Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAP13428.3                           2 END     1          50       50                Unknown (protein for IMAGE:7024380) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012110884 Xt7.1-CAAP13428.5 - 2 ESTs
                                                                       ......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAP13428.5                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACCCAGCATGCTCCATCAGTCTTTCCCTTGAGGCCCTGCTGTGGATCCCTGGGCTCCGACTCTCATGTCACTGTGGGTTGTTTGTCTTCTGGATTCCTTCCTGCACCAGTAACTGTCAAATGGAATTCAGGAGCCATAACAAGTGGAATAAAGAACTTTCCAGCTGTCCTGCAGCAAAGTGGCTCATTTGCCTCCAGTAGCCAACTGACCATCCCTCTGTCTGACTGGAAGGATAAATCCTTTGAGTGTAATGTGGAACATGCACCAACCAGTACCAAAGTAAACAAAAAGATACCAGATTGCAAAGATGAAACTGAACCAAGTGAACCAACTGTGGAGATTTTGCAAGGATCTTGCGCTGCTCCTAATTCAATTGAATTGCTCTGCCTTATGACTGAATATGCTCCTTCAGAAATCAAAGTGCAGTGGTTGCGCAATGGCGAAGATGCATCTCTTGCTCCATCCAACAGCCCTCCCTGCAAGGAAGACAATGGGACATTTGCCTCCAGAAGTAAAGTGTTTGTTCCAAAAGAAGACTGGAATTCTGGAGATACCTATACCTGCAGGGTCACCCACCCTGCTACCAGAAGCAAGACTGATGTCAGCATCTCAAAATGCAGTGACACAGCCTTAACGCCAAAGGTGGAGGTTCTTCCTCCAACTCCCAAAGATCTGCTTGTTAACAGAGAACCCAAAGTGTACTGTGTGATCTCCAAGATGGCAAGTGCAGAAGGCTTAACTGTGAAATGGTCCCGCAGTGATAAAAAGAGAGTCATTGCATTTGATTCACCCCCGGAAAAAGAGTATGATGGAACTTTCACTGTAAAAAGCATTTTGAAAATAAGTTCTGGGGACTGGCAACC
                                                  Xt7.1-CHK-1008259691                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCATGCTCCATCAGTCTTTCCCTTGAGGCCCTGCTGTGGATCCCTGGGCTCCGACTCTCATGTCACTGTGGGTTGTTTGTCTTCTGGATTCCTTCCTGCACCAGTAACTGTCAAATGGAATTCAGGAGCCATAACAAGTGGAATAAAGAACTTTCCAGCTGTCCTGCAGCAAAGTGGCTCATTTGCCTCCAGTAGCCAACTGACCATCCCTCTGTCTGACTGGAAGGATAAATCCTTTGAGTGTAATGTGGAACATGCACCAACCAGTACCAAAGTAAACAAAAAGATACCAGATTGCAAAGATGAAACTGAACCAAGTGAACCAACTGTGGAGATTTTGCAAGGATCTTGCGCTGCTCCTAATTCAATTGAATTGCTCTGCCTTATGACTGAATATGCTCCTTCAGAAATCAAAGTGCAGTGGTTGCGCAATGGCGAAGATGCATCTCTTGCTCCATCCAACAGCCCTCCCTGCAAGGAAGACAATGGGACATTTGCCTCCAGAAGTAAAGTGTTTGTTCCAAAAGAAGACTGGAATTCTGGAGATACCTATACCTGCAGGGTCACCCACCCTGCTACCAGAAGCAAGACTGATGTCAGCATCTCAAAATGCAGTGACACAGCCTTAACGCCAAAGGTGGAGGTTCTTCCTCCAACTCCCAAAGATCTGCTTGTTAACAGAGAACCCAAAGTGTACTGTGTGATCTCCAAGATGGCAAGTGCAGAAGGCTTAACTGTGAAATGGTCCCGCAGTGATAAAAAGAGAGTCATTGCATTTGATTCACCCCCGGAAAAAGAGTATGATGGAACTTTCACTGTAAAAAGCATTTTGAAAATAAGTTCTGGGGACTGGCAACCCCGCAC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                    2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Hs ---- 5e-008     XP_947333.2 PREDICTED: similar to HLA class II histocompatibility antigen, DQ(W1.1) beta chain precursor (DQB1*0501) isoform 1 [Homo sapiens] -------------------------------------------==================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Dr ---- 6e-009     XP_707527.1 PREDICTED: similar to immunoglobulin light chain isoform 2 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Gg ---- 4e-010     XP_001234976.1 PREDICTED: hypothetical protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Mm ---- 1e-032     XP_001001086.1 PREDICTED: similar to Ig gamma-2B chain C region secreted form isoform 2 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                               PREDICTED - ?? ---- 4e-128     NP_001083154.1 hypothetical protein LOC398774 [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                FRAGMENT -- Xl ---- 3e-129     S04845 Ig heavy chain precursor - African clawed frog (fragment) [Xenopus laevis]  ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                               PROTEIN --- Xt ---- 1e-169     AAH89679.1 Unknown (protein for IMAGE:7024380) [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAP13428.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ...
