Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

1% 1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 93%

 1012153261 Xt7.1-CABC6623.3.5 - 444 ESTs
                                                                       .-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABC6623.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTATGAGAGTTCTTTTTTTCAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTTAAAGAGAAAAAAAAAAAAGAATAAAATAAT
                                                  Xt7.1-CHK-1008264816                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TxxTTxTTTTTTTCAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTTAAAxAxAAAAAAxxAxxAGAATAAAATAATAAATAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       3    11    10    26    29    39    39    47    61    71    67    79    80    91    90   102   134   144   164   175   169   180   170   182   170   182   170   182   169   182   174   184   175   184   177   185   178   186   178   186   178   186   179   187   181   189   181   189   181   189   184   192   184   192   184   192   184   192   186   194   185   194   186   195   187   196   187   196   187   196   187   196   187   196   187   196   187   196   187   196   187   197   189   198   189   198   189   198   190   198   192   199   193   201   192   202   192   202   193   205   193   205   197   207   199   210   202   218   209   224   228   248   237   261   241   269   255   276   258   272   265   275   268   278   269   279   267   275   267   278   268   279   264   282   274   284   258   290   277   300   282   307   291   318   312   339   271   306   285   303   280   298   268   291   254   269   225   240   227   240   227   239   223   233   221   230   225   234   228   236   225   238   228   238   226   237   227   240   228   241   231   242   232   242   229   241   229   242   231   242   232   243   230   244   230   243   230   241   235   241   235   241   237   242   237   243   235   242   236   242   240   244   240   244   241   244   240   244   239   243   235   243   236   243   230   241   236   240   234   238   236   238   231   236   228   234   225   233   226   232   221   229   214   228   158   171   133   146   133   136   128   136   128   135   128   135   126   135   126   134   127   133   127   132   121   130   123   127   115   123   110   117    97   103    96   102    95   101    18    39    10    22     5    10
  5   1   2       e50                                  Xt7.1-CAAR709.5                                                                                                                                                                                                                                                                                                                                                                                      AAAAAAGTTACCAAAATGGTTCTAGATTTTCCTTCTAGCAAATATCAGATTAGTGAGTGCCATCTTTTATACCCGTTTGTTGTACAACCTCCTAGTAGTGTTTCCCTGACAGAAGGTATATAATGTGCCACAGCCAATAGGTATGTAATGTGCCACAGTCAATTGCTGCCAAATGGCTAGAAAAATGATAGGTTCATAGTTATAGTTTGGGGTCCAGGATGTTGAAGCAGACCTTTATTGCAAATGTCTGCTAAGTGTTACTCTGGTCTTATGAGAGTTCTTCCACCAAAGTGTAGTCTGGGCTGGAACTTTTATGGAATTTAGTAGCAGGAGAGAAGGGCCCTCTTGTAAACTCTTGTTCCCATTTATTGTATATCACTGTGGAATATGTTGGTGCTTTATAGATCATGTTAATAATAATAATTACATTCATGGCTGGAATTAGATAAAGCCTAATTATAAGACTGAATAATATTATGCAATATGTGAAAAATTCATATTTGTTTAACTTATTGTATTACACAGTAGAATAAAAACTGATCATATACTTATTCTTCAGCAAGCCATATTTTGCAACTTTTTTTTCCATCTCTAATTTTATTAAATACATTTTATTAAATAAATAAAATATTGTATTACACAGTAGAATAAAAACTGATCATATACTTATTCTTCAGCAAGCCATATTTTGCAACTTTTTTTTCCATCTCTAATTTTATTAAAAATTATAGAATTATAAATGAATAAATATATAACTAATTATGGAATTTCATAGCTGTGAGATGTACAGTATGATAAAACATTATAAAGCAATTGAATCACATTATCCTCACTATACTGAATTATCCCCGAGTTCAGTAAGTGTTTGGTATAGATAATAAAAAATAAACTTTCTTATTTAATCATATTTAAATGCTGTTTCTAATAAACCTGCTACAAACGACTTATATAGTAAAAGTATTAATCATTTTCTTTTAACTTTTCCTCAGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCCACGACAAGACTGAGTTCT
  5   1   2       e50                                 Xt7.1-CABC6623.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTTTTTTTTCAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTTAAAAAAAAAAAAAAATTAGAATAAAATAATAAATATAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCATTTCAAATT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---------A-A
                                               BLH ATG      64     628                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH MIN      64     163                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH OVR      64      56                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               CDS MIN      64      52                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               EST CLI      86      52                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               ORF LNG      64       6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 4e-020     NP_504743.2 T15B7.1 [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Dm ---- 1e-033     NP_610396.1 CG8642-PA [Drosophila melanogaster] --------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Br ---- 2e-040     ABF83551.1 fibrinogen [Branchiostoma belcheri tsingtaunese] --------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Cs ==== 2e-041     BAB88674.1 fibrinogen-like protein [Ciona savignyi] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 9e-044     BAB00626.1 fibrinogen-like protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Sp ---- 8e-048     XP_786278.2 PREDICTED: similar to angiopoietin-like protein, partial [Strongylocentrotus purpuratus] ---------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Xt ---- 1e-062     AAH94532.1 LOC594921 protein [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dr ---- 7e-152     NP_998219.1 fibrinogen gamma polypeptide [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Gg ---- 4e-164     NP_990320.1 fibrinogen gamma chain [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Mm ---- 4e-166     NP_598623.1 RIKEN cDNA 3010002H13 [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Hs ==== 1e-172     NP_000500.2 fibrinogen, gamma chain isoform gamma-A precursor [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Xl ==== 0          AAH54185.1 Unknown (protein for MGC:64319) [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === ?? ==== 0          NP_001080639.1 fibrinogen, gamma polypeptide [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABC6623.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGTAG------------------------ATG------------TAG---------------------------------------------TGATAG---------------------------ATG------------------------------TAA------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---ATG------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------TAA---TAA---------------------------------------------------------------TAA---------------------------------------------------------TAG------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  0   1   1           TpA  FL                     TTpA004p02.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       e50                                  Xt7.1-CAAR709.5                                                                                                                                                                                                                                                                                                                                                                                      AAAAAAGTTACCAAAATGGTTCTAGATTTTCCTTCTAGCAAATATCAGATTAGTGAGTGCCATCTTTTATACCCGTTTGTTGTACAACCTCCTAGTAGTGTTTCCCTGACAGAAGGTATATAATGTGCCACAGCCAATAGGTATGTAATGTGCCACAGTCAATTGCTGCCAAATGGCTAGAAAAATGATAGGTTCATAGTTATAGTTTGGGGTCCAGGATGTTGAAGCAGACCTTTATTGCAAATGTCTGCTAAGTGTTACTCTGGTCTTATGAGAGTTCTTCCACCAAAGTGTAGTCTGGGCTGGAACTTTTATGGAATTTAGTAGCAGGAGAGAAGGGCCCTCTTGTAAACTCTTGTTCCCATTTATTGTATATCACTGTGGAATATGTTGGTGCTTTATAGATCATGTTAATAATAATAATTACATTCATGGCTGGAATTAGATAAAGCCTAATTATAAGACTGAATAATATTATGCAATATGTGAAAAATTCATATTTGTTTAACTTATTGTATTACACAGTAGAATAAAAACTGATCATATACTTATTCTTCAGCAAGCCATATTTTGCAACTTTTTTTTCCATCTCTAATTTTATTAAATACATTTTATTAAATAAATAAAATATTGTATTACACAGTAGAATAAAAACTGATCATATACTTATTCTTCAGCAAGCCATATTTTGCAACTTTTTTTTCCATCTCTAATTTTATTAAAAATTATAGAATTATAAATGAATAAATATATAACTAATTATGGAATTTCATAGCTGTGAGATGTACAGTATGATAAAACATTATAAAGCAATTGAATCACATTATCCTCACTATACTGAATTATCCCCGAGTTCAGTAAGTGTTTGGTATAGATAATAAAAAATAAACTTTCTTATTTAATCATATTTAAATGCTGTTTCTAATAAACCTGCTACAAACGACTTATATAGTAAAAGTATTAATCATTTTCTTTTAACTTTTCCTCAGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCCACGACAAGACTGAGTTCT
                                                  Xt7.1-CHK-1008248885                                                                                                                                                                                                                                                                                                                                                                                            GTTACCAAAATGGTTCTAGATTTTCCTTCTAGCAAATATCAGATTAGTGAGTGCCATCTTTTATACCCGTTTGTTGTACAACCTCCTAGTAGTGTTTCCCTGACAGAAGGTATATAATGTGCCACAGCCAATAGGTATGTAATGTGCCACAGTCAATTGCTGCCAAATGGCTAGAAAAATGATAGGTTCATAGTTATAGTTTGGGGTCCAGGATGTTGAAGCAGACCTTTATTGCAAATGTCTGCTAAGTGTTACTCTGGTCTTATGAGAGTTCTTCCACCAAAGTGTAGTCTGGGCTGGAACTTTTATGGAATTTAGTAGCAGGAGAGAAGGGCCCTCTTGTAAACTCTTGTTCCCATTTATTGTATATCACTGTGGAATATGTTGGTGCTTTATAGATCATGTTAATAATAATAATTACATTCATGGCTGGAATTAGATAAAGCCTAATTATAAGACTGAATAATATTATGCAATATGTGAAAAATTCATATTTGTTTAACTTATTGTATTACACAGTAGAATAAAAACTGATCATATACTTATTCTTCAGCAAGCCATATTTTGCAACTTTTTTTTCCATCTCTAATTTTATTAAATACATTTTATTAAATAAATAAAATATTGTATTACACAGTAGAATAAAAACTGATCATATACTTATTCTTCAGCAAGCCATATTTTGCAACTTTTTTTTCCATCTCTAATTTTATTAAAAATTATAGAATTATAAATGAATAAATATATAACTAATTATGGAATTTCATAGCTGTGAGATGTACAGTATGATAAAACATTATAAAGCAATTGAATCACATTATCCTCACTATACTGAATTATCCCCGAGTTCAGTAAGTGTTTGGTATAGATAATAAAAAATAAACTTTCTTATTTAATCATATTTAAATGCTGTTTCTAATAAACCTGCTACAAACGACTTATATAGTAAAAGTATTAATCATTTTCTTTTAACTTTTCCTCAGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCCACGACAAGACTG
  5   1   2       bld Liv1      in                        CAAR12667.5p                                                                                                                                                                                                                                                                                                                                                                                      AAAAAAGTTACCAAAATGGTTCTAGATTTTCCTTCTAGCAAATATCAGATTAGTGAGTGCCATCTTTTATACCCGTTTGTTGTACAACCTCCTAGTAGTGTTTCCCTGACAGAAGGTATATAATGTGCCACAGCCAATAGGTATGTAATGTGCCACAGTCAATTGCTGCCAAATGGCTAGAAAAATGATAGGTTCATAGTTATAGTTTGGGGTCCAGGATGTTGAAGCAGACCTTTATTGCAAATGTCTGCTAAGTGTTACTCTGGTCTTATGAGAGTTCTTCCACCAAAGTGTAGTCTGGGCTGGAACTTTTATGGAATTTAGTAGCAGGAGAGAAGGGCCCTCTTGTAAACTCTTGTTcccatttattgtatatcactgtggaatatgttggtgctttatagatcatgttaataataataatTACATTCATGGCTGGAATTAGATAAAGCCTAATTATAAGACTGAATAATATTATGCAATATGTGAAAAATTCATATTTGTTTAACTTATTGTATTACACAGTAGAATAAAAACTGATCATATACTTATTCTTCAGCAAGCCATATTTTGCAACTTTTTTTTCCATCTCTAATTTTATTAAATACATTTTATTAAATAAATAAAATATTGTATTACACAGTAGAATAAAAACTGATCATATACTTATTCTTCAGCAAGCCATATTTTGCAACTTTTTTTTCCATCTCTAATTTTATTAAAAATTATAGAATTATAAATGAATAAATATATAACTAATTATGGAATTTCATAGCTGTGAGATGTACCGTATGATAA
  5   1   2      seed Liv1      in                          CAAR709.5p                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCACTCTTTTATACCCGTTTGTTGTACAACCTCCTAGTAGTGTTTCCCTGACAGAAGGTATATAATGTGCCACAGCCAATAGGTATGTAATGTGCCACAGTCAATTGCTGCCAAATGGCTAGAAAAATGATAGGTTCATAGTTATAGTTTGGGGTCCAGGATGTTGAAGCAGACCTTTATTGCAAATGTCTGCTAAGTGTTACTCTGGTCTTATGAGAGTTCTTCCACCAAAGTGTAGTCTGGGCTGGAACTTTTATGGAATTTAGTAGCAGGAGAGAAGGGCCCTCTTGTAAACTCTTGTTcccatttattgtatatcactgtggaatatgttggtgctttatagatcatgttaataataataatTACATTCATGGCTGGAATTAGATAAAGCCTAATTATAAGACTGAATAATATTATGCAATATGTGAAAAATTCATATTTGTTTAACTTATTGTATTACACAGTAGAATAAAAACTGATCATATACTTATTCTTCAGCAAGCCATATTTTGCAACTTTTTTTTCCATCTCTAATTTTATTAAATACATTTTATTAAATAAATAAAATATTGTATTACACAGTAGAATAAAAACTGATCATATACTTATTCTTCAGCAAGCCATATTTTGCAACTTTTTTTTCCATCTCTAATTTTATTAAAAATTATAGAATTATAAATGAATAAATATATAACTAATTATGGAATTTCATAGCTGTGAGATGTACAGTATGATAAAACATTATAAAGCAATTGAATCACATTATCCTCACTATACTGAATTATCCCCGAGTTCAGTAAGTGTTTGGTATAGATAATAAAAAATAAACTTTTCTA
  5   1   2       bld Liv1                                 CAAR9462.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTATGAGAGTTCTTCCACCAAAGTGTAGTCTGGGCTGGAACTTTTATGGAATTTAGTAGCAGGAGAGAAGGGCCCTCTTGTAAACTCTTGTTcccatttattgtatatcactgtggaatatgttggtgctttatagatcatgttaataataataatTACATTCATGGCTGGAATTAGATAAAGCCTAATTATAAGACTGAATAATATTATGCAATATGTGAAAAATTCATATTTGTTTAACTTATTGTATTACACAGTAGAATAAAAACTGATCATATACTTATTCTTCAGCAAGCCATATTTTGCAACTTTTTTTTCCATCTCTAATTTTATTAAATACATTTTATTAAATAAATAAAATATTGTATTACACAGTAGAATAAAAACTGATCATATACTTATTCTTCAGCAAGCCATATTTTGCAACTTTTTTTTCCATCTCTAATTTTATTAAAAATTATAGAATTATAAATGAATAAATATATAACTAATTATGGAATTTCATAGCTGTGAGATGTACAGTATGATAAAACATTATAAAGCAATTGAATCACATTATCCTCACTATACTGAATTATCCCCGAGTTCAGTAAGTGTTTGGTATAGATAATAAAAAATAAACTTTCTTATTTAATCATATTTAAATGCTGTTTCTAATAAACCTGCTACAAACGACTTATATAGTAAAAGTATTAATCATTTTCTTTTAACTTTTCCTCAGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCCACGACAAGACTGAGTTCT
  5   1   2       e50                                 Xt7.1-CABC6623.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTTTTTTTTCAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTTAAAAAAAAAAAAAAATTAGAATAAAATAATAAATATAT
                                                  Xt7.1-CHK-1008221321                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTTCAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTTAAAAAAAAAAAAAAAxxAxAATAAAATAATAA
  5   1   2       chi Liv1                                 CAAR4901.5p                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGTAAGTTAACAAAACCCCATCATTATTAAAGAAGTCCTATAGACTGATTTTTGTTGAAATAATAAATACATGCTTTTCCTTATGTTTCAGGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTAGTAAGGAATATCTCTCAGTGTGTATGATATATGCCTCATATGTAACATAGCCGCAGGGTTGATAAGCTTGTAGGACCCCGGCTGTTGTAAATTGTAGTTTCCAGCATCCTTAGCTCAGATTTGTAGTTCTTCTGAAGCTGGTGCACACATGTATAGCATTTCTGCTCTAAATAAATATTTTTTACTGTTTGTTTGCCCTTTGGAACTTTTATTTATGTTTGTCATCTATTTATATTAGCCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAAGTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAAACTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAAATGAACCATCANGCAGTGCAT
  5   1   2       bld Tad5      in                         XZT12547.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTGTGAGTATAAGTATCTCAGCATATACTTACAAACAGATTTAAGATTCTACGCAAGGTCAGAAAGATAGAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGGACGTTTTGTAAGTTAACAAAACCCCATCATTATTAAAGTCCTATAGACTGATTTTTGTTGAAATAATAAATACATGCTTTTCCTTATGTTTCAGGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCANATACAGGAATTCACAGGANAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAANAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTTCAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGNAACCAGTA
  5   1   2   40  add Liv1 5x                              CAAR2578.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTATTTCTTGTGCTACCTGTGAGCACATAAAACTGCAGGAACCTGCAAGTTTTGCTTCATTTCAAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTGTGAGTATAAGTATCTCAGCATATACTTACAAACAGATTTAAGATTCTACGCAAGGTCAGAAAGATAGGTAATAGCCATAATTTGCCTGAACCACATGTTTTTAGTTTAATATATTTATTTGATAATCAAATATCCAAATAAATGAAGACAGGTTGATTGGCTTGTGATTAAATTGCCCATAGTGTGTGTGAATGATGTATACTCTCTGTAAAGTGCTGTGTGAAATGGGTTGGCACTATATAAATAGCAGATAATAATATTAAATGATGCATTTTGACTGCTTATTTTAAAGAGCCTTTGTAAAATGTTCTTAATGTATTTATCTCATTTCATTTCAAAAGTCATTATTTTATCATAAGGGTAAGATACGCTAAATATATATAATTATCTTAATAAGGAGGGTTCTATATGTTTGCCTTATTACTCAGAATATGCATGTTAGATATTTTATATACAAGTCAATTAAATATGGACCACAGCAATAGTTTAACTTCCGGCACAAGCTGTTTCTCCTTTTCTCTACTGAGTGTGGGTGAGCCGGATAAGAAAATACAGTGCCTTCTATCTGTATGTTTTACAGAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCCTACACCTGTGGCATTTCTGATT
  3  -1   2       chi Liv1      in                         CAAR9701.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTGTGAGTATAAGTATCTCAGCATATACTTACAAACAGATTTAAGATTCTACGCAAGGTCAGAAAGATAGAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGT
  5   1   2   10  bld Liv1 5g3  in                        CAAR11094.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCGATTCAATCGGCACGAGGTTTTTTCAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTT
  5   1   2       bld Tad5      in                         XZT53623.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGCAAGTTTTGCTTCATTTCAAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGCAATGAAAAATACATCTAA
  5   1   2   10  bld Liv1 5g3  in                         CAAR4764.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCCTCGTGTTTTTTTTTTTTCAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAG
  5   1   2       bld AbdN 5g                            IMAGE:7006375                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCAAGTTTTGCTTCATTTCAAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCANAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGGACCAGTATAAAGAAGGTTTTGGGATATCTGTCACCCAACGACAAGACTGGAGTTCTGGGCTTGGGCAATGAAAAAAATACATCTTAATAAGCACCCCAAATCTGCCCATTCCCAATATGGTTTATGAAGGGAT
  3  -1   2       bld TpA       out                   TTpA045g09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTTTTTTTTTTTTTTCAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCCCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCATGAAAAAATACATCTAAT
  3  -1   2       bld Liv1      in                         CAAR6160.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTTTTTTTTTTTTTTCAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTACATCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGATCTATGGTAGGGGTCGATGTCACAGGTTTTTGCCCCGAT
  3  -1   2       bld Liv1      in                        CAAR11257.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTTTTTTTTTTCAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGGACCAGTANTAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATG
  5   1   2       bld Liv1      in                         CAAR2146.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGTAAGTTAACAAAACCCCATCATTATTAAAGAAGTCCTATAGACTGATTTTTGTTGAAATAATAAATACATGCTTTTCCTTATGTTTCAGGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGNCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATNGTATGAGGATTGAGTT
  5   1   2       bld Abd0 5g                            IMAGE:7017917                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATTTCATTTCAAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTT
  5   1   2       chi Liv1      in                         CAAR1131.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGTAAGTTAACAAAACCCCATCATTATTAAAGAAGTCCTATAGACTGATTTTTGTTGAAATAATAAATACATGCTTTTCCTTATGTTTCAGGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTAGTAAGGAATATCTCTCAGTGTGTATGATATATGCCTCATATGTAACATAGCCGCAGGGTTGATAAGCTTGTAGGACCCCGGCTGTTGTAAATTGTAGTTTCCAGCATCCTTAGCTCAGATTTGTAGTTCTTCTGAAGCTGGTGCACACATGTATAGCATTTCTGCTCTAAATAAATATTTTTTACTGTTTGTTTGCCCTTTGGAACTTTTATTTATGTTTGTCATCTATTTATATTAGCCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTGCTAACAGGGTGCAAGGGTAGCGGTCTCTACTACATAAAACTCTAAAAGCCAGCAGCAGTT
  5   1   2   10  bld Liv1 5g3  in                         CAAR5728.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCATTTCAAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGAC
  5   1   2   10  bld Liv1 5g3  in                         CAAR6527.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCATTTCAAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGG
  3  -1   2       bld Liv1      out                        CAAR8688.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTTTTTCAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGCAATGAAAAAATACATCTA
  5   1   2   10  bld Liv1 5g3  in                         CAAR8743.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTTTTTTTTCAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCATGAAAAAATACATCTAATAAG
  5   1   2   10  bld Fat1 5g3  in                        CABC10929.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCATTTCAAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAGAGCACAGC
  5   1   2   10  bld Liv1 5g3  in                        CAAR12022.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTTTTTTTCAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTTGGCATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTT
  5   1   2   10  bld Liv1 5g3  in                        CAAR12408.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTTTTTTTCAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGA
  5   1   2   10  bld Liv1 5g3  in                         CAAR3788.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAGGTTTAAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGNCATGAAAAAATACATCTAATAAGCACCCAATCTGCCCATCCATATGTTATGAGGATTGAGTT
  3  -1   2       bld Liv1      in                        CAAR10681.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTTTTCAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCANAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAG
  3  -1   2       bld Liv1      in                        CAAR11719.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTTTCAATTTTTTAATCAAGAAGGTGCAGGCGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCANAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGNCATGAAAAAATACATCTAATAAGCACCCATCTGCCATCCCATATGTTATGAGGATTGAGTT
