Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 76%

 1012109892 Xt7.1-THdA040f20.5 - 3 ESTs
                                                                       -480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-THdA040f20.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTTATATGGACTCAGCTCTCCAGCAATGGCTTATTTTTTTTCAGGGAGCAGGAGAGAGATCTGGGTGCTTTAGCCAGACCCTCAACTAAACCTGACTTTGGCATTTTCCCTGGAGTTACAAACTATAGGAGAAGCACTTGGCGCTCCCTCATTCACTCAACTGCGCCTGATTCGCACAGCATCCCAGCGCTCACCCCACAGACTTACTAGTTGGGAGTCTCTGTCTCTCTCTTCTTCTCTTGTTTTTTTTTTCTTCCTCCCATTGGAAAGAGGATTGGCACACTGGTGTCTCCACTTAGCTGCAGAATATGTCTTTAACCAACACAAAGACGGGCTTCTCTGTAAAGGACATTCTAGATCTGCCTGATACCAATGACGACGAAGGATCCATTGCAGAAGGAGCAGATGAAGACACAGACGGTTCTGAACCCACTAAAAAGCCAAGAGGTTTGGGGCAAAGCCCCTTGGAAACAGTACAGAGCCTGCCTTTAAAAAGCCCTTTCTATGACAGCAGTGACAACCCCTATACCAGATGGCTGGCCACTACCGAGAGCATCCAGTACTCCTTGCACGGCTTTGCTTCCAGCAACTCGCAGCAGGATTCCTCGCCCAAGTCGCCCGAACCGTCGGCTGATGAGTCCCCAGACAACGACAAGGACCCTTCCACCAACCCAGACTCAGGCAAAAAGAGAAAGCGCCGGGTGCTGTTCTCCAAGGCACAGACTTACGAGCTGGTAGAGGCGGTTTAGGCAGCAGCGGTACCTGTCGGCCCCTGAGAGGGAGCACCTGGCCAGCCTCATCCGACTCACCCCCACCCAAGTCAAGATCTGGTTCCAGAACCACAGGTACAAGATGAAGAGGGCCCGGGCAGAAAAAGGTATGAAAGTGACTTCCTCTTCCCTCCCCTAGGCGAGTGGCAGTGCCAGTGCTAGTAAGGGATGGAAAAGCCCTGCCACACTCTGAAAGCTCAGGACTTAGCTGCCACATTCCCAGCTGGCATCCCTTTCTCTGCTTATAGCGCCCAGTCATTACAGCACATGCAATATAATGCCCAGTATTTTTCTGCCAGTAACGCCCAGTACCTTACAGCACATCACTTGGTGCAAGCCCAACACTGGACTTGGTGAACTTTACTTACG
                                                  Xt7.1-CHK-1008249746                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGGACTCAGCTCTCCAGCAATGGCTTATTTTTTTTCAGGGAGCAGGAGAGAGATCTGGGTGCTTTAGCCAGACCCTCAACTAAACCTGACTTTGGCATTTTCCCTGGAGTTACAAACTATAGGAGAAGCACTTGGCGCTCCCTCATTCACTCAACTGCGCCTGATTCGCACAGCATCCCAGCGCTCACCCCACAGACTTACTAGTTGGGAGTCTCTGTCTCTCTCTTCTTCTCTTGTTTTTTTTTTCTTCCTCCCATTGGAAAGAGGATTGGCACACTGGTGTCTCCACTTAGCTGCAGAATATGTCTTTAACCAACACAAAGACGGGCTTCTCTGTAAAGGACATTCTAGATCTGCCTGATACCAATGACGACGAAGGATCCATTGCAGAAGGAGCAGATGAAGACACAGACGGTTCTGAACCCACTAAAAAGCCAAGAGGTTTGGGGCAAAGCCCCTTGGAAACAGTACAGAGCCTGCCTTTAAAAAGCCCTTTCTATGACAGCAGTGACAACCCCTATACCAGATGGCTGGCCACTACCGAGAGCATCCAGTACTCCTTGCACGGCTTTGCTTCCAGCAACTCGCAGCAGGATTCCTCGCCCAAGTCGCCCGAACCGTCGGCTGATGAGTCCCCAGACAACGACAAGGACCCTTCCACCAACCCAGACTCAGGCAAAAAGAGAAAGCGCCGGGTGCTGTTCTCCAAGGCACAGACTTACGAGCTGGTAGAGGCGGTTTAGGCAGCAGCGGTACCTGTCGGCCCCTGAGAGGGAGCACCTGGCCAGCCTCATCCGACTCACCCCCACCCAAGTCAAGATCTGGTTCCAGAACCACAGGTACAAGATGAAGAGGGCCCGGGCAGAAAAAGGTATGAAAGTGACTTCCTCTTCCCTCCCCTAGGCGAGTGGCAGTGCCAGTGCTAGTAAGGGATGGAAAAGCCCTGCCACACTCTGAAAGCTCAGGACTTAGCTGCCACATTCCCAGCTGGCATCCCTTTCTCTGCTTATAGCGCCCAGTCATTACAGCACATGCAATATAATGCCCAGTATTTTTCTGCCAGTAACGCCCAGTACCTTACAGCACATCACTTGGTGCAAGCCCAACACTGGACTTGGTGAACTTTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     309      42                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH MIN     309      43                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH OVR     309     102                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               