  5   1   2       chi AbdN FL                            IMAGE:7024380                           CTCAGCAAGAAATCACCATGAAGGAATATTTTCTCTTCTGATCCTGATGAAACTTGTTTCATGTGTCATTTGTCAGATTACTCTGGACCAACCTGGCTCTGCAGTTGTGAATCCATCAGGAACCCTAAAACTTTCCTGTAAAGTCTCAGTGTCTGTAAGTAGTCAGCACTGGGCATGGATCTGGCAGGCTCCTGGGAAAGGACTGGAGTATATTGGATATTTACACAGCGACATGAGGTCTTTCCCAGCCCCCTCATTTCAAAGTCGAGTCACTTTCACCAGGGACGCCTCAAAGAACGAGATTCACTTACAAATTACCAGTATGAAAAGCGCAGACTCTGGGACATATTACTGTGCAAGAGGGGTAGCGGGATACTTTGACTACTGGGGACCAGGGACCATGGTCACCGTCACTTCAGCAACCCAGCATGCTCCATCAGTCTTTCCCTTGAGGCCCTGCTGTGGATCCCTGGGCTCCGACTCTCATGTCACTGTGGGTTGTTTGTCTTCTGGATTCCTTCCTGCACCAGTAACTGTCAAATGGAATTCAGGAGCCATAACAAGTGGAATAAAGAACTTTCCAGCTGTCCTGCAGCAAAGTGGCTCATTTGCCTCCAGTAGCCAACTGACCATCCCTCTGTCTGACTGGAAGGATAAATCCTTTGAGTGTAATGTGGAACATGCACCAACCAGTACCAAAGTAAACAAAAAGATACCAGATTGCAAAGATGAAACTGAACCAAGTGTACCAACTGTGGAAGATTTTGCAAGGATCTTGCGCTGCTCCTAATTCAATTGAATTGCTCTGCCTTATGACTGAAATATGCTCCTTTCAGAAATCAAAGTGCAATGGTTTGCGCAATGGCCGAATATGCA
  5   1   2      seed Int1      out                       CAAP13428.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATCAACCCAGCATGCTCCATCAGTCTTTCCCTTGAGGCCCTGCTGTGGATCCCTGGGCTCCGACTCTCATGTCACTGTGGGTTGTTTGTCTTCTGGATTCCTTCCTGCACCAGTAACTGTCAAATGGAATTCAGGAGCCATAACAAGTGGAATAAAGAACTTTCCAGCTGTCCTGCAGCAAAGTGGCTCATTTGCCTCCAGTAGCCAACTGACCATCCCTCTGTCTGACTGGAAGGATAAATCCTTTGAGTGTAATGTGGAACATGCACCAACCAGTACCAAAGTAAACAAAAAGATACCAGATTGCAAAGATGAAACTGAACCAAGTGAACCAACTGTGGAGATTTTGCAAGGATCTTGCGCTGCTCCTAATTCAATTGAATTGCTCTGCCTTATGACTGAATATGCTCCTTCAGAAATCAAAGTGCAGTGGTTGCGCAATGGCGAAGATGCATCTCTTGCTCCATCCAACAGCCCTCCCTGCAAGGAAGACAATGGGACATTTGCCTCCAGAAGTAAAGTGTTTGTTCCAAAAGAAGACTGGAATTCTGGAGATACCTATACCTGCAGGGTCACCCACCCTGCTACCAGAAGCAAGACTGATGTCAGCATCTCAAAATGCAGTGACACAGCCTTAACGCCAAAGGTGGAGGTTCTTCCTCCAACTCCCAAAGATCTGCTTGTTAACAGAGAACCCAAAGTGTACTGTGTGATCTCCAAGATGGCAAGTGCAGAAGGCTTAACTGTGAAATGGTCCCGCAGTGATAAAAAGAGAGTCATTGCATTTGATTCACCCCCGGAAAAAGAGTATGATGGAACTTTCACTGTAAAAAGCATTTTGAAAATAAGTTCTGGGGACTGGCAACCCCGCACCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)