  5   1   2   10  bld Liv1 5g3  in                        CAAR10488.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTTTCAAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCCACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATG
  5   1   2   10  bld Liv1 5g3  in                         CAAR4345.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGANGATTGAG
  3  -1   2       bld Liv1      in                        CAAR10325.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGT
  3  -1   2       bld Liv1      in                        CAAR11262.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGA
  5   1   2   10  bld Liv1 5g3  in                         CAAR7486.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGA
  3  -1   2       bld Liv1      in                         CAAR9536.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGTAGGCGGCCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTT
  5   1   2   10  bld Liv1 5g3  in                        CAAR11392.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGGAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATNGTATGAGGATTGAGTT
  5   1   2   10  bld Liv1 5g3  in                         CAAR6697.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATTTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTC
  3  -1   2       bld Liv1      in                         CAAR9746.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCGAGAGGCCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCCACGACAAGACTGAGTTCTGGCTTTGGCATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTT
  5   1   2       bld AbdN 5g                            IMAGE:7005469                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAAGTTTTGGATATCTGTCACCCCACGACNAGACTGAGTTCTGGGCTTGGCAATGAAAAAATACATCTAAATAAGCACCCAATCTGCCATCCCCTTATGTTAAG
  5   1   2   10  bld Liv1 5g3  in                         CAAR2583.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGNNCATGAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATNGTATGAGGATTGAGTT
  3  -1   2       bld Liv1      in                         CAAR7777.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATNGTATGAGGATTGAGTT
  5   1   2       bld Abd0 5g                            IMAGE:7015788                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAGGAGACTTGATGGCAGTGTGGATTTCATAAGACTGGA
  3  -1   2       bld Liv1      in                        CAAR10288.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTT
  3  -1   2       bld Liv1      in                        CAAR11828.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAGAGCACAGCAGATTATTCCACAT
  3  -1   2       bld Liv1      in                          CAAR882.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAATCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGNAGTATCAAAAGAGCACAGCAGATTATTCCACATC
  5   1   2   10  bld Liv1 5g3  in                         CAAR4146.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGNCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAG
  5   1   2   22  bld Tad5 5g                              XZT25362.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATNGTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGC
  5   1   2   12  bld Tad5 5g3  in                         XZT27619.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGNGAGTATCAAAAGAGCACAGCA
  5   1   2   22  bld Tad5 5g                              XZT58280.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAAGGTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGGACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGA
  5   1   2   12  bld Tad5 5g3  in                         XZT50429.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTNGGCATGAAAAATACATCTAATAAG
  5   1   2   12  bld Tad5 5g3  in                         XZT28806.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGCAGGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGGACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTTGGCATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAAGGATGAGTT
  5   1   2       bld Abd0      in                     IMAGE:6999047.b                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGGTGGGACATTGGACCTGCCATAATGACCCTTATAAGAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTTTTGTATAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACTTTTATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACCCGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAAGGTTAGCGGTCTCTACTACATAAAACCTCTTAAAACCCAACAGCAATTCTTGGTGACTGGGAATTGAACATCCGCATTGCATGACGTTTTTCAAAGAAATTGAGGCAGTTGGATTCCTAAAATGGAACCTTAAAAAAGGTGGGATATTGTCCCCAAAAAACGATTTTGGTGGCAAAAAAATCTTATAACCCTC
  3  -1   2       bld Liv1      in                        CAAR10824.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGGGGGACTTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACTAGACTGAGTTCTGGCTTGGCAATGAAAAATACATCTAATAAGCACCCCATCTGCCATCCCATATGTTATGAGGGATGAGTT
  5   1   2       bld TbA  5x                        TTbA023d16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACCGCTCCTCCAGTCCTTAGCCCTCTCGTCTAGCGCCTTCGGTAATATTTTACCAAACACAGACAACCGCTGCATCTCGGAAGAACGTTTTGGAGAGTACTCGTCCTACAACCTGTGGCATCTCTGATCTCTTAAACAAATACCAAGAAAATGTTGATACAGACTCGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATG
  5   1   2   12  bld Tad5 5g3  in                         XZT51494.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGGACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGGATGAGTTAGAAGACTGGAGTAAATCAAAGAGCACAGCAGATTATTCCACATT
  5   1   2       bld Abd0 5g                            IMAGE:7016230                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCANGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTA
  5   1   2   22  bld Tad5 5g                              XZT31680.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGGACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAANATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTNTCAATACAGGAATTCACAGGAAAAGACT
  5   1   2   12  bld Tad5 5g3  in                         XZT45515.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGGACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGCAATGAAAAATACATCTAAATAGCACCCCATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGC
  5   1   2   12  bld Tad5 5g3  in                         XZT64007.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTT
  5   1   2   12  bld Tad5 5g3  in                         XZT68639.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAA
  5   1   2       bld TpA  5g3  in                   TTpA013b06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGGACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAG
  5   1   2       bld Lun1      in                        CABD10048.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGNGAGTATCAAAGAGCACAGCAGAT
  5   1   2       bld TpA  FL   in                   TTpA004p02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTG
  5   1   2   10  bld Liv1 5g3  in                        CAAR11157.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATT
  5   1   2   10  bld Liv1 5g3  in                        CAAR11979.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGNCAATGAAAAAAACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGNAGTATCAAAAGAGCACAGCAGATTATTCCACATT
  5   1   2   10  bld Liv1 5g3  in                         CAAR4469.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTTAGAGACTGGAGT
  5   1   2   10  bld Liv1 5g3  in                          CAAR582.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAG
  5   1   2   10  bld Liv1 5g3  in                         CAAR7242.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTT
  5   1   2   10  bld Liv1 5g3  in                         CAAR8332.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTT
  5   1   2   20  bld Liv1 5g                              CAAR9731.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTT
  5   1   2       bld Lun1      in                        CABD14882.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAA
  5   1   2   24  bld Met5 5g                               CACX438.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GACATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCNCACGACAAGACTGAGTTCTGGCTTGNCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCA
  5   1   2       bld TpA  5g3  in                   TTpA050l02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATTGGACCTGCCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGGACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAA
  5   1   2   20  bld Liv1 5g                             CAAR12467.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCATCGATTCGCCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCT
  5   1   2   10  bld Liv1 5g3  in                        CAAR13147.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCNCACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATNGTATGAGGATTGAGTT
  5   1   2   10  bld Liv1 5g3  in                         CAAR5958.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATNGTATGAGGATTGAGTT
  5   1   0       add Liv1      in                         CAAR6646.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTGTGAGTATAAGTATCTCAGCATATACTTACAAACAGATTTAAGATTCTACGCAAGGTCAGAAAGATAGGTAATAGCCATAATTTGCCTGAACCACATGTTTTTAGTTTAATATATTTATTTGATAATCAAATATCCAAATAAATGAAGACAGGTTGATTGGCTTGTGATTAAATTGCCCATAGTGTGTGTGAATGATGTATACTCTCTGTAAAGTGCTGTGTGAAATGGGTTGGCACTATATAAATAGCAGATAATAATATTAAATGATGCATTTTGACTGCTTATTTTAAAGAGCCTTTGTAAAATGTTCTTAATGTATTTATCTCATTTCATTTCAAAAGTCATTATTTTATCATAAGGGTAAGATACGCTAAATATATATAATTATCTTAATAAGGAGGGTTCTATATGTTTGCCTTATTACTCAGAATATGCATGTTAGATATTTTATATACAAGTCAATTAAATATGGACCACAGCAATAGTTTAACTTCCGGCACAAGCTGTTTCTCCTTTTCTCTACTGAGTGTGGGTGAGCCGGATAAGAAAATACAGTGCCTTCTATCTGTATGTTTTACAGGTAACATAACTAGATACACTATGAAGAGAATTTGTTGCCTACAGAACATTATATTAACTATTAAACAGCCTATTCCTTTTTTTCCTACAGAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGTAAGTTAACAAAACCCCATCA
  5   1   2   10  bld Liv1 5g3  in                         CAAR9324.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCACATTCAGAGTGGGTTCAGAA
  5   1   2   12  bld Tad5 5g3  in                          XZT8680.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGGACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGANATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTAT
  5   1   2   10  bld Liv1 5g3  in                         CAAR5099.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCGATTCGCCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTA
  5   1   2   20  bld Liv1 5g                              CAAR8231.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTT
  5   1   2   10  bld Liv1 5g3  in                        CAAR11466.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTT
  5   1   2       bld Tad5                                 XZT11279.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATAATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATTAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATNGTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAA
  5   1   2       bld TpA  5g3  in                   TTpA024h15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGGACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCCAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCCGATCTGGGCAAAAACCTGTGACATCCACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAAGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATAT
  5   1   2   10  bld Liv1 5g3  in                         CAAR5172.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AATGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGNCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTT
  5   1   2       bld Liv1      in                          CAAR648.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATCGATTCAATTCGGCAAGAGGGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATT
  5   1   2       bld Abd0                               IMAGE:7017685                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCACGACNAGACT
  5   1   2       bld Liv1      in                        CAAR10263.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGGTATCAAAAGAGCACAGCAGATTATTCACATTCAGAGTGGGTTCAGAAAAG
  5   1   2       bld Liv1      in                        CAAR11191.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAAT
  5   1   2       bld Liv1      in                         CAAR8710.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGNCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCCATCCATATNGTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAA
  5   1   2       bld Liv1      in                        CAAR12062.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCA
  5   1   2       bld Liv1      ?                          CAAR4394.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCA
  5   1   2       bld Fat1      in                         CABC6623.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTACACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGG
  5   1   2       bld Liv1      in                        CAAR11185.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCCATTCA
  5   1   2       bld Liv1      in                         CAAR3114.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTT
  5   1   2       bld Liv1      in                         CAAR5081.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCCATCGATTCGTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAA
  5   1   2       bld Liv1      in                         CAAR7120.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGT
  5   1   2       bld Fat1      in                         CABC1113.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGCTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATC
  5   1   2       bld Fat1      in                         CABC2234.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTC
  5   1   2       bld Fat1      in                          CABC921.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATT
  5   1   2       bld Lun1      in                        CABD14215.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACAAGCAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAAATCAAAGAGCACAGCAGATTATTCCACATTCAG
  5   1   2       chi Fat1      in                         CABC6965.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCAGTTGTCTGTGTTTGGTAAAATATTACCAAAGGCACTAGACAAGAGGGCTAAGGACTGGAGGAGCAGTAATCCTTGCTTGTGTAATCTGGTCATTATGGCAGGTCCAATGTCCCCTGCACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTC
  5   1   2       bld Liv1      in                         CAAR8382.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAGGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAG
  5   1   2       bld Liv1      in                         CAAR5619.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGGTTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGC
  3  -1   2       bld Liv1      in                         CAAR6997.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAG
  5   1   2       bld Liv1      in                        CAAR10300.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTG
  5   1   2       bld Liv1      in                         CAAR2197.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGNTGGTGA
  5   1   2       bld Liv1      in                         CAAR3287.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATT
  5   1   2       bld Liv1      in                         CAAR6458.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATNGTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAGAGC
  5   1   2       bld Liv1      in                        CAAR10363.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAGTCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGGTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGA
  5   1   2       bld Liv1      in                        CAAR10784.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTT
  5   1   2       bld Liv1      in                         CAAR8020.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAAATCAAAGAGCACAGCAGATTATTCCACATTCAGAG
  5   1   2       bld Liv1      in                         CAAR8179.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCA
  5   1   2       bld Liv1      in                          CAAR847.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTTCACATTCAGAGTGGGTTCA
  5   1   2       bld Lun1      in                        CABD11332.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGNGTTC
  5   1   2       bld Liv1      in                        CAAR12893.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAG
  3  -1   2       bld Liv1      in                         CAAR8301.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGAATGAGTTAGAAGACTGGNAGTATCAAAAGAGCACAGCAGATTA
  3  -1   2       bld Lun1      in                        CABD12345.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATCGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGNGTTCAGAAAAAGGATATTATCGTTTCACTTACGCATA
  3  -1   2       bld Liv1      in                         CAAR2858.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATNCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGATAATTATCGTTTCACTTACGCATACTTCA
  5   1   2       bld Liv1      in                        CAAR11805.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAG
  5   1   2       bld Liv1      in                         CAAR2722.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCA
  5   1   2       bld Liv1      in                         CAAR4004.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTT
  5   1   2       bld Liv1      in                         CAAR4391.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGTATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCA
  5   1   2       bld Liv1      in                         CAAR6650.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGGTCAGAAAA
  5   1   2       bld Liv1      in                         CAAR6802.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTG
  5   1   2       bld Liv1      in                         CAAR8724.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATT
  5   1   2       bld Liv1      in                         CAAR8742.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTT
  3  -1   2       bld Liv1      in                        CAAR11174.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCA
  5   1   2       bld Liv1      in                        CAAR11972.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATTCCGTGTGACTCAAAAATCCAAAAACTTGTTGGATGA
  5   1   2       bld Liv1      in                        CAAR12214.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATNGTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATT
  5   1   2       bld Liv1      in                        CAAR12529.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATCA
  5   1   2       bld Liv1      in                        CAAR13169.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGA
  5   1   2       bld Liv1      in                         CAAR1736.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAANAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCACATTCAGAGTGGGT
  5   1   2       bld Liv1      in                         CAAR2412.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCANAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTC
  5   1   2       bld Liv1      in                         CAAR3914.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGGTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGAT
  5   1   2       bld Liv1      in                         CAAR5107.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCNCACGACAAGACTGAGTTCTGGCTTGNCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTT
  5   1   2       bld Liv1      in                         CAAR5245.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAGAGCACAGCAGATTATCCACATTCAGAGTGGGTTC
  5   1   2       bld Liv1      in                         CAAR7244.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAAATTATCGTTTCACTTACCCATACTTCAT
  5   1   2       bld Liv1      in                         CAAR7355.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAG
  5   1   2       bld Liv1      in                         CAAR7873.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACAT
  5   1   2       bld Liv1      in                         CAAR7989.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAG
  5   1   2       bld Liv1      in                         CAAR9238.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTT
  5   1   2       bld Liv1      in                         CAAR9660.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCG
  5   1   2       bld Fat1      in                         CABC1345.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAG
  5   1   2       bld Liv1      in                         CAAR6747.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTTCACTTACGCATAC
  5   1   2       bld Liv1      in                          CAAR564.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATNGTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGATAATTTATCGTTCACTTACGCATA