ORF LNG     309       3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                                                       PROTEIN --- Dm ---- 7e-030     NP_001036253.1 ventral nervous system defective CG6172-PB, isoform B [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Sp ---- 8e-041     XP_784319.1 PREDICTED: similar to NK2 transcription factor related 2a [Strongylocentrotus purpuratus] --------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Bf ==== 3e-045     AAD01958.1 homeodomain protein [Branchiostoma floridae] ===============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Gg ---- 6e-036     XP_426104.2 PREDICTED: similar to homeodomain protein [Gallus gallus] ----------------------------------------====================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Mm ==== 6e-080     NP_035049.1 NK2 transcription factor related, locus 2 [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Hs ==== 2e-080     NP_002500.1 NK2 transcription factor related, locus 2 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Dr ==== 2e-081     NP_571497.1 NK2 transcription factor related 2 [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-THdA040f20.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATG------------------------------------------------------------------------------TAA---TGA------------------------------TAG---------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------TAG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------TAGTAA---ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                               ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ... open reading frame                                                                                                                                                                 ...
  5   1   1           HdA  FLq                    THdA040f20.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGAGATCTGGGTGCTTTAGCCAGACCCTCAACTAAACCTGACTTTGGCATTTTCCCTGGAGTTACAAACTATAGGAGAAGCACTTGGCGCTCCCTCATTCACTCAACTGCGCCTGATTCGCACAGCATCCCAGCGCTCACCCCACAGACTTACTAGTTGGGAGTCTCTGTCTCTCTCTCTTCTTCTCTTGTTTTTTTTTTCTTCCTCCCATTGGAAAGAGGATTGGCACACTGGTGTCTCCACTTAGCTGCAGAATATGTCTTTAACCAACACAAAGACGGGCTTCTCTGTAAAGGACATTCTAGATCTGCCTGATACCAATGACGACGAAGGATCCATTGCAGAAGGAGCAGATGAAGACACAGACGGTTCTGAACCCACTAAAAAGCCAAGAGGTTTGGGGCAAAGCCCCTTGGAAACAGTACAGAGCCTGCCTTTAAAAAGCCCTTTCTATGACAGCAGTGACAACCCCTATACCAGATGGCTGGCCACTACCGAGAGCATCCAGTACTCCTTGCACGGCTTTGCTTCCAGCAACTCGCAGCAGGATTCCTCGCCCAAGTCGCCCGAACCGTCGGCTGATGAGTCCCCAGACAACGACAAGGACCCTTCCACCAACCCAGACTCAGGCAAAAAGAGAAAGCGCCGGGTGCTGTTCTCCAAGGCACAGACTTACGAGCTGGAGAGGCGGTTTAGGCAGCAGCGGTACCTGTCGGCCCCTGAGAGGGAGCACCTGGCCAGCCTCATCCGACTCACCCCCACCCAAGTCAAGATCTGGTTCCAGAACCACAGGTACAAGATGAAGAGGGCCCGGGCAGAAAAAGGTATGGAAGTGACTCCTCTTCCCTCCCCTAGGCGAGTGGCAGTGCCAGTGCTAGTAAGGGATGGAAAGCCCTGCCACACTCTGAAAGCTCAGGACTTAGCTGCCACATTCCCAGCTGGCATCCCTTTCTCTGCCTATAGCGCCCAGTCATTACAGCACATGCAATATAATGCCCAGTACTCTTCTGCCAGTAACGCCCAGTACCCTACAGCACATCACTTGGTGCAAGCCCAACACTGGACTTGGTGAACTTTACTTACGGACTGGTCTGCTCCAAAAAAATGATGGGGGGGATAAAAAAAAACTGTTGGGTAAAAAAAGAGGCATAATTATTATTATAATTATTATTATTATTATGTTTTTTATGAAAGGTCAATTCATCCTCAAACACCCAGTTTCTGGTATGTTGTGCTCCATGTTTACAAATTTGCTCCAAGACAGCGAATCTACCTACCTGCGATTCAATGGGGGGAACCTACTGCTTATGTGATTTTCTTTGTAAAATATGTTTGTGTGTTGTAGAAATGTTGTCGATCGTATAAAAACAAAAGCAAGTGAAAACCACTTTAGAGATTTTTATTTCTTTCTTTTAAGCACACAGCCACCGCAAAAAAACAAAAAATAAAACTGTTATTTATGGCCAACGTGTAAAAATAAAATCTGAATTTATTTTTTATGTTTTAATTTCATAGAGAAGTGTTTATTATTGGCATCAGTAACCTCCAGGGCGCTATTTTATGCAAACATTCCCCGAAACATAAAGTAGAACATGTCAGTCACCTGCATATAGATCTATACAGCTGTATATGTATCATTAAAGAAAAAAGAATTAAAAGTGCATCCCATGGGAGATTTTGGACTTTTATAAGAATTTTAATAAAACAATGTGTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tbd1      in                        CBXT23001.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTTATATGGACTCAGCTCTCCAGCAATGGCTTATTTTTTTTCAGGGAGCAGGAGAGAGATCTGGGTGCTTTAGCCAGACCCTCAACTAAACCTGACTTTGGCATTTTCCCTGGAGTTACAAACTATAGGAGAAGCACTTGGCGCTCCCTCATTCACTCAACTGCGCCTGATTCGCACAGCATCCCAGCGCTCACCCCACAGACTTACTAGTTGGGAGTCTCTGTCTCTCTCTTCTTCTCTTGTTTTTTTTTTCTTCCTCCCATTGGAAAGAGGATTGGCACACTGGTGTCTCCACTTAGCTGCAGAATATGTCTTTAACCAACACAAAGACGGGCTTCTCTGTAAAGGACATTCTAGATCTGCCTGATACCAATGACGACGAAGGATCCATTGCAGAAGGAGCAGATGAAGACACAGACGGTTCTGAACCCACTAAAAAGCCAAGAGGTTTGGGGCAAAGCCCCTTGGAAACAGTACAGAGCCTGCCTTTAAAAAGCCCTTTCTATGACAGCAGTGACAACCCCTATACCAGATGGCTGGCCACTACCGAGAGCATCCAGTACTCCTTGCACGGCTTTGCTTCCAGCAACTCGCAGCAGGATTCCTCGCCCAAGTCGCCCGAACCGTCGGCTGATGAGTCCCCAGACAACGACAAGGACCCTTCCACCAACCCAGACTCAGCAAGAAGAGAAAGCGCCGGGTGCTGTTCTTCAAGGCACAGACTTACGAGCT
  5   1   2      seed HdA  FLq  out                 THdA040f20.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAGATCTGGGTGCTTTAGCCAGACCCTCAACTAAACCTGACTTTGGCATTTTCCCTGGAGTTCAAACTATAGGAGAAGCACTTGGCGCTCCCTCATTCACTCAACTGCGCCTGATTCGCACAGCATCCCAGCGCTCACCCCACAGACTTACTAGTTGGGAGTCTCTGTCTCTCTCTCTTCTTCTCTTGTTTTTTTTTTCTTCCTCCCATTGGAAAGAGGATTGGCACACTGGTGTCTCCACTTAGCTGCAGAATATGTCTTTAACCAACACAAAGACGGGCTTCTCTGTAAAGGACATTCTAGATCTGCCTGATACCAATGACGACGAAGGATCCATTGCAGAAGGAGCAGATGAAGACACAGACGGTTCTGAACCCACTAAAAAGCCAAGAGGTTTGGGGCAAAGCCCCTTGGAAACAGTACAGAGCCTGCCTTTAAAAAGCCCTTTCTATGACAGCAGTGACAACCCCTATACCAGATGGCTGGCCACTACCGAGAGCATCCAGTACTCCTTGCACGGCTTTGCTTCCAGCAACTCGCAGCAGGATTCCTCGCCCAAGTCGCCCGAACCGTCGGCTGATGAGTCCCCAGACAACGACAAGGACCCTTCCACCAACCCAGACTCAGGCAAAAAGAGAAAGCGCCGGGTGCTGTTCTCCAAGGCACAGACTTACGAGCTGGTAGAGGCGGTTTAGGCAGCAGCGGTACCTGTCGGCCCCTGAGAGGGAGCACCTGGCCAGCCTCATCCGACTCACCCCCACCCAAGTCAAGATCTGGTTCCAGAACCACAGGTACAAGTATGAAGAGGGCCCGGGCA
  3   1   1       add Tbd1      in                        CBXT23001.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAAGGGAGCACTTGCCCAGCTTCATCCGACTCACCCCCACCCAAGTCAAGATCTGGTTCCAGAACCACAGGTACAAGATGAAGAGGGCCCGGGCAGAAAAAGGTATGAAAGTGACTTCCTCTTCCCTCCCCTAGGCGAGTGGCAGTGCCAGTGCTAGTAAGGGATGGAAAAGCCCTGCCACACTCTGAAAGCTCAGGACTTAGCTGCCACATTCCCAGCTGGCATCCCTTTCTCTGCTTATAGCGCCCAGTCATTACAGCACATGCAATATAATGCCCAGTATTTTTCTGCCAGTAACGCCCAGTACCTTACAGCACATCACTTGGTGCAAGCCCAACACTGGACTTGGTGAACTTTACTTACGGATTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)