Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-TTpA066k12.5.5                       24 END     1           1        4                Nfrl [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 918.0    0Xt7.1-TGas050g04.5.5                       29 PI      87          3      757                Unknown (protein for MGC:68652) [Xenopus laevis]
     3 697.0    0Xt7.1-IMAGE:8952364.5                       6 PI      86          6      619                Unknown (protein for MGC:121696) [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     4   9.0    0(repeat)                                    0 REP     84       1249     1657                (no blast hit)
     5   2.0    0(repeat)                                    0 REP     83        765     1246                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012153455 Xt7.1-CABG4384.5.5 - 84 ESTs
                                                                       .-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABG4384.5.5                                CCCTTCCCTTCTGCAGGTGTAACTAAAACCTAATTGCCATGGATCCGGTCTCTGTACTTCTGTCCGTTGTTGTTTGTATTTTCCTATATAAAGTCTTCTATGGCGGGAAAGAAACATCCAAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGAGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCAGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATAT
                                                  Xt7.1-CHK-1008265773                                      CCTTCTGCAGGTGTAACTAAAACCTAATTGCCATGGATCCGGTCTCTGTACTTCTGTCCGTTGTTGTTTGTATTTTCCTATATAAAGTCTTCTATGGCGGGAAAGAAACATCCAAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGAGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCAGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACxxxAAxCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATxCTTxxCTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAA
                                                      consensus depths                                     2     2     3     3     6     7     7     8    10    11    15    17    17    18    17    18    15    18    10    19    18    19    19    20    19    20    19    21    19    21    19    21    19    21    20    21    20    21    20    22    20    22    20    22    20    22    20    22    20    22    20    22    20    22    20    23    21    23    21    23    21    23    20    23    21    24    21    24    21    24    21    24    21    24    22    25    22    25    22    25    22    25    22    25    22    25    19    25    19    27    19    27    19    27    19    27    19    27    20    28    21    28    22    29    22    29    22    29    23    30    23    30    18    30    17    30    17    30    17    30    17    29    17    29    17    28    16    29    16    30    17    30    17    30    17    30    17    30    14    25    12    25    10    22    12    21    10    20    11    17    10    16    11    16     9    16     8    14     7    13     7    13     8    15     8    15     9    16     7    14     8    15     7    15     8    15     7    14     9    15     9    16    10    17    11    18    11    18    11    21    11    22    14    26    14    26    14    25    15    30    15    31    14    32    14    33    13    36    14    37    16    39    17    41    24    48    24    47    25    46    28    48    31    50    32    51    32    51    32    51    32    51    32    50    33    51    31    51    33    50    33    50    31    50    33    51    35    50    35    50    35    50    35    50    35    50    35    50    35    50    35    50    35    50    35    50    34    49    34    49    34    49    34    49    34    48    34    48    34    48    34    48    34    48    34    48    34    48    34    48    33    47    33    47    33    47    33    47    32    46    32    46    32    46    32    46    31    45    31    44    31    45    31    43    31    44    31    43    30    42    30    41    30    35    30    33    30    33    26    33    26    32    25    32    24    31    22    29    22    29    21    28    13    24     4     9     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     2     2     2     2     2     2
  5   1   2  SIG                                      Xt7.1-CABD5239.5                                CCCTTCCCTTCTGCAGGTGTAACTAAAACCTAATTGCCATGGATCCGGTCTCTGTACTTCTGTCCGTTGTTGTTTGTATTTTCCTATATAAAGTCTTCTATGGTGGGAAAGGAGCATCTCAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAAATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTAAATGACCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGAGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGCTGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCGGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTCGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCATGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATAAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATAATCACCATAAAATGGAGCTTCTCATTTACAAAAATTAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTGTACACGAATAGTTCTCTATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATATTCTTACCTAT
  5   1   2  SIG                                      Xt7.1-CABG4384.5                                                   TAACTAAAACCTAATTGCCATGGATCCGGTCTCTGTACTTCTGTCCGTTGTCATTTGTATTTTCCTATATAAAGTCTTCTATGGCGGGAAAGAAACATCCAAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGAGAAGTCTTCATCTAAAAAGTTTTCCATGATGAA------------------------------------------------------------------------------------------------------------CTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCAGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATTCTTACC
  5   1   2                                           Xt7.1-CABC4511.3                                                    AACTAAAACCTAATTGCCATGGATCCGGTCTCTGTACTTCTGTCCGTTGTTGTTTGTATTTTCCTATATAAAGTCTTCTATGGTGGGAAAGGAGCATCTCAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAAATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTCAAGTCCCATGAAGGGAAGCCATTTGATAACACCTTGATACTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGACTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATAGTCATGGTAAGCTGTTATGGGGTTCTTTCAACTTCCTTCCACATTTCTCTATTCCACTGATCCCTGACCTGTGGCTCATGAGCAACATGTTGCATGCCACCCCCTTTCATGTTGCTCTCCGTGGCCTCAACACTAATTTCAAAATTCCAGGAAAGTTTTCGAGGCACTAGTTTACTCCAAGAAGGGTCTCCTGCAGGCTAGCAGTCTACATGGGGCTAT------------------------------------------------------------------------------------ATGAAATATCCAGACATTCAAAAAAAAGTCCAGATGAAAATTGACAGAGTGATTGGATCGGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTCGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCATGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATAAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATAATCACCATAAAATGGAGCTTCTCATTTACAAAAATTAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTGTACACGAATAGTTCTCTATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATA
  5   1   2                                           Xt7.1-CABI5522.3                                                                                         CATCGATTCGTGTCATTTGTATTTTCCTATATAAAGTCTTCTATGGCGGGAAAGAAACATCCAAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGGTAGGAGTGTTGGGTAGCACGTGTTGAGGTCATGGGATGCCTGGCACAAAGGAATAATAGTTGAACGTGGGAAGGTATAGCAGAAACGGGCAGGCAAAGTAGGAAAGGGGAGCAAATTAGTATGGGGTGCCAGAAGAGAGAACCACCAATCAAGAGGTCAAGCAAATTTTGTTTGTAGATGGAAGTCAGGATAAGGCATATGGCTCAAATGGTAATCACTTGAAATGCATACAGTGCAAACGGTAGTGTAACTGCTATTGGTTTGTGAATCTTCTTTATAATAATGGGATAGGATCAGTGGCAATTCCTGGAGTTTAAGTGCTGCAACGTTCTTGGACAAAAGTCATTTTGCATCTTCTTTCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCNCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGGAATATAAT
  5   1   2  SIG                                     Xt7.1-CABG10279.3                                                                                                                                                          AACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGGGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGAGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCAGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGGAATATAATTCT
  5   1   2                                          Xt7.1-CAAP10313.3                                                                                                                                                                                  TTTTCTGCTTGTGTGGCTCCTCAATGCTTTTTCCATCTGATTTTGGCTTATGAGTAAAATAGGTTGGGGACCCCTGCTCTATTCTTTTGTATAGAATTTTTGGGATCTTTTGGTGCTACTGCACCTCAGTTCAGAAATACTAATCCTAATAATGCTGGCTGGACATCTTTCACTGGGTCTCCTTCCCATGCTAAGAATATCTGGCCAGGTTCTGGTTTTGTGTCCTCTTACCAGAAGGATTGAGTAAATAACTTTACTCAGCTATCTTCCTAATACACGTCTACGTGTACCAGGTAAATCTGCAAGGCCGATTTATTCTTCCATGTTCTCCAAGGTAAACAAACATGCAGAGAAATGCATTTATTAATTAACTGAACATTTTTTGCTGCATTATTTCTTGAAGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGTATTTATAAATTTATTGCTAAACCGGTTTTGGTCCAGTTAATTTAAACCTGTGAACTGGCAAGCCATTCCGAAGTTCTTCATGCCTTTTTCATCTAGGATGCAGACAATACTAACTTAGCTCTGCAATTTCAGGAGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCAGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTAT
  5   1   2  SIG                                      Xt7.1-CAAP1282.3                                                                                                                                                                                                                                                                TCGCGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTAACTGGATTCAGTATGAATATATATTGTCAACATTCATTGGCAGAGGGGGCCAAGAAAGAACAAAGGAACTAGGCATTAATGTAGTCCCATTTCAGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGGTAAGCTGTTATGGGGTTCTTTCAACTTCCTTCCACATTCCCCATTTCTCTATTCCACTGACCTGTGGCTCATGAGCAACATGTTGCATGCCACCCCCTTTCATGTTGCTCTCCGTGGCCTCAACAGTAATTTTAAAATTCCAGGTTTGGAGCCAAGTTTTGGAGGCACTAGTTTACTCCAAGAAGGGTCTCCTGAAGGCTAGCAGTCTACATGGGGCTACCAAATAGCCAATCACAGTCCCCAATGAACTTTTTTTCATGCTTGTGTGGCTCCTCAATGCTTTTTCCATCTGATTTTGGCTTATGAGTAAAATAGGTTGGGGACCCCTGCTCTATTCTTTTGTATAGAATTTTTGGGATCTTTTGGTGCTACTGCACCTCAGTTCAGAAATACTAATCCTAATAATGCTGGCTGGACATCTTTCACTGGGTCTCCTTCCCATGCTAAGAATATCTGGCCAGGTTCTGGTTTTGTGTCCTCTTACCAGAAGGATTGAGTAAATAACTTTACTCAGCTATCTTCCTAATACACGTCTACGTGTACCAGGTAAATCTGCAAGGCCGATTTATTCTTCCATGTTCTCCAAGGTAAACAAACATGCAGAGAAATGCATTTATTAATTAACTGAACATTTTTTGCTGCATTATTTCTTGAAGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCANACGTAGGGATCAACTGGATGTGAAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGGAGAATATAAT
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                   VAR                                                                                                                                            AAGGAGCATCTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGAAGGTAGGAGTGTTGGGTAGCACGTGTTGAGGTCATGGGATGCCTGGCACAAAGGAATAATAGTTGAACGTGGGAAGGTATAGCAGAAACGGGCAGGCAAAGTAGGAAAGGGGAGCAAATTAGTATGGGGTGCCAGAAGAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAAGCTGTTATGGGGTTCTTTCAACTTCCTTCCACATTCCCCATTTCTCTATTCCACTGACCTGTGGCTCATGAGCAACATGTTGCATGCCACCCCCTTTCATGTTGCTCTCCGTGGCCTCAACAGTAATTTTAAAATTCCAGGTTTGGAGCCAAGTTTTGGAGGCACTAGTTTACTCCAAGAAGGGTCTCCTGAAGGCTAGCAGTCTACATGGGGCTACCAAATAGCCAATCACAGTCCCCAATGAACTTTTTTTCATGCTTGTGTGGCTCCTCAATGCTTTTTCCATCTGATTTTGGCTTATGAGTAAAATAGGTTGGGGACCCCTGCTCTATTCTTTTGTATAGAATTTTTGGGATCTTTTGGTGCTACTGCACCTCAGTTCAGAAATACTAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCAGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGGAGAGACGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCCTCATGGAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACCATAAGATCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGCATTGCCTCGCAGCTAGACAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACTCTACACATA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCACCATAAAATGGAGCTTCTCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTACAAAAATT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCATTCTACTGTACACGAATAGTTCTCTATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTCCTTCCCCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGACGTCACATTCAGAGGCTATTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTTCTCTATAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTT
                                                                   SNP                                                                                            ----T------A
                                                                   SNP                                                                                                                                -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                            -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --G--A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --G--------T
                                               BLH ATG      38     928                                
                                               BLH MIN      29     161                                
                                               BLH OVR      38      25                                
                                               EST CLI      44      13                                
                                               ORF LNG      38       2                                
                                                                                                           PROTEIN --- Ci ---- 2e-012     ABI20699.1 cytochrome P450 CYP3-like member 2 [Ciona intestinalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PROTEIN === Ce ==== 3e-054     NP_501480.2 cytochrome p450 2A15 family member (57.7 kD) (4J410) [Caenorhabditis elegans] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 5e-055     NP_728191.1 Cytochrome P450-18a1 CG6816-PA [Drosophila melanogaster] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PREDICTED - Sp ---- 5e-068     XP_786956.2 PREDICTED: similar to MGC140497 protein [Strongylocentrotus purpuratus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                            PROTEIN === Hs ==== 5e-102     NP_000763.1 cytochrome P450, family 2, subfamily C, polypeptide 18; cytochrome P450,subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 17; cytochrome P450,subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 18; microsomalmonooxygenase; flavoprotein-linked monoo [Homo sapiens]  ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PROTEIN === Mm ==== 2e-102     NP_082467.1 cytochrome P450, family 2, subfamily c, polypeptide 65 [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                              PREDICTED - Dr ---- 2e-103     XP_685869.1 PREDICTED: similar to Cytochrome P450 2F2 (CYPIIF2) (Naphthalene dehydrogenase) (Naphthalene hydroxylase) (P450-NAH-2) isoform 1 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                             PREDICTED - Gg ---- 2e-133     XP_420052.2 PREDICTED: similar to LOC494798 protein [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                            PROTEIN === Xt ==== 0          CAJ83629.1 novel cytochrome P450 cyp2 family protein [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                            PREDICTED = Xl ==== 0          AAH60472.1 Unknown (protein for MGC:68652) [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                            PREDICTED = ?? ==== 0          NP_001083455.1 hypothetical protein LOC398935 [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABG4384.5.5                                                       TAA------------ATG---------------------------------------------------------------------------------------------------------------------------------ATGATG---ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATGATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------TGA---------------------------------------------------------------------------TAA---------------------------------------------TGA------------------------TGA------------------------TAA------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------TAA---------------------------------------------------TAA------------------------TAA---TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------TGA---------------------------TAG---------------------------------------------------------TGA------------------------TAA------------------------TGA---ATG---------------------TAG---------------------------------------------------------------------------------------------------------------TGA---------ATG------------------TAG---------------------------------------------------------------------------------------------------TAA---------------------------------------------------TGA---------------------------------------------------------------------TGA------------------------------------TAG---------------------------------------------------------------ATG---------------------------------------------------TAATGATGA---ATG------------------------------------TAA
                                                                   ORF                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ...
