCTCTTTGACCATGGCAATCATTATCTTTGCCACTGTGATGTTTTATGCTGAGAAAGGGTCATCATCCAGCAAATTCACAAGCATCCCAGCTTCCTTTTGGTATACTATTGTTACCATGACGACACTTGGATATGGGGACATGGTTCCCAAGACTATCGCAGGGAAAATCTTTGGTTCCATTTGTTCACTGAGTGGTGTGCTGGTCATTGCACTGCCTGTCCCTGTAATTGTGTCAAACTTCAGCCGGATTTACCACCAGAACCAGCGTGCTGATAAAAGACGAGCACAAAAGAAAGCAAGACTTGCAAGAATTAGGGTGGCTAAGACCGGAAGTTCCACAGCCTACCTTCACAGCAAGAGGAATGGTCTTCTTAATGAAGCTTTGGAACTAATGGGATCCACAGAAGAGCCACACATTGGCAAATCAGCATCACTGATAGAAAGCCAACACCACCACCTGCTGCATTGCCTGGAAAAAACAACTGGATTGTCCTATCTTGTGGATGATCCCCTGTTATCTGTTCGAACTTCCACCATGAAGAACCATGAATTTATGGATGAGCAGATGTTTGAACAGAACTGCAGGGAGAGCTCCATGCAAAACTACCCATCTAGTCGCAGCCCATCCCTATCCAGTAACCATGGGCTCACCACCTCCTGCTGTTCCAGACGCAACAAAAAGACCACCCACCTCCCTAACTCCAATGTGCCGGCAACAAGGTTGCGCAGCATGCAGGAACTCAGCACTATTCACATACAGTGCAGTGACCAACCATCTTTAACAGCTAGCCGTTCCAGTCTGAATCTGAAGTCAGATGATGAGTTAAGATCAAACTGCAAAGCTTCGCAGATAACTACAGCAATTATTAGCATCCCTACACCTCCAGCTCTGAGCCCTGAAGGGGAAACCCGACCTGGCAGCCCACCTGGACGCTCAACAAACATTCACAGTACAAGCAACATTGTGAAAGTATCCGCCTTGTAAAACACTTAGTGGCGAACCGAGGCTGCCGTCCTGCTTTTCTTTTTCGCTGCAAAACCGTGGAATTAGCAGTGAAAAAGTGACAAGCTTCCGCTAAACTTGCCATTTACCATCATGGAAGGAGAGAAAAGTCTGTGCAACGGAAGTATACATACATTCCTATCTCCATGCATATGGATGTATGTATATGGTGGAAGCCCTCTGCTAGGAAGTTTTATGGCAAGTAGAGGAGTTAACACAAAGCAAATTGACAACACTGTGTTTAAACACCTTTTTTTAAGGTTTTCAGTGGATAATATTTATTCATAAAGAAATAATGTAAAAAAAATTACAAAAATGGTTTAAAAAGGAGGGAGGGTATTGACCAGGAGTCATTTTTGCAAGTTGAGCATTGAAAACAGGGAAGGGAAAATTGTTATTTTGTTGTTTTTTGTTTATTCGAAAAGAATCAGCAAGCAATCAACATTTTTGTGTCTGTAACAGTCGGACAGAGGGGGTTGTGATATGTTTTAAGAAATTCAGATTTTCCTGTGTATTTTGTGAGTTTGGATATGGAACTGTTCAGTGAACAGAATAGCTCCTAGCACATATCTGACCCAGCACATTGTAGAAGCGAGCACACAAACACAATCTTCCCTCGCTGGTGATCTTAATTCCTAGATATTTTGTTATAGCCTTACAAGTCCAACCAGTGCAGATTGTGATGTTGTTGGGTAATTTGTCTGTGAAAAAGCTTAATTGTGAAGCAAAAAAAAAAAAAAA
  5   1   2      skin Brn3 FL   out                       CAAK11525.5p AGGGAGACAATTCTTCCAGGCTTCAGCAACCTGCTACATTTATATATATATATATATATATATTTTGTTGCTGGATTTTTTTTTTCAAGTGATGCCTGCCTTTCTCCTGAAGATGGTCATGGTTTGAAGTCAAACTGGTTTTAAAAGTCATTGATCTGCCCACCAGACCTGGCGCCCTCATGGCTTCTGGGGTTGCAGCATGGCTGCCCTTTGCAAGGGCGGCAGCGATTGGGTGGATGCCAGTGGCCAACTGCCCTATGCCATTGGCCCCAGCTGACAAGAACAAAAGACAAGATGAGGTGATAATTCTCAATGTCAGTGGGCGTCGATTCCAGACCTGGAGAACTACCTTAGAGAGGTACCCTGATACACTACTGGGAAGCACTGAAAAGGAATTCTTCTTTAATGAGGAAACCAAGGAATACTTCTTTGACCGTGATCCTGAAGTCTTCAGGTGCATCCTTAACTTTTACAGAACAGGCAAGCTGCATTACCCCAGGTATGAGTGCATCTCTGCTTACGACGAAGAACTTGCTTTTTATGGGATATTGCCTGAAATCATAGGGGACTGCTGCTATGAAGAATACAAAGACAGAAAAAGAGAAAATGCAGAAAGGTTGATGGATGACAATGAATTTGAGAACAATCAAGAAGCCATGCCCTCACTTACTTTACGCCAGACAATGTGGCGCGCCTTTGAAAATCCCCATACCAGCACTTTAGCCTTAGTCTTCTACTATGTAACTGGCTTCTTTATTGCAG
