Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 408.0    0Xt7.1-TTbA054j18.3                          3 PI      78        232      782                Siamois [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     2 138.0    0(repeat)                                    0 REP     82        967     1268                (no blast hit)

 This cluster: approximate FL confidence score = 60%

 1012106955 Xt7.1-TGas138j09.3 - 3 ESTs
                                                                       ..-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas138j09.3                                                                                                                                                                                                                                                                       CCGGGGAGACAGACATGACCTGTGAGGCTGAAATGGAGCAGATTGTCTCCACTGCGCTGACTCTGCAAGAGGACTACATCAAATTCACCCCAAGGAACCCCACCATGGCCTGCCACACTGAAATCATTGGGGTATTTCATGATATTCACCCCACTGTGGAGAAAAACAAGGAAGCCCACCGGGATAAATTGGTTCTACAAGAGACTCTGGTGGAACTCTACTCCGTCTTGGGAATTCCACAGGAGCCCCAGGTCGGCAAAACCATGAAGTTTGAAGAACCAGAACAACATAGAGGATCAGCTAGGTTTGACCCCCTAGTCAACAGCCTGCAATTGAAAAGGCCTTTATACGAAGAGGAACGGAGGGAATGTAAGAGGCCGCTGGTTCAGGCAGATGAGGCCGTGGCAGCCCCCAGTGCCAGATCCAGGAGGAGAACCATTTACTCCAAGGAGCAAACCCACTTCCTTCAGAATCAATTTGACCTCAACCCTTATCCGGACTTTGTCAACAGATGCCGCATTGCCAAGATAACCGCCATTCCTGAGCCCCGGATACAGGTTTGGTTCCAGAACAGAAGAGCCAGACACCTCCCAAGAGCGGCCACGTCCCTGTCCCCCCAGGAAAGGAAACCCCCGGGTTCTGTACGGCCCAGATCTTCCCTGTGCAGAGAAGCCCAACACCCAGAAGCTTGGAGTGAAGTTCTGATCCCATCGGACTCACAGCCCCACCCAAACTGACTTCTACAATCAACTCAATGGCTTTTGTACTTCAATGGACTTTTATTATGGGGGGGTTTCTTATAAATAACTTTACTGGCTGCCGATTGGTGCATATGTTACAGGGGATGCTGACATTTATTTTCTATATTTTAGTATTTTATTTATTTTAATATCTTATAGTAATAGACCCCGTTATTTATAGACATTATATTCTGTTCATTCTGTGCTTCATTATTATCTAAAGTTGTATTATTTATGGTTTTTTTAATTATTTGCCTTCTGCTTCTGCCACTTTCCAGCTTTCAAATGGGGGTCGCTGACCCCGGCAGCCAAACCCTATTGCTCTGTGAGGCTCCAGTTTTATTGTTATTGTTACTTTTTATACCTTTATTTTTCAACTTAGGCCCTTTCCTGTTTATATATCGGCCTCTCGTGCAAACCACTCCCTGGTTGCTAAGGTAATTTGCTTCCTAGCAACCAGATAGCAGCTGAAACTCCATTCACTGAATAAAAAGTGAAATAACTAAAACACTACAAATAATAAAAACTAGTCAGATATTCACTTTCACACAGCAGACTGTTGCCAGTTGATTGGTTGCTATGGGTTACTAGACTTCCATATATTTTAGATTTTTTTCTGTATCCACACAGGGCATTGCTTGAAACTGCAGATGTGGCACAATTATGTATTTAGCAATACAAGAAGATTAATATATAGTTGGACGGTTGGTTTTCAATAAAGATGAGATGTTATTATAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008251051                                                                                                                                                                                                                                                                             AGACAGACATGACCTGTGAGGCTGAAATGGAGCAGATTGTCTCCACTGCGCTGACTCTGCAAGAGGACTACATCAAATTCACCCCAAGGAACCCCACCATGGCCTGCCACACTGAAATCATTGGGGTATTTCATGATATTCACCCCACTGTGGAGAAAAACAAGGAAGCCCACCGGGATAAATTGGTTCTACAAGAGACTCTGGTGGAACTCTACTCCGTCTTGGGAATTCCACAGGAGCCCCAGGTCGGCAAAACCATGAAGTTTGAAGAACCAGAACAACATAGAGGATCAGCTAGGTTTGACCCCCTAGTCAACAGCCTGCAATTGAAAAGGCCTTTATACGAAGAGGAACGGAGGGAATGTAAGAGGCCGCTGGTTCAGGCAGATGAGGCCGTGGCAGCCCCCAGTGCCAGATCCAGGAGGAGAACCATTTACTCCAAGGAGCAAACCCACTTCCTTCAGAATCAATTTGACCTCAACCCTTATCCGGACTTTGTCAACAGATGCCGCATTGCCAAGATAACCGCCATTCCTGAGCCCCGGATACAGGTTTGGTTCCAGAACAGAAGAGCCAGACACCTCCCAAGAGCGGCCACGTCCCTGTCCCCCCAGGAAAGGAAACCCCCGGGTTCTGTACGGCCCAGATCTTCCCTGTGCAGAGAAGCCCAACACCCAGAAGCTTGGAGTGAAGTTCTGATCCCATCGGACTCACAGCCCCACCCAAACTGACTTCTACAATCAACTCAATGGCTTTTGTACTTCAATGGACTTTTATTATGGGGGGGTTTCTTATAAATAACTTTACTGGCTGCCGATTGGTGCATATGTTACAGGGGATGCTGACATTTATTTTCTATATTTTAGTATTTTATTTATTTTAATATCTTATAGTAATAGACCCCGTTATTTATAGACATTATATTCTGTTCATTCTGTGCTTCATTATTATCTAAAGTTGTATTATTTATGGTTTTTTTAATTATTTGCCTTCTGCTTCTGCCACTTTCCAGCTTTCAAATGGGGGTCGCTGACCCCGGCAGCCAAACCCTATTGCTCTGTGAGGCTCCAGTTTTATTGTTATTGTTACTTTTTATACCTTTATTTTTCAACTTAGGCCCTTTCCTGTTTATATATCGGCCTCTCGTGCAAACCACTCCCTGGTTGCTAAGGTAATTTGCTTCCTAGCAACCAGATAGCAGCTGAAACTCCATTCACTGAATAAAAAGTGAAATAACTAAAACACTACAAATAATAAAAACTAGTCAGATATTCACTTTCACACAGCAGACTGTTGCCAGTTGATTGGTTGCTATGGGTTACTAGACTTCCATATATTTTAGATTTTTTTCTGTATCCACACAGGGCATTGCTTGAAACTGCAGATGTGGCACAATTATGTATTTAGCAATACAAGAAGATTAATATATAGTTGGACGGTTGGTTTTCAATAAAGATGAGATGTTATTATAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                            1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               BLH ATG      14     104                                                                                                                                                                                                                                                                       
                                               BLH MIN      14      56                                                                                                                                                                                                                                                                       
                                                                                                                                                           PROTEIN --- Cs ---- 2e-007     BAB68343.1 Cs-TTF1 [Ciona savignyi] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Br ==== 8e-008     ABD62780.1 Rx homeobox protein [Branchiostoma lanceolatum] ========================================================================
                                                                       PROTEIN --- Bb ---- 6e-009     ABK54278.1 Pax6 [Branchiostoma belcheri] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================
                                                                                                                                                                                                                 PROTEIN --- Dm ---- 4e-008     NP_523862.1 CG2692-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Bf ---- 1e-009     AAT66433.1 Dmbx [Branchiostoma floridae] ---------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Sp ---- 1e-008     XP_796340.1 PREDICTED: similar to Retinal homeobox protein Rx3 [Strongylocentrotus purpuratus] ------------------------------------------------------------------================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ci ---- 2e-011     BAE06657.1 transcription factor protein [Ciona intestinalis] ==========================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 1e-010     NP_505519.3 UNCoordinated family member (unc-42) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Mm ---- 2e-010     NP_038757.1 Mix1 homeobox-like 1; Mix1 homeobox-like 1 (xenopus laevis); mouse Mix-like gene[Mus musculus] ---------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Hs ---- 6e-011     NP_114150.1 Mix-like homeobox protein 1; likely ortholog of mouse Mix [Homo sapiens] ----------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Dr ---- 5e-012     NP_775334.1 mezzo [Danio rerio] ------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Gg ---- 4e-013     XP_415813.2 PREDICTED: similar to SEBOX [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xl ==== 1e-098     CAA88495.1 Siamois [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xt ==== 1e-138     CAJ83552.1 Novel protein containing homeodomain (siamois) [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                           PROTEIN === ?? ==== 1e-138     NP_001090821.1 siamois homeodomain 1 [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas138j09.3                                                                                                                                                                                                                                                                                     ATG---------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------TAA---------------------------------------------TGA------------------TAG------------------------TAGTAATAG---------------------------------------------------------------------ATG------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------TAG---------------TGA------------TGA---------------------------------------------------------------------------------TGA---------ATG------TAG------------------------------------------------TGA---------------------ATG---------------------TAA------------------------------------ATG------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  0   1   1           Gas  FL                     TGas088l16.FL-Sanger                                                                                                                                                                                                                                                                      CCCGGGGAGACAGACATGACCTGTGAGGCTGAAATGGAGCAGATTGTCTCCACTGCGCTGACTCTGCAAGAGGACTACATCAAATTCACCCCAAGGAACCCCACCATGGCCTGCCACACTGAAATCATTGGGGTATTTCATGATATTCACCCCACTGTGGAGAAAAACAAGGAAGCCCACCGGGATAAATTGGTTCTACAAGAGACTCTGGTGGAACTCTACTCCGTCTTGGGAATTCCACAGGAGCCCCAGGTCGGCAAAACCATGAAGTTTGAAGAACCAGAACAACATAGAGGATCAGCTAGGTTTGACCCCCTAGTCAACAGCCTGCAGTTGAAAAGGCCTTTATACGAGGAGGAACGGAGGGAATGTAAGAGGCCGCTGGTTCAGGCAGATGAGGCCGTGGCAGCCCCCAGTGCCAGATCCAGGAGGAGAACCATTTACTCCAAGGAGCAAACCCACTTCCTTCAGAATCAATTTGACCTCAACCCTTATCCGGACTTTGTCAACAGATGCCGCATTGCCAAGATAACCGCCATTCCTGAGCCCCGGATACAGGTTTGGTTCCAGAACAGAAGAGCCAGACACCTCCCAAGAGCGGCCACGTCCCTGTCCCCCCAGGAAAGGAAACCCCCGGGTTCTGTAGGGCCCAGATCTTCCCTGTGCAGAGAAGCCCAACACCCAGAAGCTTGGAGTGAAGTTCTGATCCCATCGGACTCACAGCCCCACCCAAACTGACTTCTACAATCAACTCAATGGCTTTTGTACTTCAATGGACTTTTATTATGGGGGGGTTTCTTATAAATAACTTTACTGGCTGCCGATTGGTGCATATGTTACAGGGGATGCTGACATTTATTTTCTATATTTTAGTATTTTATTTATTTTAATATCTTATAGTAATAGACCCCGTTATTTATAGACATTATATTCTGTTCATTCTGTGCTTCATTATTATCTAAAGTTGTATTATTTATGGTTTTTTTAATTATTTGCCTTCTGCTTCTGCCACTTTCCAGCTTTCAAATGGGGGTCGCTGACCCCGGCAGCCAAACCCTATTGCTCTGTGAGGCTCCAGTTTTATTGTTATTGTTACTTTTTATACCTTTATTTTTCAACTTAGGCCCTTTCCTGTTTATATATCGGCCTCTCGTGCAAACCACTCCCTGGTTGCTAAGGTAATTTGCTTCCTAGCAACCAGATAGCAGCTGAAACTCCATTCACTGAATAAAAAGTGAAATAACTAAAACACTACAAATAATAAAAACTAGTCAGATATTCACTTTCACACAGCAGACTGTTGCCAGTTGATTGGTTGCTATGGGTTACTAGACTTCCATATATTTTAGATTTTTTTCTGTATCCACACAGGGCATTGCTTGAAACTGCAGATGTGGCACAATTATGTATTTAGCAATACAAGAAGATTAATATATAGTTGGACGTTTGGTTTTCAATAAAGATGAGATGTTATTTATAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas  FL   in                   TGas088l16.p1kSP6                                                                                                                                                                                                                                                                       CCGGGGAGACAGACATGACCTGTGAGGCTGAAATGGAGCAGATTGTCTCCACTGCGCTGACTCTGCAAGAGGACTACATCAAATTCACCCCAAGGAACCCCACCATGGCCTGCCACACTGAAATCATTGGGGTATTTCATGATATTCACCCCACTGTGGAGAAAAACAAGGAAGCCCACCGGGATAAATTGGTTCTACAAGAGACTCTGGTGGAACTCTACTCCGTCTTGGGAATTCCACAGGAGCCCCAGGTCGGCAAAACCATGAAGTTTGAAGAACCAGAACAACATAGAGGATCAGCTAGGTTTGACCCCCTAGTCAACAGCCTGCAGTTGAAAAGGCCTTTATACGAGGAGGAACGGAGGGAATGTAAGAGGCCGCTGGTTCAGGCAGATGAGGCCGTGGCAGCCCCCAGTGCCAGATCCAGGAGGAGAACCATTTACTCCAAGGAGCAAACCCACTTCCTTCAGAATCAATTTGACCTCAACCCTTATCCGGACTTTGTCAACAGATGCCGCATTGCCAAGATAACCGCCATTCCTGAGCCCCGGATACAGGTTTGGTTCCAGAACAGAAGAGCCAGACACCTCCCAAGAGCGGCCACGTCCCTGTC
  3  -1   2      seed Gas                             TGas138j09.q1kT7                                                                                                                                                                                                                                                                                       CCTGTGAGGCTGATATGGAGCAGATTGTCTCCACTGGCGCTGACTCTGCAAGAGGACTACATCAAATTCACCCCAAGGAACCCCACCATGGCACTGCCACACTGAAATCATTGGGGTATTTCATGATATTCACCCCACTGTGGAGAAAAACAAGGAAGCCCACCGGGATAAATTGGTTCTACAAGAGACTCTGGTGGAACTCTACTCCGTCTTGGGAATTCCACAGGAGCCCCAGGTCGGCAAAACCATGAAGTTTGAAGAACCAGAACAACATAGAGGATCAGCTAGGTTTGACCCCCTAGTCAACAGCCTGCAATTGAAAAGGCCTTTATACGAAGAGGAACGGAGGGAATGTAAGAGGCCGCTGGTTCAGGCAGATGAGGCCGTGGCAGCCCCCAGTGCCAGATCCAGGAGGAGAACCATTTACTCCAAGGAGCAAACCCACTTCCTTCAGAATCAATTTGACCTCAACCCTTATCCGGACTTTGTCAACAGATGCCGCATTGCCAAGATAACCGCCATTCCTGAGCCCCGGATACAGGTTTGGTTCCAGAACAGAAGAGCCAGACACCTCCCAAGAGCGGCCACGTCCCTGTCCCCCCAGGAAAGGAAACCCCCGGGTTCTGTACGGCCCAGATCTTCCCTGTGCAGAGAAGCCCAACACCCAGAAGCTTGGAGTGAAGTTCTGATCCCATCGGACTCACAGCCCCACCCAAACTGACTTCTACAATCAACTCAATGGCTTTTGTACTTCAATGGACTTTTATTATGGAGGGGGTTTCTTATAAATAACTTTACTGGCTGC
  3   1   1       add Gas  FL   in                    TGas088l16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTGTAGGGCCCAGATCTTCCCTGTGCAGAGAAGCCCAACACCCAGAAGCTTGGAGTGAAGTTCTGATCCCATCGGACTCACAGCCCCACCCAAACTGACTTCTACAATCAACTCAATGGCTTTTGTACTTCAATGGACTTTTATTATGGGGGGGTTTCTTATAAATAACTTTACTGGCTGCCGATTGGTGCATATGTTACAGGGGATGCTGACATTTATTTTCTATATTTTAGTATTTTATTTATTTTAATATCTTATAGTAATAGACCCCGTTATTTATAGACATTATATTCTGTTCATTCTGTGCTTCATTATTATCTAAAGTTGTATTATTTATGGTTTTTTTaattatttgccttctgcttctgccactttccagctttcaaatgggggtcgctgaccccggcagccaaaccctattgctctgtgaggctccagttttattgttattgttactttttatacctttatttttcaacttaggccctttcctgtttatatatcggcctctcgtgcaaaccactccctggttgctaaggtaatttgcttcctagcaaccagatagcagctgaaactccaTTCACTGAATAAAAAGTGAAATAACTAAAACACTACAAATAATAAAAACTAGTCAGATATTCACTTTCACACAGCAGACTGTTGCCAGTTGATTGGTTGCTATGGGTTACTAGACTTCCATATATTTTAGATTTTTTTCTGTATCCACACAGGGCATTGCTTGAAACTGCAGATGTGGCACAATTATGTATTTAGCAATACAAGAAGATTAATATATAGTTGGACGGTTGGTTTTCAATAAAGATGAGATGTTATTATAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)