  5   1   2       bld Liv1      in                         CAAR2758.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTAATCCACATTCAGAGTGGGTTCAGAAAAAGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCG
  5   1   2       bld Liv1      in                         CAAR3449.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCCAGTCCTTAGCCCTCTTCTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGC
  5   1   2       bld Liv1      in                         CAAR4647.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTC
  3  -1   2       bld Liv1      in                         CAAR5467.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGAATATTCCACATTCAGAGTGGGTTCAG
  5   1   2       bld Liv1      in                         CAAR5843.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATNGTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTG
  5   1   2       bld Liv1      in                         CAAR7861.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTTCAGAA
  5   1   2       bld Liv1      in                          CAAR916.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTA
  5   1   2       bld Liv1      in                         CAAR9473.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCA
  3  -1   2       bld Fat1      in                          CABC812.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGNGTTCAGAAAAG
  5   1   2       bld Liv1      in                         CAAR7478.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATC
  5   1   2       bld Liv1      in                        CAAR12028.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTC
  5   1   2       bld Liv1      in                        CAAR12271.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAAATCAAAGAGCACAGCAGAATATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCG
  5   1   2       bld Liv1      in                         CAAR2909.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGG
  5   1   2       bld Liv1      in                        CAAR10290.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAAATCAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATT
  5   1   2       bld Liv1      in                         CAAR5593.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAG
  5   1   2       bld Liv1      in                          CAAR831.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTC
  5   1   2       bld Liv1      in                         CAAR9794.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAAATCAAAGAGCACAGCAGATTATTCCACATC
  3  -1   2       bld Liv1      out                        CAAR5845.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAAATCAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCA
  5   1   2       bld Liv1      in                         CAAR9639.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTCCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTTC
  5   1   2       bld Liv1      in                        CAAR12853.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTAATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAA
  5   1   2       bld Liv1      in                         CAAR3448.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGGATATTATCGTTTCACTTACGCATACTTCAAT
  5   1   2       bld Liv1      in                         CAAR6516.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTC
  5   1   2       bld Liv1      in                         CAAR7299.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAG
  5   1   2       bld Liv1      in                         CAAR9995.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCA
  5   1   2       bld Fat1      in                         CABC1455.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAAATCAAAGAGCACAGCAGATTATTCCACATT
  5   1   2       bld Liv1      in                         CAAR3722.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAA
  5   1   2       bld Liv1      in                         CAAR4553.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAG
  5   1   2       bld Liv1      in                         CAAR5707.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGAATATTCCACATTCAGAG
  5   1   2       bld Liv1      in                         CAAR6341.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAA
  5   1   2       bld Liv1      in                         CAAR8415.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATNGAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACA
  5   1   2       bld Liv1      in                         CAAR9287.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTAGCCCTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGGAGTATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAA
  5   1   2       bld Liv1      in                        CAAR11119.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGAACAGACTGAGTTCTGGCTTGGCAATGAAAAATACA
  5   1   2       bld Lun1      in                        CABD14240.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCA
  5   1   0       add Liv1      in                        CAAR12113.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTGTCTAGTGCCTTTGGTGTGAGTATAAGTATCTCAGCATATACTTACAAACAGATTTAAGATTCTACGCAAGGTCAGAAAGATAGGTAATAGCCATAATTTGCCTGAACCACATGTTTTTAGTTTAATATATTTATTTGATAATCAAATATCCAAATAAATGAAGACAGGTTGATTGGCTTGTGATTAAATTGCCCATAGTGTGTGTGAATGATGTATACTCTCTGTAAAGTGCTGTGTGAAATGGGTTGGCACTATATAAATAGCAGATAATAATATTAAATGATGCATTTTGACTGCTTATTTTAAAGAGCCTTTGTAAAATGTTCTTAATGTATTTATCTCATTTCATTTCAAAAGTCATTATTTTATCATAAGGGTAAGATACGCTAAATATATATAATTATCTTAATAAGGAGGGTTCTATATGTTTGCCTTATTACTCAGAATATGCATGTTAGATATTTTATATACAAGTCAATTAAATATGGACCACAGCAATAGTTTAACTTCCGGCACAAGCTGTTTCTCCTTTTCTCTACTGAGTGTGGGTGAGCCGGATAAGAAAATACAGTGCCTTCTATCTGTATGTTTTACAGGTAACATAACTAGATACACTATGAAGAGAATTTGTTGCCTACAGAACATTATATTAACTATTAAACAGCCTATTCCTTTTTTTCCTACAGAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGTAAGTTAACAAAACCCCATCATTATTAAAGAAGTCCTATAGACTGATTTTTGTTGAA
  3  -1   2       bld Liv1      in                         CAAR4836.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTGTCTAGTGCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACA
  5   1   2       bld Tad5                                 XZT22752.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGACGCGTGGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTTACATGCCAGCAGCCTTGTCGAGATACAGTTCANATACAGGAAATCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGG
  5   1   2       bld Liv1      in                         CAAR5155.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAA
  5   1   2       bld Liv1      in                         CAAR8763.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTTTGGTAATATTTTACCAAACACAGACAACTGCTGCATCTTGGATGAACGTTTTGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAGAGCACAGCAGATTATTCCACATTCA
  5   1   2       bld Liv1      in                         CAAR5872.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGAGGGGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGNGTTCA
  5   1   2       bld Tad5      in                         XZT33579.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGCGTCGAGAGTACTGTCCTACAACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCNNCAGTGACAGTTCTTCACATCTCAC
  5   1   2       bld Tad5      in                         XZT39410.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACCTGTGGCATTTCTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGA
  5   1   2       bld TpA       in                   TTpA064g19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGATTTCTTAAACAAATACCAAGAAAATGTTGATACAGACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTG
  5   1   2       bld Liv1      in                         CAAR1774.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTTGCAGTACCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGNGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCNAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAG
  5   1   2       bld Liv1      in                        CAAR12236.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCNCAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTG
  5   1   2       bld Liv1      in                        CAAR11681.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTGAAAACCTTTTAGTTCAAATCAATAATTCCACAAGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTA
  5  -1   2       chi Liv1      in                         CAAR6160.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGTGGAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCATAAATCCAAAACCATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGATCTATGGTAGGTGTCGATGTCACAGGTTTTTGCCCAGATCCGATTACATGATCTACTATTATGGTAGTTTCACTTGTGGAATTATTGATTTGAACTAAAAGGTTTTCAAGGTACTGCAAGTCTG
  5   1   2       bld Tad5                                 XZT30975.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTTCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGT
  5   1   2       bld Tad5      in                         XZT59765.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTGAAACTACCATAATAGTAGATCATGTAATCGGATCTGGGCAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAAC
  5   1   2       bld Liv1      in                         CAAR2863.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGGATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAAACGATGCCATGCTGCCCACCTCAATG
  5   1   2       bld Liv1      in                        CAAR10463.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAACCTGTGACATCGACACCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGAACATGGTATTATCTGGGCTA
  5   1   2       bld Liv1      in                         CAAR1802.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTACCATAGATCCTGTGACTCAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCCTCATGGGAAATACTATCA
  5   1   2       bld TpA       in                   TTpA063f16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAAAATCCAAAAACATGTTGGATGAAATTACAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATC
  5   1   2       bld TpA       in                   TTpA007n06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGGATGAAATTCAAGATATGAAAAAACTATTGTCCAGTATGAAGAAAATATACAATACCTGCAAGAAGTATATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGAAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGC
  5   1   2       bld Tad5      in                         XZT25873.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTCTTCAAATCAAAATAAGATTTTCCTGCTTAAACAGAAAATAGCAAATCTGGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGANACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGNGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTC
  3   1   2       bld Liv1      in                         CAAR4553.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAATCAAAATAAGATTTCCTGCTAACAGAAAAATAGCAAATCTGAATTACAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTANCAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCAC
  3  -1   2       bld Liv1      in                         CAAR6782.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAATCTGGAATTCAATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTC
  3   1   2       chi Tad5      in                         XZT53623.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATGCCAGCAGCCTTGTCGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTAAAAAAAAAAAAAAAGG
  3  -1   2       bld Abd0      in                       IMAGE:6999153                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGAACCTATTAGAACAAGTTTTTTCGGTCCGGGAATTCCCGGGGATCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCNAAGAAGTCTGACTTTGAGAACAGAGGAGACTTATTAAATTGCAGTTTTAGGT
  5  -1   2       bld Liv1      in                        CAAR10325.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGAGATACAGTTCAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTC
  5   1   2       bld Fat1      in                         CABC5857.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAATACAGGAATTCACAGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCANAGAAGTCTGACTTTGAGAACAG
  5  -1   2       bld Liv1      in                        CAAR10288.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGAAAAGACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTT
  3   1   2       bld Lun1      in                        CABD14215.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAAAAGACTGTCAGAAGTTGCTACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTAAAAAAAA
  3   1   2       bld Liv1      in                         CAAR3114.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACTGTCAAGAAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATGAAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTAAAAAAACCTCTC
  3   1   2       bld Liv1      in                        CAAR12893.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACTGTCAAGAAGTTGCTAACAAGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTAAAAAAAA
  3   1   2       bld Liv1      in                         CAAR5707.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCNTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTAAAAAAACCTCT
  3   1   2       bld Liv1      in                         CAAR9995.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTAAAAA
  3   1   2       bld Liv1      in                         CAAR9287.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGTGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTAAATAAAAATAAACCATTCTAAA
  3   1   2       bld Liv1      in                          CAAR648.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGGTGCAAGGGTTAGCGGTCTCTACTACATAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATGGAACCATCAGGCAGTGCATGGACAGTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACAC
  3   1   2       bld Liv1 5g3  in                         CAAR7486.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTA
  3   1   2       bld Liv1      in                         CAAR8710.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAAGGGTTAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATGANCCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGCTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  5   1   2       bld Liv1      out                        CAAR4981.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTC
  3   1   2       bld Liv1      in                         CAAR2412.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Liv1 5g3  in                          CAAR582.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCGGTCTCTACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATGACNCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCC
  3   1   2       bld Liv1      in                         CAAR6646.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAANTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCC
  3   1   2       bld Liv1      in                         CAAR9473.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTAAAAAAA
  5  -1   2       bld Liv1      in                         CAAR9701.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTT
  3   1   2       bld Liv1      in                        CAAR12853.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTACATAAAACTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCC
  3   1   2       bld Liv1      in                         CAAR4647.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCC
  3   1   2       bld Liv1      in                         CAAR7873.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAG
  3   1   2       bld Tad5 5g3  in                         XZT50429.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TACATAAAACCTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Liv1 5g3  in                        CAAR13147.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTACATAAACCTCTAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATGACNCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Liv1      in                         CAAR2909.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCTAAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCC
  3   1   2       bld Liv1      in                         CAAR2146.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTC
  3   1   2       bld Liv1      in                         CAAR3914.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Liv1      in                          CAAR847.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Fat1      in                         CABC1345.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTAAAA
  3   1   2       bld Tad5 5g3  in                         XZT28806.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAAGCCCAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGAAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAACAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Fat1      in                         CABC6965.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAAAAAAAA
  3   1   2       bld Liv1 5g3  in                        CAAR11392.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Liv1      in                         CAAR1802.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Liv1      in                         CAAR6516.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATGAACCATCAGGCAGTGCATGGACAGTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  5  -1   2       bld Liv1      in                         CAAR6997.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Liv1      in                         CAAR7478.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Tad5                                  XZT3739.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTAAATAAAAATAAACCATTCTACACAGTAAAAAAAAAAAAAAAGGGCG
  5   1   2       bld Liv1      in                         CAAR7606.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGGAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCACGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCANAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTC
  3   1   2       bld Fat1      in                         CABC5857.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCCAAGCAGCAGTTCNTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCCAAAAAA
  3   1   2       bld Liv1      in                         CAAR2758.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  5  -1   2       bld Liv1      in                         CAAR9746.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATT
  3   1   2       bld Fat1      in                         CABC1455.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACAC
  3   1   2       bld Lun1      in                        CABD10048.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTC
  3   1   2       bld Liv1      in                         CAAR3722.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  5   1   2       bld Lun1      in                        CABD12954.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCC
  3   1   2       bld Liv1      in                        CAAR12236.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAAAAAAAAAA
  3   1   2       bld Liv1 5g3  in                         CAAR2583.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAAGCAGCAGTTCCTGGTGTACTGTGAAATGACCCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCC
  3   1   2       bld Liv1      in                        CAAR10734.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTT
  3   1   2       bld Liv1 5g3  in                         CAAR4146.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCC
  3   1   2       bld Lun1      in                        CABD14240.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTAAATAAAAATAAACCATTCTAAAAA
  3   1   2       bld Liv1      in                         CAAR5245.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Liv1      in                         CAAR7606.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  5   1   2       bld Liv1      in                        CAAR10734.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAGCAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCANAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTAAAAAAAAAAAAAAAAA
  3   1   2       bld Liv1      in                         CAAR5155.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCAGCAGTTCCTGGTGTACTGTGAAATGACCCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACAC
  3   1   2       bld Liv1      in                         CAAR5081.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGTTCCTGGTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Fat1      in                         CABC2234.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Liv1 5g3  in                        CAAR11094.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCC
  3   1   2       bld Liv1      in                        CAAR11185.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAAAA
  3   1   2       bld Liv1      in                        CAAR11681.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Liv1      out                        CAAR3662.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Liv1 5g3  in                         CAAR4764.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTAAAAAAA
  3   1   2       bld Liv1      in                         CAAR8724.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Tad5      in                         XZT33579.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTACTGTGAAATTGACCCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTT
  3   1   2       bld Liv1      in                         CAAR1131.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Liv1      in                         CAAR1774.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTACTGTGAAATTGANCCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  5  -1   2       bld Liv1      in                         CAAR5467.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTAAA
  3   1   2       bld Liv1      in                         CAAR5843.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACAC
  3   1   2       bld Liv1      in                        CAAR12062.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Liv1      in                         CAAR7120.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTACTGTGAAATGACCCATCAGGCAGTGCATGGACAGTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTAC
  3   1   2       bld Tad5 5g3  in                         XZT45515.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGAAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAACAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTAC
  3   1   2       bld Liv1      in                         CAAR3862.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  5   1   2       bld Liv1      in                         CAAR3862.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGTGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCANAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Lun1                                CABD12355.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCANAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGAATTCATTTTTACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATT
  3   1   2       bld Liv1 5g3  in                         CAAR6527.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAATTGAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACNCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Tad5                                 XZT40364.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGAAACCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGAAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAACAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTT
  3   1   2       bld Liv1      out                        CAAR6482.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAACCATCAGGCAGTGCATGGACAGTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Liv1 5g3  in                        CAAR11466.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCATCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Liv1      in                        CAAR13169.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Liv1 5g3  in                        CAAR12408.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGGCAGTGCATGGACAGTTTTTCAAAGAAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACGCATTCC
  3   1   2       bld Liv1 5g3  in                         CAAR8743.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCC
  5   1   2       bld Liv1      in                         CAAR3601.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAG
  3   1   2       bld Liv1      in                         CAAR2197.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGCAGTGCATGGACAGTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACNCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTG
  3   1   2       bld Liv1      in                         CAAR5593.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Liv1      in                          CAAR564.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGTGCATGGACAGTTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Liv1 5g3  in                        CAAR11157.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGTGCATGGACAGTTTTCAAAGGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTC
  5  -1   2       bld Liv1      in                        CAAR11828.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGAGACTTGATGGCAGTGTGGATTTCCATAGAAACTGGAACCAGTATAAAGAAGGTTTGGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGCCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCT
  5   1   2       bld Liv1      in                        CAAR11801.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGAGACTTGATGGCAGTGTGGATTTTATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGA
  3   1   2       bld Tad5 5g3  in                         XZT51494.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAGACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGAAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAACAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  5  -1   2       bld Liv1      in                         CAAR4836.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAA
  5   1   2       bld TpA       in                   TTpA070g16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTGATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTA
  3   1   2       bld TpA       in                    TTpA064g19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATGGCAGTGTGGATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGAAAATACTATCAAGGTGGTTCATACACTAAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTAAATAAAAATAAACCATTCTAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Liv1      in                         CAAR8382.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTTCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Lun1      in                        CABD11332.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCATAAGAACTGGAACCAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACNCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTTTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTG
  3   1   2       bld Liv1      in                        CAAR12113.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATTTTCCCCCCCCCCCCCCCCCCCCGGAGAAATGGCTGTGCTGTGCCCCCTGCAGCAGATAAAATATAAAGCGGAGGTACACAGCGCAGTATTAGGGGGTGCAAACCAGCCCTGTGTACCCCTGCTGTTTCCCAACTTGACAGCACCATAGATTAGAGCCAGGACTATAGAAAAACAGCAAATTCTTGTAGCATATGTTGGTTTGACAAAAAAATGTTCTCTTCCCATTTATCATTATTTGTATCCATTACACATAAAGAAAGCCCATACAAATTAGAGGTTTTGAAAAACCTGTTTTTCAAGGTTTGCTACTTTAATGTACTTTATTTCCTTTGATGCAGAAACCAACTATTTTTAAATGAATGAAAAATGAAATACAAATTGTGTATAAATGTATGGCCTAATACCTTCTATTGTTCTTGCAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Liv1      in                        CAAR12529.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGTATAAAGAAGGTTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATGAACCATTCT
  3   1   2       bld Tad5      in                         XZT19309.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCCCCCCCCCCCCCCCCCCCGGAGAAATGGCTGTGCTGTGCACCCTGCAGCAGATAAAATATAAAGCGGAGGTACACAGCGCAGTATTAGGGGGTGCAAACCAGCCCTGTGTACCCCTGCTGTTTCCCAACTTGACAGCACCATAGATTAGAGCCAGGACTATAGAAAAACAGCAAATTCTTGTAGCATATGTTGGTTTGACAAAAAAATGTTCTCTTCCCATTTATCATTATTTGTATCCATTACACATAAAGAAAGCCCATACAAATTAGAGGTTTTGAAAAACCTGTTTTTCAAGGTTTGCTACTTTAATGTACTTTATTTCCTTTGATGCAGAAACCAACTATTTATAAATGAATGAAAAATGAAATACAAATTGTGTATAAATGTATGGCCTAATACCTTCTATTGTTCTTGCAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCT
  3   1   2       bld Liv1      in                        CAAR12667.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCCCCCCCCCCCCCCCCGGAGAAATGGCTGTGCTGTGCACCCTGCAGCAGATAAAATATAAAGCGGAGGTACACAGCGCAGTATTAGGGGGTGCAAACCAGCCCTGTGTACCCCTGCTGTTTCCCAACTTGACAGCACCATAGATTAGAGCCAGGACTATAGAAAAACAGCAAATTCTTGTAGCATATGTTGGTTTGACAAAAAAATGTTCTCTTCCCATTTATCATTATTTGTATCCATTACACATAAAGAAAGCCCATACAAATTAGAGGTTTTGAAAAACCTGTTTTTCAAGGTTTGCTACTTTAATGTACTTTATTTCCTTTGATGCAGAAACCAACTATTTATAAATGAATGAAAAATGAAATACAAATTGTGTATAAATGTATGGCCTAATACCTTCTATTGTTCTTGCAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCC
  5  -1   2       bld Liv1      in                         CAAR6782.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACNCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCT
  3   1   2       bld Liv1 5g3  in                         CAAR6697.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTGGATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACNCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTAAATAAAAATAAACCATTCTAG
  3   1   2       bld Liv1 5g3  in                         CAAR4345.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATATCTGTCACCCAACGACAAGACTGAGTTCTGGCTGGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATGAGTTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTTAAA
  5   1   2       bld Liv1                                 CAAR3049.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTCACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACTTAGCCGGAAA
  5  -1   2       bld Liv1      in                         CAAR2858.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCT
  3   1   2       bld Tad5      in                         XZT12547.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATTTGTTATGAGGATTGAGTTGGAAGCCTGGAGTAATCAAAAGAGCACAGCAGTTTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGAAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAACAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTAAAAAAAAAAAAAAAA
  5   1   2       bld Liv1      in                         CAAR4767.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTTAAAGAG
  3   1   2       bld Liv1      in                         CAAR7989.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAACGACAAGACTGAGTTCTGGCTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATT
  3   1   2       bld Fat1 5g3  in                        CABC10929.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAACGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTT
  3   1   2       bld Liv1      in                         CAAR2722.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTT
  3   1   2      seed Fat1      in                         CABC6623.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GACAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTATAAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTTAAA
  3   1   2       bld Liv1      in                         CAAR6560.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCC
  5   1   2       bld Liv1      in                         CAAR6560.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCCAAANAAAAAAAAAAAAAA
  5   1   2       bld Liv1      in                         CAAR7200.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAGACTGAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGANACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATC
  3   1   2       bld TpA       out                   TTpA012k14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGTTCTGGCTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Liv1      in                         CAAR3287.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGTTCTGCTTGGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTTAAAGAG
  3   1   2       bld Liv1 5g3  in                         CAAR9324.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGTTCTGGCTTGGCAATGAAAAAATACATCTATNAAGCACCCAATCTGCCATCCCATATGTTATGAGGATGAGTTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATT
  3   1   2       bld Liv1      in                         CAAR3449.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTNTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATT
  5  -1   2       bld Liv1      in                         CAAR7777.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTA
  3   1   2       bld Fat1      in                          CABC921.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGGCAATGAAAAAATACATCTAATAAGCACNCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTAAAGAGAAAAAAAA
  5  -1   2       bld Fat1      in                          CABC812.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGGCAATGAAAAAATACATCTAATAAGCACNCAATCTGCCATCCCATATGTTATGAGGATGAGTTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTAT
  3   1   2       bld TpA  5g3  in                    TTpA013b06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGCCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTAAAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Lun1      in                        CABD12345.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATGAGTTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCT
  3   1   2       bld Liv1 5g3  in                         CAAR4469.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTA
  3   1   2       bld Liv1      in                         CAAR7299.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAATGAAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTAAAAAAAAAAAA
  3   1   2       bld TpA  5g3  in                    TTpA024h15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAATGAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGCGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGCCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Liv1      in                        CAAR10363.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCATGAAAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATGNAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTTAAGAG
  5  -1   2       bld Liv1      in                        CAAR11262.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAATGAAAAAATACATCTAATAAGCACNCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTT
  5  -1   2       bld Abd0      in                       IMAGE:6999153                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGAAAAAATACATCTAATAAGCACNCAATCTGCCATTCCCATATGTTATGAGGATTGAGTTAGAGGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGAAAAAGGTAAATCCTATTGCTTGGCCATTCATGTATTGGTTAATCTT
  5   1   2       bld Liv1      in                         CAAR1125.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAG
  5  -1   2       bld Liv1      in                        CAAR10681.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAAATACATCTAATAAGCACNCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTG
  3   1   2       bld Liv1      in                         CAAR3448.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATT
  3   1   2       bld Liv1 5g3  in                         CAAR5172.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAAATACATCTATAAAGCACNCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTAAAGAGAAAAAA
  5   1   2       bld Liv1      ?                          CAAR1578.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCC
  3   1   2       bld Liv1      in                        CAAR10290.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTT
  3   1   2       bld Liv1 5g3  in                        CAAR10488.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATT
  5   1   2       bld Liv1      in                        CAAR12302.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAAACCTAGCCGGAAAAAGGTAAATCCCTATTGCTGGCATTCT
  3   1   2       bld Liv1      in                        CAAR10403.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTTAG
  5   1   2       bld Liv1      in                        CAAR10403.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTTAGAAAAAAAAAAAAAAAAA
  3   1   2       bld Liv1      in                         CAAR9238.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACATCTAATAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATT
  5   1   2       bld Liv1 5g3  in                         CAAR3184.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACAGCGCAGTATTAGGGGGCTGCAAACCAGCCCTGTGTACCCCTGCTGTTTCCCAACTTGACAGCACCATAGATTAGAGCCAGGACTATAGAAAAACAGCAAATTCTTGTAGCATATGTTGGTTTGACAAAAAAATGTTCTCTTCCCATTTATCATTATTTGTATCCATTACACATAAAGAAAGCCCATACAAATTAGAGGTTTTGAAAAACCTGTTTTTCAAGGTTTGCTACTTTAATGTACTTTATTTCCTTTGATGCAGAAACCAACTATTTATAAATGAATGAAAAATGAAATACAAATTGTGTATAAATGTATGGCCTAATACCTTCTATTGTTCTTGCAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCC
  3   1   2       bld Liv1      in                        CAAR12214.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAAGCACCCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTT
  3   1   2       bld Liv1      in                         CAAR5619.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATT
  3   1   2       bld Liv1 5g3  in                         CAAR8332.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAGCACCCAATCTGCCATCCCATATGTTATGAGGATGAGTTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTAAAAAAAAA
  3   1   2       bld Liv1      in                         CAAR2863.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAAGCACCCAATCTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTTAAAGAG
  3   1   2       bld Liv1      in                          CAAR709.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCGCAGTATTAGGGGGTGCAAACCAGCCCCTGTGTACCCCTGCTGTTTCCCAACTTGACAGCACCATAGATTAGAGCCAGGACTATAGAAAAACAGCAAATTCTTGTAGCATATGTTGGTTTGACAAAAAAATGTTCTCTTCCCATTTATCATTATTTGTATCCATTACACATAAAGAAAGCCCATACAAATTAGAGGTTTTGAAAAACCTGTTTTTCAAGGTTTGCTACTTTAATGTACTTTATTTCCTTTGATGCAGAAACCAACTATTTATAAATGAATGAAAAATGAAATACAAATTGTGTATAAATGTATGGCCTAATACCTTCTATTGTTCTTGCAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTT
  3   1   2       bld Liv1      in                        CAAR10300.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCCAATCTGCCATCCCATATGTTATGAGGATGAGTTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATT
  3   1   2       bld Abd0      in                       IMAGE:6999047                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAAAAACATTTAAAGCACCCATTGGCTTCCATTAGTTTGGGATGGGTTTGAGGCTGGGATATCAAAGAGCCCCGCCGGTTTTCCCCTTCAGAATGGGTCAGAAAAGATAATTATTGTTTCACTACGCTACTTCATTGTGGTGATGCTGCCGATGCTTTGATGATTTGATTTTGGAGATGATCCAGGTGACAAGTTCTTCACATCTCACATGGAAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTG
  3   1   2       bld Liv1      in                         CAAR3601.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCAATCTGCCATCCCATATGTTATGAGGATGAGTTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTTAAG
  3   1   2       bld Fat1      in                         CABC1113.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTGCCATCCCATATGTTATGAGGATTGAGTAGAAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATCCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTAAAGAGAAAAAAAA
  3   1   2       bld Liv1      in                        CAAR12028.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTT
  3   1   2       bld Liv1      in                         CAAR6747.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTTAAA
  3   1   2       bld Liv1      in                         CAAR7244.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCC
  5  -1   2       bld Liv1                                 CAAR7351.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTAT
  3   1   2       bld Liv1      in                         CAAR4004.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCCATCCCATATGTTATGAGGATGAGTTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATT
  3   1   2       bld Liv1 5g3  in                         CAAR5958.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATTTAAGAAAAAA
  5   1   2       bld Liv1      in                         CAAR7680.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCCATCCCATATGTTATGAGGATTGAGTTAGACCACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCCACCTC
  3   1   2       bld TpA       in                    TTpA063f16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGAAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTAAATAAAAATAAACCATTCTAAAAAAAAAAAAAAAA
  3   1   2       bld Liv1 5g3  in                         CAAR3788.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATT
  3   1   2       bld Liv1      in                         CAAR4391.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATT
  3   1   2       bld Liv1 5g3  in                         CAAR5099.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGGTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATT
  3   1   2       bld Liv1 5g3  in                         CAAR7242.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCATCCCATATGTTATGAGGATGAGTTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATT
  3   1   2       bld Liv1      in                          CAAR831.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATT
  3   1   2       bld Liv1      in                         CAAR8742.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCATCCCATATGTTATGAGGATGNAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATT
  5  -1   2       bld Liv1      in                         CAAR9536.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCATCCCATATGTTATGAGGATTGAGTTAGAAGACTGGAGTAATCAAAAGAGCACAGCAGATTATTCCACATTCAGAGTGGGTTCAGAAAAGGATAATTATCGTTTCACTTACGCATACTTCATTGGTGGTGATGCTGGCGATGCCTTTGATGGATTTGATTTTGGAGATGATCCAAGTGACAAGTTCTTCACATCTCACAATGGAATGCAGTTCAGTACTTATGACAGAGATAATGACAAATTTGAAGGAAACTGTGCTGAGCAAGATGGGTCTGGTTGGTGGATGAACCGATGCCATGCTGCCCACCTCAATGGGAAATACTATCAAGGTGGTTCATACACTGAGGCAGACAGCGGAACTAGTGGCTATGACAATGGTATTATCTGGGCTACCTGGCGAAGCAGGTGGTACTCCATGAAGTCAGTGACAATGAAAATGATTCCCCTAAACAGATATGGAGCAGAGGGACAGCAGACTTTGGGTGGCTCAAAGAAGTCTGACTTTGAGAACAGAGGAGACTTTTAAAATTGCAGTTTTAGGATTCTTTTTTCATACTTTAATGTCATACTTTATAGATTCCATTCACAACAAGTTTTTAAATAAAAATAAACCATTCTACACAGTTGTTTTCTTAGTTTTGCTAAGACTGGCAAAATTATCCAGATTTCATTTTAACCTTTTACACACTGGCTAGGAATAGGATCATCCGTTTGTCATTCACATAGGTTAACCTAGCCGGAAAAGGTAAATCCTATTGCTTGGCATTCTGTATGTATTTGCATTTTTGCTTTTATACAATTAATAAAAATGATCTATT
  3   1   2       bld Liv1      in                         CAAR9794.3p