  5   1   2      seed Brn4      out                        CAAL8315.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGATATTGCCTGAAATCATAGGGGACTGCTGCTATGAAGAATACAAAGACAGAAAAAGAGAAAATGCAGAAAGGTTGATGGATGACAATGAATTTGAGAACAATCAAGAAGCCATGCCCTCACTTACTTTACGCCAGACAATGTGGCGCGCCTTTGAAAATCCCCATACCAGCACTTTAGCCTTAGTCTTCTACTATGTAACTGGCTTCTTTATTGCAGTGTCGGTCATCACCAATGTTGTGGAAACTGTGCCCTGTGGCACCGTACCTGGAAATAAGGAGCTTCCATGTGGTGAAAGATATGATGTAGCCTTCTTTTGCCTGGACACTGCATGTGTAATGATTTTCACAGTTGAATACCTTTTGAGACTTTTTGCAGCCCCAAGTCGCTACAGGTTCATGAGAAGTGTCATGAGCATCATTGATGTAGTTGCCATCATGCCATACTACATTGGCTTGGTAATGACCAACAATGAGGATGTGAGTGGTGCTTTCGTCACCTTGCGGGTATTCCGGGTCTTCAGGATTTTCAAGTTCTCTCGCCACTCCCAGGGCTTAAGGATCCTTGGATACACCCTAAAGAGTTGTGCCTCTGAACTGGGATTCCTGCTCTTCTCTTTGACCATGGCAATCATTATCTTTGCCACTGTGATGTTTTATGCTGAGAAAGGGTCATCATCCAGCANATTCACAAGCATCCCAGCTTCCTTTTGGTATACTATTGTTACCATGACGACACTTGGATATGGGGACATGGTTCCCAAGACTATCG
  3   1   2       bld TbA       out                   TTbA079g06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAGGTTCATGAGAAGTGTCATGAGCATCATTGATGTAGTTGCCATCATGCCATACTACATTGGCTTGGTAATGACCAACAATGAGGATGTGAGTGGTGCTTTCGTCACCTTGCGGGTATTCCGGGTCTTCAGGATTTTCAAGTTCTCTCGCCACTCCCAGGGCTTAAGGATCCTTGGATACACCCTAAAGAGTTGTGCCTCTGAACTGGGATTCCTGCTCTTCTCTTTGACCATGGCAATCATTATCTTTGCCACTGTGATGTTTTATGCTGAGAAAGGGTCATCATCCAGCAAATTCACAAGCATCCCAGCTTCCTTTTGGTATACTATTGTTACCATGACGACACTTGGGTAAGTCGTGATCCCCTTATTATGTTTATTCAACATAGAGAGTTGCTGCAGCCTTGGAACCCTTCGTTTTTCAGGTAGATTTCAGCTCCTCCACAATGACATTTAATGACACTCTCATGGGATTTCAAATGCATTTTCCTTTTTCACTAAGCTGCTTACACAGACACACAAAATCAATTAGAGGAGATAGTGCTGGGGTAAAACAACAGATTATAATTATGTCTTTTCTTTGTGTGTTTCTCACTTGTAGCGGCTTCCTTGATTAGTTGTCTCTTGATGAGATGAAGGTGACTTTTTATATTATGTCTCGGAAATGAGGCAGATTTGTAGGTATACACTAAAATATATGCAATTAGGGAAAATGAAAGCAACATATGTTATGGTGAATTCTTAAAGAAAAAGACAAAATGGAAATGTTATACATATATTTTTTAATGTAATGTGCATTCATACTTAGGTAAAAATTGCCATATTAAAAAAAAAAAAAAAAAAAAGCG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)