  5   1   2  SIG                                      Xt7.1-CABD5239.5                                CCCTTCCCTTCTGCAGGTGTAACTAAAACCTAATTGCCATGGATCCGGTCTCTGTACTTCTGTCCGTTGTTGTTTGTATTTTCCTATATAAAGTCTTCTATGGTGGGAAAGGAGCATCTCAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAAATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTAAATGACCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGAGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGCTGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCGGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTCGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCATGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATAAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATAATCACCATAAAATGGAGCTTCTCATTTACAAAAATTAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTGTACACGAATAGTTCTCTATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATATTCTTACCTAT
                                                  Xt7.1-CHK-1008281716                                      CCTTCTGCAGGTGTAACTAAAACCTAATTGCCATGGATCCGGTCTCTGTACTTCTGTCCGTTGTTGTTTGTATTTTCCTATATAAAGTCTTCTATGGTGGGAAAGGAGCATCTCAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAAATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTAAATGACCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGAGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGCTGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCGGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTCGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCATGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATAAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATAATCACCATAAAATGGAGCTTCTCATTTACAAAAATTAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTGTACACGAATAGTTCTCTATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATxxTxxxACCTATAAAAAA
  5   1   2   10  ext Ova1 5g3  in                        CABE13082.5p ...............................CCCTTCCCTTCTGCAGGTGTAACTAAAACCTAATTGCCATGGATCCGGTCTCTGTACTTCTGTCCGTTGTTGTTTGTATTTTCCTATATAAAGTCTTCTATGGTGGGAAAGGAGCATCTCAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAAATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTCAAGTCCCATGAAGGGAAGCCATTTGATAACACCTTGATACTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGACTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATAGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTNAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTAAATGACCAGAGGGATCTCATTGA
  5   1   4      seed Int1      in                         CAAP7530.5p                                                                                                                                            AAGAAACATCCAAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGAGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGG
  5   1   2       ext Kid1      in                         CABA7679.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTAAATGACCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGAGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGCTGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCGGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTCGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCATGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATAAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATAATCACCATAAAATGGAGCTTCTCATTTACAAAAATTAAACATAGAAAGCTATAAACAGTCTTAAGAAAACAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAG
  3   1   4      seed Int1      in                         CAAP7530.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTGATGATGATGAAATATCCAGACATCAAAAAAAAGTCCAAGATGAAATGNACAGAGTGATNGGATCAGCAGAACCTCGGCTCGACACCGGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTA
  3   1   2       ext Kid1      in                         CABA7679.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTCGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCATGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATAAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATAATCACCATAAAATGGAGCTTCTCATTTACAAAAATTAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTGTACACGAATAGTTCTCTATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACCGGCCCTATATTA
  5   1   2       ext Lun1      in                         CABD5239.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTCGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCATGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATAAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATAATCACCATAAAATGGAGCTTCTCATTTACAAAAATTAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTGTACACGAATAGTTCTCTATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATTCTTAAAAAAAAA
  3   1   2       ext Lun1      in                         CABD5239.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATAACTGAGGACGTCACATTCAGAGGCTATTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTCGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCATGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATAAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATAATCACCATAAAATGGAGCTTCTCATTTACAAAAATTAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTGTACACGAATAGTTCTCTATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAGA
  3   1   2       ext Ova1 5g3  in                        CABE13082.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTCGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCATGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATAAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATAATCACCATAAAATGGAGCTTCTCATTTACAAAAATTAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTGTACACGAATAGTTCTCTATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAANNTATAATTCTTACCTATAAAAAA
  5   1   2  SIG                                      Xt7.1-CABG4384.5                                                   TAACTAAAACCTAATTGCCATGGATCCGGTCTCTGTACTTCTGTCCGTTGTCATTTGTATTTTCCTATATAAAGTCTTCTATGGCGGGAAAGAAACATCCAAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGAGAAGTCTTCATCTAAAAAGTTTTCCATGATGAA------------------------------------------------------------------------------------------------------------CTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCAGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATTCTTACC
                                                  Xt7.1-CHK-1008281720                                                         AAACCTTATTGCCATGGATCCGGTCTCTGTACTTCTGTCTGTTGTCATTTGTATTTTCCTATATAAAGTCTTCTATGGCGGGAAAGAAACATCCAAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGAGAAGTCTTCATCTAAAAAGTTTTCCAT------------------------------------------------------------------------------------------------------------AGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCAGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATT
  5   1   2   12  ext Gas7 PIPE in                         XZG37671.5p ................CACGGATTGTACTTGCCCTTCCCTTCTGCAGGTGTAACTAAAACCTAATTGCCATGGATCCGGTCTCTGTACTTCTGTCCGTTGTTGTTTGTATTTTCCTATATAAAGTCTTCTATGGTGGGAAAGGAGCATCTCAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTTAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTTAAGAGACATTTACCANACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGA
  3  -1   3        nb Int1      in                         CAAP6903.3p                                       CTTCTGCAGGTATAACTAAAACCTTATTGCCATGGATCCGGTCTCTGTACTTCTGTCTGTTGTCATTTGTATTTTCCTATATAAAGTCTTCTATGGCGGGAAAGAAACATCCAAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCAAAAATTATCCAACTTTCTAAAGAGACATTTACCAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGA
  5   1   2   10  ext Ova1 5g3  in                         CABE6948.5p ..................................................TAACTAAAACCTTATTGCCATGGATCCGGTCTCTGTACTTCTGTCTGTTGTCATTTGTATTTTCCTATATAAAGTCTTCTATGGCGGGAAAGAAACATCCAAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCA
  5   1   4   10 seed Sto1 5g3  in                         CABG9119.5p .......................................................CGATTCAATTCGGCACGAGGCCGGTCTCTGTACTTCTGTCCGTTGTTGTTTGTATTTTCCTATATAAAGTCTTCTGTGGTGGGAAAGGAGCATCTCAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGGGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCANACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGAGAAGTCTTCATCTAAAAAGTTTTCCATGATGAAAA
  5   1   3   10   nb Int1 5g3  in                        CAAP12704.5p ............................................................CTAATTGCCATGGATCCGGTCTCTGTACTTCTGTCCGTTGTTGTTTGTATTTTCCTATATAAAGTCTTCTATGGTGGGAAAGGAGCATCTCAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAAATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTCAAGTCCCATGAAGGGAAGCCATTTGATAACACCTTGATACTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGACTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATAGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTAAATGACCAGAGGGATCTCATTGACGCATTCCTTGNNTCAGCAC
  5   1   2       add Int1      in                          CAAP488.5p                                                                            tggagatccaaattatggaaagatcccttatccggaatacccttggtccaatgcattgtggataacgggtcctataccagtatAATACATTTATTTCCAGGTGTATATAAAGCATTATTATTATTTAGATTATATGAATTCTTACCTTTATTGCTTCCTTTACAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAAATATCTAAAGGATATGGTAACTGGATTCAGTATGAATATATATTGTCAACATTCATTGGCAGAGGGGGCCAAGAAAGAACAAAGGAACTAGGCATTAATGTAGTCCCATTTCAGGTATGAGTAAAGGCATTCAGCAAATACTCACATCTAGTAAACAAGCTGAGGTCCAAATCCAGGAAAAGAGCTGGAATGGGTACTGCACAAAATCAGACCCGTGCTTAGGCAATGTGATTGGGAAATGCAAAAAGGTGCAGTGGCGCCAATGAGCAGTGGTGCTGGGTTGGCCATAGTGTTAAATTGCTTATTCTTTTCAAACAAAACAAAAACGGAGAAGGGGCGGACAGACCCCCGTAATAAAGAAGGTGGGGAGAGAG
  5   1   2       add Spl1      in                         CABK7947.5p                                                                            CCGGTCTCTGTACTTCTGTCCGTTGTTGTTTGTATTTTCCTATATAAAGTCTTCTGTGGTGGGAAAGGAGCATCTCAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGGGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAANCAGAGGAGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAANATTTTTGAAGTCTTTTAGGCGATTTATTTGCGCTGGAATGG
  5   1   2       add Int1      in                         CAAP2882.5p                                                                               GTCTCTGTACTTCTGTCCGTTGTTGTTTGTATTTTCCTATATAAAGTCTTCTATGGTGGGAAAGGAGCATCTCAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAAATATCTAAAGGATATGGTAACTGGATTCAGTATGAATATATATTGTCAACATTCATTGGCAGAGGGGGCCAAGAAAGAACAAAGGAACTAGGCATTAATGTAGTCCCATTTCAGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTCAAGTCCCATGAAGGGAAGCCATTTGATAACACCTTGATACTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGACTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATAGTCATGGTAAGCTGTTATGGGGTTCTTTCAACTTCCTTCCACATTTCTCTATTCCACtgatccctgacctgtggctcatgagcaacatgttgcatgccaccccctttcatgttgctc
  5   1   3        nb Sto1      in                         CABG3954.5p                                                                                 CTCTGTACTTCTGTCTGTTGTCATTTGTATTTTCCTATATAAAGTCTTCTATGGCGGGAAAGAAACATCCAAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCACAAG
  5   1   2       add Int1      in                        CAAP14749.5p                                                                                    TGTACTTCTGTCTGTTGTCATTTGTATTTTCCTATATAAAGTCTTCTATGGCGGGAAAGAAACATCCAAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGGTAGGAGTGTTGGGTAGCACGTGTTGAGGTCATGGGATGCCTGGCACAAAGGAATAATAGTTGAACGTGGGAAGGTATAGCAGAAACGGGCAGGCAAAGTAGGAAAGGGGAGCAAATTAGTATGGGGTGCCAGAAGAGAGAACCACCAATCAAGAGGTCAAGCAAATTTTGTTTGTAGATGGAAGTCAGGATAAGGCATATGGCTCANATGGTAATCACTTGAAATGCATACAGTGCAAACGGTAGTGTAACTGCTATTGGTTTGTGAATCTTCTTTATAATAATGGGATAGGATCAGTGGCAATTCCTGGAGTTTAAGTGCTGCAACGTTCTTGGACAAAAGTCATTTTGCATCTTCTTTCTTAAATACCCCAGCG
  3  -1   2       add Int1      in                        CAAP13838.3p                                                                                       ACTTCTGTCTGTTGTCATTTGTATTTTCCTATATAAAGTCTTCTATGGCGGGAAAGAAACATCCAAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTNCAGNNCACAGAGGAGAAGTCTTCATCTAANAAGTTTTTCCATGATGAANATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTC
  5   1   3        nb Int1      out                       CAAP14282.5p                                                                                        CTTCTGTCTGTTGTCATTTGTATTTTCCTATATAAAGTCTTCTATGGCGGGAAAGAAACATCCAAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGAGAAGTCTTCA
  5   1   3        nb Int1      in                         CAAP6637.5p                                                                                                       ATTTGTATTTTCCTATATAAAGTCTTCTATGGCGGGAAAGAAACATCCAAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGC
  5   1   2       add Ovi1      in                         CABI7806.5p                                                                                                                                                                                                                                                                                                                                                                                                                        TGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTCAAGTCCCATGAAGGGAAGCCATTTGATAACACCTTGATACTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGACTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATAGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTAAATGACCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGAGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGCTGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCGGCAGAACCTCGGCTCGAACACCGGANACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCT
  3  -1   2       add Kid1      in                         CABA2519.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGAGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCAGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCA
  5   1   2       add Fat1      in                         CABC9392.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGGCTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGTATTTATAAATTTATTGCTAAACCGGTTTTGGTCCAGTTAATTTAAACCTGTGAACTGGCAAGCCATTCCGAAGTTCTTCATGCCTTTTTCATCTAGGATGCAGACAATACTAACTTAGCTCTGCAATTTCAGGAGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCAGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAGTTACTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATA
  5   1   0       chi Liv1      in                         CAAR7306.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGTCTGTTTTTATTTTGATAAAAACGCTTTACACACATTTGAAAGTTTGTAGAGATGAGTGTGTATTTTCCATTTCGCTTAGCCGAAAAATTCGCAAAACGGTGAAAAATTTGTGGAATGCGGCTGCAACTCTTTTTGATGTGATCACGACTTTTTCCTCACCAAATTTTTGCCGCTGTGAATCTTTGCGGTAGTTTTGCAAAAAAATTCTGAATTTTGCAGTGAATCCATGCCTGGCGAAATATTTTGCCTACCACTACTCCAATCTCAATATAAGTTGTATTACACCTATTTTTGTTTTATCAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTA
  5   1   2       ext Sto1      in                         CABG6562.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGGAGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCAGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAGTTACTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTT
  3  -1   3        nb Sto1      in                         CABG1486.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCTATAGGGCGAGAGGGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCAGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGA
  5   1   2       ext Sto1      in                         CABG7644.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACGACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCAGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAGTTACTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTA
  3   1   3        nb Int1 5g3  in                        CAAP12704.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTNGATCGGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTCGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCATGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATAAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATAATCACCATAAAATGGAGCTTCTCATTTACAAAAATTAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTGTACACGAATAGTTCTCTATAGTTACCTG
  3   1   2       add Int1      in                        CAAP14749.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGACATCCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCAGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCNCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTG
  5   1   3        nb Liv1      in                         CAAR2058.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCTTTTACCTACTGAGAAGGGAAGGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATTCTTACCTATAAAAAAAAAAAAAAA
  5  -1   2       add Kid1      in                         CABA2519.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGG
  5   1   2       ext Sto1      in                         CABG4384.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATTCTTACCCTAAAAAAAAAAAAAAAA
  3   1   2       ext Sto1      in                         CABG7644.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAGTTACTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAGA
  3   1   2       add Spl1      in                         CABK7947.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAGTTACTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAATATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATANATTCTTAAAAAAAAGCCTCTT
  5  -1   3        nb Int1      in                         CAAP6903.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGA
  3   1   4      seed Sto1 5g3  in                         CABG9119.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCCGTTATTCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAGTTACTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGGAATATAATTCTTAG
  3   1   2       add Liv1      in                         CAAR7306.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAATTNTGCAGTGAATCCATGCCTGGCGAAATATTTTGCCTACCACTACTCCAATCTCAATATAAGTTGTATTACACCTATTTTTGTTTTATCAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAAGTNATAATTCTTACCTAAAAA
  5   1   3        nb Ova1      in                        CABE10146.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCGATTCAATTCGGCACGAGGCCACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATTCTTACCTAAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas7 PIPE in                         XZG37671.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGAGATTCAGAGATTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAGTTACTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTATAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAAT
  3   1   2       add Ovi1      in                         CABI7806.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAAAAGAAGTTGTGTCGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCATGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATAAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATAATCACCATAAAATGGAGCTTCTCATTTACAAAAATTAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTGTACACGAATAGTTCTCTATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGNAGAATATAATTCTTACCTAGAAAAAAA
  5   1   3        nb Sto1      in                        CABG12059.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAGTTACTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATTCTTACCTAAAAAAAAAAAAAAAAAA
  3   1   2       ext Sto1      in                         CABG4384.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACNCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATTCTTACCTAAAAAAAAAAAAAAAAGCCTTCGCCCTAAGTGAGTCG
  3   1   2       add Int1      in                         CAAP2882.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTGTCCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTCGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCATGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATAAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATAATCACCATAAAATGGAGCTTCTCATTTACAAAAATTAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTGTACACGAATAGTTCTCTATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATTCTTACCC
  3   1   2       add Fat1      in                         CABC9392.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAGTTACTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATTCTT
  3   1   3        nb Ova1      in                        CABE10146.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATTCTTACCT
  3   1   2       ext Ova1 5g3  in                         CABE6948.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAA
  3   1   2       ext Sto1      in                         CABG6562.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAGTTACTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATTCTTACCTAT
  5  -1   2       add Int1      in                        CAAP13838.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTAT
  3   1   3        nb Sto1      in                        CABG12059.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAGTTACTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATTCTTACCT
  3   1   3        nb Sto1      in                         CABG3954.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGGAGAATATAATTCTT
  3   1   3        nb Liv1      in                         CAAR2058.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCCTTCCAAAGGGAACCCAAGTGATCCNCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCTTTTACCTACTGAGAAGGGAAGGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGGAGAATATAATTCTTACCTAT
  5  -1   3        nb Sto1      in                         CABG1486.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATTCTTACCT
  3   1   3        nb Sto1      in                         CABG9657.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTTTGAGTCAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAG
  5   1   3        nb Sto1      in                         CABG9657.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTTTGAGTCAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATTCTTAAAAA
  3   1   2       add Int1      in                          CAAP488.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTCGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCATGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATAAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATAATCACCATAAAATGGAGCTTCTCATTTACAAAAATTAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTGTACACGAATAGTTCTCTATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGTAATATAATTCTTACCTATAAAG
  3   1   3        nb Int1      in                         CAAP6637.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATTCTTACCTAC
  5  -1   3        nb Int1      out                       CAAP11347.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACNGG
  5   1   2                                           Xt7.1-CABC4511.3                                                    AACTAAAACCTAATTGCCATGGATCCGGTCTCTGTACTTCTGTCCGTTGTTGTTTGTATTTTCCTATATAAAGTCTTCTATGGTGGGAAAGGAGCATCTCAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAAATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTCAAGTCCCATGAAGGGAAGCCATTTGATAACACCTTGATACTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGACTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATAGTCATGGTAAGCTGTTATGGGGTTCTTTCAACTTCCTTCCACATTTCTCTATTCCACTGATCCCTGACCTGTGGCTCATGAGCAACATGTTGCATGCCACCCCCTTTCATGTTGCTCTCCGTGGCCTCAACACTAATTTCAAAATTCCAGGAAAGTTTTCGAGGCACTAGTTTACTCCAAGAAGGGTCTCCTGCAGGCTAGCAGTCTACATGGGGCTAT------------------------------------------------------------------------------------ATGAAATATCCAGACATTCAAAAAAAAGTCCAGATGAAAATTGACAGAGTGATTGGATCGGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTCGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCATGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATAAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATAATCACCATAAAATGGAGCTTCTCATTTACAAAAATTAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTGTACACGAATAGTTCTCTATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATA
                                                  Xt7.1-CHK-1008281712                                                          AACCTAATTGCCATGGATCCGGTCTCTGTACTTCTGTCCGTTGTTGTTTGTATTTTCCTATATAAAGTCTTCTATGGTGGGAAAGGAGCATCTCAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAAATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTCAAGTCCCATGAAGGGAAGCCATTTGATAACACCTTGATACTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGACTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATAGTCATGGTAAGCTGTTATGGGGTTCTTTCAACTTCCTTCCACATTTCTCTATTCCACTGATCCCTGACCTGTGGCTCATGAGCAACATGTTGCATGCCACCCCCTTTCATGTTGCTCTCCGTGGCCTCAACACTAATTTCAAAATTCCAGGAAAGTTTTCGAGGCACTAGTTTACTCCAAGAAGGGTCTCCTGCAGGCTAGCAGTCTACATGG------------------------------------------------------------------------------------CTGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAGATGAAAATTGACAGAGTGATTGGATCGGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTCGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCATGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATAAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATAATCACCATAAAATGGAGCTTCTCATTTACAAAAATTAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTGTACACGAATAGTTCTCTATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATTC
  5   1   4      seed Int1 5g3  in                        CAAP12396.5p                                                    AACTAAAACCTAATTGCCATGGATCCGGTCTCTGTACTTCTGTCCGTTGTTGTTTGTATTTTCCTATATAAAGTCTTCTATGGTGGGAAAGGAGCATCTCAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAAATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTCAAGTCCCATGAAGGGAAGCCATTTGATAACACCTTGATACTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGACTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATAGTCATGGTAAGCTGTTATGGGGTTCTTTCAACTTCCTTCCACATTTCTCTATTccactgatccctgacctgtggctcatgagcaacatgttgcatgccaccccctttcatgttgctctccgtgggctcaaCACTAATTTTCAAATTCCAGGAAAG
  5   1   2       ext Fat1      in                         CABC4511.5p                                                      CTAAAACCTAATTGCCATGGATCCGGTCTCTGTACTTCTGTCCGTTGTTGTTTGTATTTTCCTATATAAAGTCTTCTATGGTGGGAAAGGAGCATCTCAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAAATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTCAAGTCCCATGAAGGGAAGCCATTTGATAACACCTTGATACTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGACTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATAGTCATGGTAAGCTGTTATGGGGTTCTTTCAACTTCCTTCCACATTTCTCTATTccactgatccctgacctgtggctcatgagcaacatgttgcatgccaccccctttcatgttgctctccgtggcctcaacactaatttcaaaattccaggaaagttttcgaggcactagtttactccaagaagggtctcctgcaggctagcagtctacatggggctatcaaat
  3   1   4      seed Int1 5g3  in                        CAAP12396.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCTGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAGATGAAAATTGACAGAGTGATTGGATCGGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTCGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCATGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATAAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATAATCACCATAAAATGGAGCTTCTCATTTACAAAAATTAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTGTACACGAATAGTTCTCGCCTCTCGCCCTA
  3   1   2       ext Fat1      in                         CABC4511.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTCGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCATGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATAAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATAATCACCATAAAATGGAGCTTCTCATTTACAAAAATTAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTGTACACGAATAGTTCTCTATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATTCTT
  5   1   2                                           Xt7.1-CABI5522.3                                                                                         CATCGATTCGTGTCATTTGTATTTTCCTATATAAAGTCTTCTATGGCGGGAAAGAAACATCCAAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGGTAGGAGTGTTGGGTAGCACGTGTTGAGGTCATGGGATGCCTGGCACAAAGGAATAATAGTTGAACGTGGGAAGGTATAGCAGAAACGGGCAGGCAAAGTAGGAAAGGGGAGCAAATTAGTATGGGGTGCCAGAAGAGAGAACCACCAATCAAGAGGTCAAGCAAATTTTGTTTGTAGATGGAAGTCAGGATAAGGCATATGGCTCAAATGGTAATCACTTGAAATGCATACAGTGCAAACGGTAGTGTAACTGCTATTGGTTTGTGAATCTTCTTTATAATAATGGGATAGGATCAGTGGCAATTCCTGGAGTTTAAGTGCTGCAACGTTCTTGGACAAAAGTCATTTTGCATCTTCTTTCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCNCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGGAATATAAT
                                                  Xt7.1-CHK-1008281724                                                                                               TTCGTGTCATTTGTATTTTCCTATATAAAGTCTTCTATGGCGGGAAAGAAACATCCAAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGGTAGGAGTGTTGGGTAGCACGTGTTGAGGTCATGGGATGCCTGGCACAAAGGAATAATAGTTGAACGTGGGAAGGTATAGCAGAAACGGGCAGGCAAAGTAGGAAAGGGGAGCAAATTAGTATGGGGTGCCAGAAGAGAGAACCACCAATCAAGAGGTCAAGCAAATTTTGTTTGTAGATGGAAGTCAGGATAAGGCATATGGCTCAAATGGTAATCACTTGAAATGCATACAGTGCAAACGGTAGTGTAACTGCTATTGGTTTGTGAATCTTCTTTATAATAATGGGATAGGATCAGTGGCAATTCCTGGAGTTTAAGTGCTGCAACGTTCTTGGACAAAAGTCATTTTGCATCTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCNCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGGAATATAATTCTTAC
  5   1   4      seed Ovi1      in                         CABI5522.5p                                                                                         CATCGATTCGTGTCATTTGTATTTTCCTATATAAAGTCTTCTATGGCGGGAAAGAAACATCCAAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGGTAGGAGTGTTGGGTAGCACGTGTTGAGGTCATGGGATGCCTGGCACAAAGGAATAATAGTTGAACGTGGGAAGGTATAGCAGAAACGGGCAGGCAAAGTAGGAAAGGGGAGCAAATTAGTATGGGGTGCCAGAAGAGAGAACCACCAATCAAGAGGTCAAGCAAATTTTGTTTGTAGATGGAAGTCAGGATAAGGCATATGGCTCAAATGGTAATCACTTGAAATGCATACAGTGCAAACGGTAGTGTAACTGCTATTGGTTTGTGAATCTTCTTTATAATAATGGGATAGGATCAGTGGCAATTCCTGGAGTTTAAGTGCTGCAACGTTCTTGGACAAAAGTCATTTTGCATCTTCTTTCT
  5   1   3        nb Int1      in                        CAAP10431.5p                                                                                           CTGTCTGTTGTCATTTGTATTTTCCTATATAAAGTCTTCTATGGCGGGAAAGAAACATCCAAGAACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGGTAGGAGTGTTGGGTAGCACGTGTTGAGGTCATGGGATGCCTGGCACAAAGGAATAATAGTTGAACGTGGGAAGGTATAGCAGAAACGGGCAGGCAAAGTAGGAAAGGGGAGCAAATTAGTATGGGGTGCCAGAAGAGAGAACCACCCAATCAGAGGTCAAGCAAATTTTGTTTGTAGATGGAAGTCAGGATAAGGCATATGGCTCANATGGTAATCACTTTGAATGCATACA
  3   1   4      seed Ovi1      in                         CABI5522.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCNCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGGAATATAATTCTTACCTAC
  3   1   3        nb Int1      in                        CAAP10431.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACATTTCCCTGACTCAAAAGGAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGGAATATAATTCTTACCTAT
  5   1   2  SIG                                     Xt7.1-CABG10279.3                                                                                                                                                          AACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGGGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGAGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCAGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGGAATATAATTCT
                                                  Xt7.1-CHK-1008281718                                                                                                                                                                CCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGGGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGAGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCAGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCxxTxTxTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGGAATATAATTCTTACCTA
  5   1   4      seed Lun1      in                        CABD13382.5p                                                                                                                                                          AACTTCCCTCCTGGGCCCAAACCATTACCCCTCATTGGGAATCTGCACATGATGAATATGAAGAAACCCCATCTAACATTTATGGAGTTCAGTAAGAAGTACGGCCCAGTATTCAGCATTCAGCTTGGGTTAAATAAGGCGATTGTGCTTTGTGGCGCGGATGCAGTGAAAGACGCTCTTATTAACCATGGCGATGAGTTTTCGGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGGGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGAGAAGTCTTCATCTAAAAAGTTTTTCTATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGAT
  5   1   3        nb Tad5      in                         XZT63422.5p                                                                                                                                                                                                                                                                                                                                                                  CGGACGCGTGGGCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGAGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCAGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTTCGATACTGAGGACGTCACATTCAGAGGCTATTTCCTTCAAAGG
  5   1   2       ext Sto1      in                        CABG10279.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGGCACGAGGGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCNGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGAGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCAGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCANAAGGAAATTTTGT
  3   1   2       ext Sto1      in                        CABG10279.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGGAATATAATTCTTACCTAT
  3   1   4      seed Lun1      in                        CABD13382.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAGTTACTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGGAGAATATANATTCTTACCTAT
  3   1   3        nb Tad5      in                         XZT63422.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTTTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGGAATATAATTCTTACCT
  5   1   2                                          Xt7.1-CAAP10313.3                                                                                                                                                                                  TTTTCTGCTTGTGTGGCTCCTCAATGCTTTTTCCATCTGATTTTGGCTTATGAGTAAAATAGGTTGGGGACCCCTGCTCTATTCTTTTGTATAGAATTTTTGGGATCTTTTGGTGCTACTGCACCTCAGTTCAGAAATACTAATCCTAATAATGCTGGCTGGACATCTTTCACTGGGTCTCCTTCCCATGCTAAGAATATCTGGCCAGGTTCTGGTTTTGTGTCCTCTTACCAGAAGGATTGAGTAAATAACTTTACTCAGCTATCTTCCTAATACACGTCTACGTGTACCAGGTAAATCTGCAAGGCCGATTTATTCTTCCATGTTCTCCAAGGTAAACAAACATGCAGAGAAATGCATTTATTAATTAACTGAACATTTTTTGCTGCATTATTTCTTGAAGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGTATTTATAAATTTATTGCTAAACCGGTTTTGGTCCAGTTAATTTAAACCTGTGAACTGGCAAGCCATTCCGAAGTTCTTCATGCCTTTTTCATCTAGGATGCAGACAATACTAACTTAGCTCTGCAATTTCAGGAGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCAGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTAT
                                                  Xt7.1-CHK-1008281708                                                                                                                                                                                        GCTTGTGTGGCTCCTCAATGCTTTTTCCATCTGATTTTGGCTTATGAGTAAAATAGGTTGGGGACCCCTGCTCTATTCTTTTGTATAGAATTTTTGGGATCTTTTGGTGCTACTGCACCTCAGTTCAGAAATACTAATCCTAATAATGCTGGCTGGACATCTTTCACTGGGTCTCCTTCCCATGCTAAGAATATCTGGCCAGGTTCTGGTTTTGTGTCCTCTTACCAGAAGGATTGAGTAAATAACTTTACTCAGCTATCTTCCTAATACACGTCTACGTGTACCAGGTAAATCTGCAAGGCCGATTTATTCTTCCATGTTCTCCAAGGTAAACAAACATGCAGAGAAATGCATTTATTAATTAACTGAACATTTTTTGCTGCATTATTTCTTGAAGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGTATTTATAAATTTATTGCTAAACCGGTTTTGGTCCAGTTAATTTAAACCTGTGAACTGGCAAGCCATTCCGAAGTTCTTCATGCCTTTTTCATCTAGGATGCAGACAATACTAACTTAGCTCTGCAATTTCAGGAGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCAGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATG
  3  -1   2       ext Int1      in                         CAAP6899.3p                                                                                                                                                                                  TTTTCTGCTTGTGTGGCTCCTCAATGCTTTTTCCATCTGATTTTGGCTTATGAGTAAAATAGGTTGGGGACCCCTGCTCTATTCTTTTGTATAGAATTTTTGGGATCTTTTGGTGCTACTGCACCTCAGTTCAGAAATACTAATCCTAATAATGCTGGCTGGACATCTTTCACTGGGTCTCCTTCCCATGCTAAGAATATCTGGCCAGGTTCTGGTTTTGTGTCCTCTTACCAGAAGGATTGAGTAAATAACTTTACTCAGCTATCTTCCTAATACACGTCTACGTGTACCAGGTAAATCTGCAAGGCCGATTTATTCTTCCATGTTCTCCAAGGTAAACAAACATGCAGAGAAATGCATTTATTAATTAACTGAACATTTTTTGCTGCATTATTTCTTGAAGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGTATTTATAAATTTATTGCTAAACCGGTTTTGGTCCAGTTAATTTAAACCTGTGAACTGGCAAGCCATTCCGAAGTTCTTCATGCCTTTTTCATCTAGGATGCAGACAATACTAACTTAGCTCTGCAATTTCAGGAGAAGTCTTCATCTAANAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAG
  5   1   4   10 seed Int1 5g3  in                        CAAP10313.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTTTGCTGCATTATTTCTTGAAGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCAAACGTAGGGATCAACTGGATGTGAATGATCAGAGGGATCTCATTGACGCATTCCTTGTCAAGCAACAAGAGGTATTTATAAATTTATTGCTAAACCGGTTTTGGTCCAGTTAATTTAAACCTGTGAACTGGCAAGCCATTCCGAAGTTCTTCATGCCTTTTTCATCTAGGATGCAGACAATACTAACTTAGCTCTGCAATTTCAGGAGAAGTCTTCATCTAAAAAGTTTTTCCATGATGAAAATTTGAAAGTTCTTTTAGGCGATTTATTTGCCGCTGGAATGGAGACGACTTCTACCACTCTTCGCTGGGGTATCCTGATGATGATGAAATATCCAGACATTCAAAAAAAAGTCCAAGATGAAATTGACAGAGTGATTGGATCAGCAGAACCTCGGCTCGAACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCT
  5  -1   2       ext Int1      in                         CAAP6899.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGT
  3   1   4      seed Int1 5g3  in                        CAAP10313.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCA
  5   1   2  SIG                                      Xt7.1-CAAP1282.3                                                                                                                                                                                                                                                                TCGCGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTAACTGGATTCAGTATGAATATATATTGTCAACATTCATTGGCAGAGGGGGCCAAGAAAGAACAAAGGAACTAGGCATTAATGTAGTCCCATTTCAGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGGTAAGCTGTTATGGGGTTCTTTCAACTTCCTTCCACATTCCCCATTTCTCTATTCCACTGACCTGTGGCTCATGAGCAACATGTTGCATGCCACCCCCTTTCATGTTGCTCTCCGTGGCCTCAACAGTAATTTTAAAATTCCAGGTTTGGAGCCAAGTTTTGGAGGCACTAGTTTACTCCAAGAAGGGTCTCCTGAAGGCTAGCAGTCTACATGGGGCTACCAAATAGCCAATCACAGTCCCCAATGAACTTTTTTTCATGCTTGTGTGGCTCCTCAATGCTTTTTCCATCTGATTTTGGCTTATGAGTAAAATAGGTTGGGGACCCCTGCTCTATTCTTTTGTATAGAATTTTTGGGATCTTTTGGTGCTACTGCACCTCAGTTCAGAAATACTAATCCTAATAATGCTGGCTGGACATCTTTCACTGGGTCTCCTTCCCATGCTAAGAATATCTGGCCAGGTTCTGGTTTTGTGTCCTCTTACCAGAAGGATTGAGTAAATAACTTTACTCAGCTATCTTCCTAATACACGTCTACGTGTACCAGGTAAATCTGCAAGGCCGATTTATTCTTCCATGTTCTCCAAGGTAAACAAACATGCAGAGAAATGCATTTATTAATTAACTGAACATTTTTTGCTGCATTATTTCTTGAAGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACATTTACCANACGTAGGGATCAACTGGATGTGAAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGGAGAATATAAT
                                                  Xt7.1-CHK-1008281714                                                                                                                                                                                                                                                                      GAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTAACTGGATTCAGTATGAATATATATTGTCAACATTCATTGGCAGAGGGGGCCAAGAAAGAACAAAGGAACTAGGCATTAATGTAGTCCCATTTCAGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGGTAAGCTGTTATGGGGTTCTTTCAACTTCCTTCCACATTCCCCATTTCTCTATTCCACTGACCTGTGGCTCATGAGCAACATGTTGCATGCCACCCCCTTTCATGTTGCTCTCCGTGGCCTCAACAGTAATTTTAAAATTCCAGGTTTGGAGCCAAGTTTTGGAGGCACTAGTTTACTCCAAGAAGGGTCTCCTGAAGGCTAGCAGTCTACATGGGGCTACCAAATAGCCAATCACAGTCCCCAATGAACTTTTTTTCATGCTTGTGTGGCTCCTCAATGCTTTTTCCATCTGATTTTGGCTTATGAGTAAAATAGGTTGGGGACCCCTGCTCTATTCTTTTGTATAGAATTTTTGGGATCTTTTGGTGCTACTGCACCTCAGTTCAGAAATACTAATCCTAATAATGCTGGCTGGACATCTTTCACTGGGTCTCCTTCCCATGCTAAGAATATCTGGCCAGGTTCTGGTTTTGTGTCCTCTTACCAGAAGGATTGAGTAAATAACTTTACTCAGCTATCTTCCTAATACACGTCTACGTGTACCAGGTAAATCTGCAAGGCCGATTTATTCTTCCATGTTCTCCAAGGTAAACAAACATGCAGAGAAATGCATTTATTAATTAACTGAACATTTTTTGCTGCATTATTTCTTGAAGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTNAAGAGACATTTACCANACGTAGGGATCAACTGGAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGGAGAATATAATTCTTAC
  3  -1   2       ext Int1      in                         CAAP8073.3p                                                                                                                                                                                                                                                                TCGCGGGAGGCCCAAAATTCCAGTCTTTGACCAGATATCTAAAGGATATGGTAACTGGATTCAGTATGAATATATATTGTCAACATTCATTGGCAGAGGGGGCCAAGAAAGAACAAAGGAACTAGGCATTAATGTAGTCCCATTTCAGGTGTTGTGTTTGCTGATGGGGAGAACTGGAAAGTGATGAGAAGATTCGCTCTTTCTACGCTAAGAGACTTTGGGATGGGGAGGAAAACTATAGAAGACACAATCGTTGAAGAAAGTGGCTGTTTGGTGGAAACGTTTAAGTCCCATGAAGCGAAGCCGTTTGATAACACCTTGATATTGAATGCGGCTGTAGCCAACATCATTGTGCACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGGTAAGCTGTTATGGGGTTCTTTCAACTTCCTTCCACATTCCCCATTTCTCTATTCCACTGacctgtggctcatgagcaacatgttgcatgccaccccctttcatgttgctctccgtggcctcaacagtaattttaaaattccaggtttggagccaagttttggaggcactagtttactccaagaagggtctcctgaaggctagcagtctacatggggctaccaaatagccaatcacagTCCCCAATGAACTTTTTTTCATGCTTGTGTGGCTCCTCAATGCTTTTTCCATCTGATTTTGGCTTATGAGTAAAATAGGTTGGGGGACCCCTGCTCTATTCTTTTGTATAGAATTTTTGGGATCTTTTGGTGCTACTG
  5   1   2       ext Sto1 5g3  in                         CABG5646.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACATACTGCTCAACCACCGCTTTGAGTATCAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGGTAAGCTGTTATGGGGTTCTTTCAACTTCCTTCCACATTCCCCATTTCTCTATTCCACTGacctgtggctcatgagcaacatgttgcatgccaccccctttcatgttgctctccgtggcctcaacagtaattttaaaattccaggtttggagccaagttttggaggcactagtttactccaagaagggtctcctgaaggctagcagtctacatggggctaccaaatagccaatcacagTCCCCAATGAACTTTTTTTCATGCTTGTGTGGCTCCTCAATGCTTTTTCCATCTGATTTTGGCTTATGAGTAAAATAGGTTGGGGACCCCTGCTCTATTCTTTTGTATAGAATTTTTGGGATCTTTTGGTGCTACTGCACCTCAGTTCAGAAATACTAATCCTAATAATGCTGGCTGGACATCTTTCACTGGGTCTCCTTCCCATGCTAAGAATATCTGGCCAGGTTCTGGTTTTGTGTCCTCTTACCAGAAGGATTGAGTAAATAACTTTACTCAGCTATCTTCCTAATACACGTCTACGTGTACCAGGTAAATCTGCAAGGCCGATTTATTCTTCCATGTTCTCCAAGGTAAACAAACATGCAGAGAAATGCATTTATTAATTAACTGAACATTTTTTGCTGCATTATTTCTTGAAGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGGAGTCACAAAACTGTTTT
  5   1   2       ext Int1 5g3  in                         CAAP7041.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGGATCCAACGCTGATCAAACTTATAAAAAGTGTCAGTGAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGGTAAGCTGTTATGGGGTTCTTTCAACTTCCTTCCACATTCCCCATTTCTCTATTCCACTGacctgtggctcatgagcaacatgttgcatgccaccccctttcatgttgctctccgtggcctcaacagtaattttaaaattccaggtttggagccaagttttggaggcactagtttactccaagaagggtctcctgaaggctagcagtctacatggggctaccaaatagccaatcacagTCCCCAATGAACTTTTTTTCATGCTTGTGTGGCTCCTCAATGCTTTTTCCATCTGATTTTGGCTTATGAGTAAAATAGGTTGGGGACCCCTGCTCTATTCTTTTGTATAGAATTTTTGGGATCTTTTGGTGCTACTGCACCTCAGTTCAGAAATACTAATCCTAATAATGCTGGCTGGACATCTTTCACTGGGTCTCCTTCCCATGCTAAGAATATCTGGCCAGGTTCTGGTTTTGTGTCCTCTTACCAGAAGGATTGAGTAAATAACTTTACTCAGCTATCTTCCTAATACACGTCTACGTGTACCAGGTAAATCTGCAAGGCCGATTTATTCTTCCATGTTCTCCAAGGTAAACAAACATGCAGAGAAATGCATTTATTAATTAACTGAACATTTTTTGCTGCATTATTTCTTGAAGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGNGAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTAAAGAGACA
  5   1   4      seed Int1 5g3  in                         CAAP1282.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGAATGTCAAGATTGCTGGAAGTCCTATCGTCATGGTAAGCTGTTATGGGGTTCTTTCAACTTCCTTCCACATTCCCCATTTCTCTATTCCACTGacctgtggctcatgagcaacatgttgcatgccaccccctttcatgttgctctccgtggcctcaacagtaattttaaaattccaggtttggagccaagttttggaggcactagtttactccaagaagggtctcctgaaggctagcagtctacatggggctaccaaatagccaatcacagTCCCCAATGAACTTTTTTTCATGCTTGTGTGGCTCCTCAATGCTTTTTCCATCTGATTTTGGCTTATGAGTAAAATAGGTTGGGGACCCCTGCTCTATTCTTTTGTATAGAATTTTTGGGATCTTTTGGTGCTACTGCACCTCAGTTCAGAAATACTAATCCTAATAATGCTGGCTGGACATCTTTCACTGGGTCTCCTTCCCATGCTAAGAATATCTGGCCAGGTTCTGGTTTTGTGTCCTCTTACCAGAAGGATTGAGTAAATAACTTTACTCAGCTATCTTCCTAATACACGTCTACGTGTACCAGGTAAATCTGCAAGGCCGATTTATTCTTCCATGTTCTCCAAGGTAAACAAACATGCAGAGAAATGCATTTATTAATTAACTGAACATTTTTTGCTGCATTATTTCTTGAAGCTGTATAACACATATCCGTCTATTATGGGATGGATTCCTGGAAGTCACAAAACTGTTTTCGAAAACTTCCAAAAATTATCCAACTTTCTTNAAGAGACATTTACCANACGTAGGGATCAACTGGATGTGAATGATC
  3   1   4      seed Int1 5g3  in                         CAAP1282.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACACCGGAAACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTCCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGAGAATATAATTCTAAAAAAA
  3   1   2       ext Int1 5g3  in                         CAAP7041.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACAAATACCCTATACCGATGCCGTTATCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATTCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCA
  5  -1   2       ext Int1      in                         CAAP8073.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCATGAGATTCAGAGATTTGCCAACCTCGTGCCTATTGTCCTTCCCCATCCGATAACTGAGGACGTCACATTCAGAGGCTATTTCCTTCCAAAGGGAACCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAACTTCTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGA
  3   1   2       ext Sto1 5g3  in                         CABG5646.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCAAGTGATCCCCCTGCTGATTTCTGTTATGCAAGATAAAGATTATTTCCAAAAACCAGAAGAATTTTACCCGGAACATTTCCTTGACTCAAAAGGAAATTTTGTGAAAAATGAGGCCTTCCTTCCCTTCTCAGTAGGTAAAAGAAGTTGTGTTGGAGAGACGTTGGCCAAGATGGAACTCTTCTTGTTCTTCACAAAGTTACTGCAGAACTTCACATTCCAACCCCCTCCTGGAGTTGAGGTCCAACTGACCTGTGGAGATGCACTCACATCCATACCTTTAGACCATCAGATCTGTGCATTGCCTCGCAGCTAGACAAACTCTACACATCATCACCATAAAATGGAGCTTCTCATTTACAAAAATCAAACATAGAAAGCTATAAACAGTCTTAAGAAACCAAAACCTTTATTTACTTGTAATTTTAGCTATTTCTTGAAGTCCTGGTCAGTGTCCGCACTCTTCAAAACCCCACCCCTTTTCACAGATCAAGACTTTTCAGCCTGAGTGAAGAAAGCCCTTGTTATTCCTCAGTTTCTCTGCTTTATAGAACATTTTGGGACAAATACGCCTTCCCTATTCCAATTACACTCCCACATCTTATGGTGAAGCCATGAAACCATTCTACTCTACACGAAGAACCATAGTTACCTGTAAACTGTATTTGTAATGATGAATTATGTGCAGAACGGCCTATATTAATTTGATATTTATATATTAAAAAGGAGAATATAATTCTTACCTAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)