Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xt7.1-EC2BBA13BC10.5.5                    101 END     1           1        1                CD2-associated protein [Xenopus tropicalis]
     2   2.0    0Xt7.1-CBSU1136.3                           46 END     1           1        2                LOC446962 protein [Xenopus laevis]
     3   2.0    0Xt7.1-CABC7861.3                           15 END     1           1        6                PREDICTED: similar to keratin Kb40 [Mus musculus]

 This cluster: approximate FL confidence score = 99%

 1012154332 Xt7.1-CABI6512.3.5 - 63 ESTs
                                                                       .....-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810......4820......4830......4840......4850......4860......4870....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABI6512.3.5                                                                                                                    AAAAGAGCCGGAGAGAGGGATCGGCCTGTGATTGGCCGAGGAGGGTCACATGGCTTAGCTGGGCTCCGAGTTGGCGTACGCGGTTGTGTAGCCCGGTGCTCGGGTGCTAGGGAACTGGGCAGAGAGGGTGAGAGGTTACCGCCGAGGGCTGGACAGGGTTGGAGAGTTGTCTGGCATTTGGATGGGCGTAGGCTGCCGGCGGGGAGAGACGGAGCCCGGGAAGCCAGAGGCCGGAGAGTGACAGCCCCCCTTGCCGGGGTGGAAGAGATCCGGGCAGCATGGTGGAATACATTGTGGAATATGACTACGATGCTGTAAATGAGGACGAGTTGACGATACGAGTAGGAGACGTCATCAAGAACGTTAACAAGCTGGAAGAGGATGGCTGGCTGGAGGGTGAAGTCAATGGTAAAAGAGGCGCCTTCCCTGATAATTTTGTAAAGGAAGTAAAAAAAGATCCAGAACCAAAAGAAGAGAATGTATCAAATAAAAGGGAGAAATCTGGAAATGTTGCCAGCCTGGTGCAGCGGATGAGCGTGTATGGAATCCCTGGGATGGGGCCTCCACCGCAGCCCAAATCCATCAAAAAAAAATCCAAAAAGCGCCAGTGCAAGGTCCTGTATGAGTACATCCCGCAGAACGAAGATGAACTGGAGCTGAAAGTGGGGGAAGTCCTGGATATCATTGAGGAGGTAGAAGAAGGCTGGTGGAGTGGAAGCAACAGCGGCAAATCCGGCCTCTTTCCTTCCAACTTTGTAAAAGAAATTGATCTGTCGGACGATGGAGAGAGTCAGGAGAGCACTGAAGATTCAGAGCCATCTGTCACAACTCCTATAGCAACGCCGGCCTCCCCTGTACTGTCCCCAGCGAATGGACCTGATGCCTCCCCATTAGCCACGGCACAGCCAAAGAAGGTCATGGGAGTCGGCTTTGGGGACATTTTCAAAGAAGGCTCTGTGAAACTCAAGACTAGACTGCCAGCTCCTGAGCCAGAAGTGAAAAAGCCCGAAAAGCCATTACCAGTTCAGCCATCAGGTACCAAGGTTCTGCGCTCAACAAGCTCTGATGCTTCAAGAACAGAGACGGACAGTAAACCCAAAGCCAAGGAGATCTGCAAGGCGCTGTTTAACTATGAGTCTGTGAACGAGGATGAACTTTCATTTAAGGAAGGAGATATTATTCACCTGACTAGTAAAGAGACTGGTGACCCAGGCTGGTGGAAAGGAGAACTGAATGGCAAGGAAGGAGTTTTCCCCGACAACTTTGTTGCAATAATACAAGATTCTGAAAAAGAGAAGCCAAAGAAGCCACCACCTCCTATTAAAAGCCCAGCACCAAAGCCAGAACTTCGCATTGCAGAGAAAAAGTCAACTCCAACGAAGACAGAAGAGAAAGATGAAAAGCCATTGGTGGACCTCAAGCCCCCCAAACCTGCAGCTCCTCAGGTACCTCCGAAGAAACCAAATCTTACAAGCAAGAGTAATAGTATCCTAAAACCCGCGGTAATCCCGCCCAAGCGTCCGGAAAAGCCAGCGTTTGCCTCACCAACCTCCAAGCCTAATGGGGATTTACTGCTAAATCGCGCTAAGCCAGAATCAGAGACTTTTAATAAAGCAAAGACAGAGCCGGACCCACAGGTTCCAAGTCGACCAAAACCAGCAGAAGCAGAACCACATAATAAAACAAAAACTGACCTCGAGCAGATTCTAAGCCGACCCAAATCAGAAGTGGAACCGCATAATAAAACAAAAACTGATCTGGAGCAGATTCTGAACAGGCCAAAGTCAGAGGCAGAACCTCTTAATAAAACAAAGATGGATCTAGAGCAGATCCTGAGCAGACCAAAATCCAACGGGGAACATCATAACAAAACAAAGATGGACCTGGAACATATTCTGAGCAGACCAAAGTCAGTGGAAGTAGAGCCAGCGGCTAAAAGTCCCAGAGATGAGGTGGACTTTTTTGGTGATGTGATACCTACCTCAAACCATTTATCCCACCCGACTGCAAGCAGGCCAAAGATGCAAGGGAAGAGACCGCCCGGTCGATTTAATGGTTCCACTGCTCAAAGCAAAGATGTAACAGATTCTGTCAAAGTGCTTAAAGAAGAGGAGGAGGAAAGTGCCAAAGTAAAGACTCCTGAAGTAAAGAAGCCATTGGTTTCCAGCCCTGGTCCATTTGCACTCTCGGTTTCACCCCTTGTGCCACTCCCTGTGTCAAAACCAGCCCCCAGCCCTCAGGTCCCATTACCTGCTGAGGTGAAAGTGAAATCAGATGTGACTGACAGTAAGAAGAGCGAAAAGAGTGAAATGGAAGAACTTAAAGCCCAAATCGGGGAACTGCTCAGCATCGTGGATGCACTTAGGAAAGAACATAGGAAAGAGATGGATCACCTAAAGAAAGAGCTGGAAGAGGAGCGATTGTTACGGACCAGTTTAGAGACTGAGGTTGACAAGCTGAAGAAGGCAGTCCAGTTAACATGAGGCGGCCATTTTGTTAATGGCACCAGTCCAGATTAAAGTCCACGTCAGATATTTAATGCTGTCTCCTCTTTTCCTCGAGTTCATGGAAGCATGGTCCAACGATCCTCTGGCGCTTTCCTCTCGTTGCTTTGCCAATGGAATTAAAGAGGCCTTATCTCCTTACTGTGCTGGAGTGGCAGACCCTCGGACAACGGTTTGCTTCAAGATACTACTGAGTTTATGTACAAAGCGGGGATTCTGTACGAATTTTATTGAAAACTTATGTAATTTTTTTTTTTTTTTTTAAAATGCTCTGAATACGTATATATATATCTATCTTTAGATACTGTAATATAGCCTAACGGGGGGATACGATAGCCTTAGATTAATAACCACTCGTCACGGGAAGCAAAAACGATCATGTTCTTTTGTATATTTTAGACTTCTTATCCAGGGTTACACACTGCTGTGCCTGTCTGCGGCCCAAGTATTAATTGCATTGTGTATAATTAGATTTCTATCGGCCGGTTGTTGATACTGTATGTAGGAGGCAATTCCCCTACGCATATAAGCGAGAAGAATGCTACTTTGTGTTTTTAATGGAGAGCTTGTTACGTCACTTTGCACAAGGAGAACTTCAAGGGATTTGGGTCATTGTACTGGAGCTTTGCACTTACACTGGAATAGGGAGCAGCTTGGAGGGGGGTACTCCTTTCTTATAACACCACCTATTTTGGGGGGGACCAACAGACTCCAAAAGGGGGACGGGGACTTCCTTGGGGCATTGGTGGAATTAGGGAACAGCCTAAGCAGATCAGAGGTGTAATATTTCCTATATTTATGGGCGTATTAATGTGCATTGGGTACCAAGAGTAGGGGAGGGGTCTTCTTAGCTTGAAAATGTCCCTTTGTAAAGGGCCGACTCTTAGCATTCAGCTCTCAAGGAATGCTGGGAGTTTTATTTTTTTTAACTGGATTTAGGGGTGTTGGCCTTAATACCCTGGGACCCTTCTTCCTGACATTGGACCCAGAAGCAAAATCATTTTCAGTGAGTTCCTTTCTATTTAAATTCCTGTACAGGTCGACGAACGCTAGATTTTTAGCAGGATGGTGCCCTTTTATAGGCAAGTAAACCTTGCGCCACCATATGTTCTATACTCTTTTATTTCTATAGCTTAAAAGATATTGGCTTCTGAACCCTTCCCCCAGTCGTACCTTGCTGATCATCAGTGTCCCAGTGAGCCGCTGTAATGTGGCCAATACTAATGAAACTGGGGGCCCTCCTTCTAAGAAACTTGTAGTGCAAACGGGAAGACAGAATAAAGTTATCTGATGAAAGTGTACTACTTTATCCAGTTACCACTTACCAACCAATCCCTTGCTGCGAAAGGAGAAGTATCATCTGTTATAACATGATCTTTATCAGAGAGATTTCCTTATTGGTTAAAATGAGGCTCAGGGTTTGAAGATCACTTGCAGTACCTTTTTCCACCAGTGCTGGCAGTGTTTCCAACAGAACTGTGCCTCGACTATAGACAAGCTGCAACCCTTGTACAAAGCACCTCCCAGATGTTCTAGACCCTTTTTACTAAACAGAGTAAAGCCATACAGAGAGAAATGGTACCTCCCTTTTATATATATATTTTTTATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTATGGGGAGGGGGGATTTCTAGCCATAAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCAGTTAATAAAATGATTGAATTTTCAAAAAAAAAA
                                                  Xt7.1-CHK-1008265085                                                                                                                          GCCGGAGAGAGGGATCGGCCTGTGATTGGCCGAGGAGGGTCACATGGCTTAGCTGGGCTCCGAGTTGGCGTACGCGGTTGTGTAGCCCGGTGCTCGGGTGCTAGGGAACTGGGCAGAGAGGGTGAGAGGTTACCGCCGAGGGCTGGACAGGGTTGGAGAGTTGTCTGGCATTTGGATGGGCGTAGGCTGCCGGCGGGGAGAGACGGAGCCCGGGAAGCCAGAGGCCGGAGAGTGACAGCCCCCCTTGCCGGGGTGGAAGAGATCCGGGCAGCATGGTGGAATACATTGTGGAATATGACTACGATGCTGTAAATGAGGACGAGTTGACGATACGAGTAGGAGACGTCATCAAGAACGTTAACAAGCTGGAAGAGGATGGCTGGCTGGAGGGTGAAGTCAATGGTAAAAGAGGCGCCTTCCCTGATAATTTTGTAAAGGAAGTAAAAAAAGATCCAGAACCAAAAGAAGAGAATGTATCAAATAAAAGGGAGAAATCTGGAAATGTTGCCAGCCTGGTGCAGCGGATGAGCGTGTATGGAATCCCTGGGATGGGGCCTCCACCGCAGCCCAAATCCATCAAAAAAAAATCCAAAAAGCGCCAGTGCAAGGTCCTGTATGAGTACATCCCGCAGAACGAAGATGAACTGGAGCTGAAAGTGGGGGAAGTCCTGGATATCATTGAGGAGGTAGAAGAAGGCTGGTGGAGTGGAAGCAACAGCGGCAAATCCGGCCTCTTTCCTTCCAACTTTGTAAAAGAAATTGATCTGTCGGACGATGGAGAGAGTCAGGAGAGCACTGAAGATTCAGAGCCATCTGTCACAACTCCTATAGCAACGCCGGCCTCCCCTGTACTGTCCCCAGCGAATGGACCTGATGCCTCCCCATTAGCCACGGCACAGCCAAAGAAGGTCATGGGAGTCGGCTTTGGGGACATTTTCAAAGAAGGCTCTGTGAAACTCAAGACTAGACTGCCAGCTCCTGAGCCAGAAGTGAAAAAGCCCGAAAAGCCATTACCAGTTCAGCCATCAGGTACCAAGGTTCTGCGCTCAACAAGCTCTGATGCTTCAAGAACAGAGACGGACAGTAAACCCAAAGCCAAGGAGATCTGCAAGGCGCTGTTTAACTATGAGTCTGTGAACGAGGATGAACTTTCATTTAAGGAAGGAGATATTATTCACCTGACTAGTAAAGAGACTGGTGACCCAGGCTGGTGGAAAGGAGAACTGAATGGCAAGGAAGGAGTTTTCCCCGACAACTTTGTTGCAATAATACAAGATTCTGAAAAAGAGAAGCCAAAGAAGCCACCACCTCCTATTAAAAGCCCAGCACCAAAGCCAGAACTTCGCATTGCAGAGAAAAAGTCAACTCCAACGAAGACAGAAGAGAAAGATGAAAAGCCATTGGTGGACCTCAAGCCCCCCAAACCTGCAGCTCCTCAGGTACCTCCGAAGAAACCAAATCTTACAAGCAAGAGTAATAGTATCCTAAAACCCGCGGTAATCCCGCCCAAGCGTCCGGAAAAGCCAGCGTTTGCCTCACCAACCTCCAAGCCTAATGGGGATTTACTGCTAAATCGCGCTAAGCCAGAATCAGAGACTTTTAATAAAGCAAAGACAGAGCCGGACCCACAGGTTCCAAGTCGACCAAAACCAGCAGAAGCAGAACCACATAATAAAACAAAAACTGACCTCGAGCAGATTCTAAGCCGACCCAAATCAGAAGTGGAACCGCATAATAAAACAAAAACTGATCTGGAGCAGATTCTGAACAGGCCAAAGTCAGAGGCAGAACCTCTTAATAAAACAAAGATGGATCTAGAGCAGATCCTGAGCAGACCAAAATCCAACGGGGAACATCATAACAAAACAAAGATGGACCTGGAACATATTCTGAGCAGACCAAAGTCAGTGGAAGTAGAGCCAGCGGCTAAAAGTCCCAGAGATGAGGTGGACTTTTTTGGTGATGTGATACCTACCTCAAACCATTTATCCCACCCGACTGCAAGCAGGCCAAAGATGCAAGGGAAGAGACCGCCCGGTCGATTTAATGGTTCCACTGCTCAAAGCAAAGATGTAACAGATTCTGTCAAAGTGCTTAAAGAAGAGGAGGAGGAAAGTGCCAAAGTAAAGACTCCTGAAGTAAAGAAGCCATTGGTTTCCAGCCCTGGTCCATTTGCACTCTCGGTTTCACCCCTTGTGCCACTCCCTGTGTCAAAACCAGCCCCCAGCCCTCAGGTCCCATTACCTGCTGAGGTGAAAGTGAAATCAGATGTGACTGACAGTAAGAAGAGCGAAAAGAGTGAAATGGAAGAACTTAAAGCCCAAATCGGGGAACTGCTCAGCATCGTGGATGCACTTAGGAAAGAACATAGGAAAGAGATGGATCACCTAAAGAAAGAGCTGGAAGAGGAGCGATTGTTACGGACCAGTTTAGAGACTGAGGTTGACAAGCTGAAGAAGGCAGTCCAGTTAACATGAGGCGGCCATTTTGTTAATGGCACCAGTCCAGATTAAAGTCCACGTCAGATATTTAATGCTGTCTCCTCTTTTCCTCGAGTTCATGGAAGCATGGTCCAACGATCCTCTGGCGCTTTCCTCTCGTTGCTTTGCCAATGGAATTAAAGAGGCCTTATCTCCTTACTGTGCTGGAGTGGCAGACCCTCGGACAACGGTTTGCTTCAAGATACTACTGAGTTTATGTACAAAGCGGGGATTCTGTACGAATTTTATTGAAAACTTATGTAATTTTTTTTTTTTTTTTTAAAATGCTCTGAATACGxxxATATATATATATCTTTAGATAxxxTxxTATAGCCTAACGGGGGGATACGATAGCCTTAGATTAATAACCACTCGTCACGGGAAGCAAAAACGATCATGTTCTTTTGTATATTTTAGACTTCTTATCCAGGGTTACACACTGCTGTGCCTGTCTGCGGCCCAAGTATTAATTGCATTGTGTATAATTAGATTTCTATCGGCCGGTTGTTGATACTGTATGTAGGAGGCAATTCCCCTACGCATATAAGCGAGAAGAATGCTACTTTGTGTTTTTAATGGAGAGCTTGTTACGTCACTTTGCACAAGGAGAACTTCAAGGGATTTGGGTCATTGTACTGGAGCTTTGCACTTACACTGGAATAGGGAGCAGCTTGGAGGGGGGTACTCCTTTCTTATAACACCACCTATTTTGGGGGGGACCAACAGACTCCAAAAGGGGGACGGGGACTTCCTTGGGGCATTGGTGGAATTAGGGAACAGCCTAAGCAGATCAGAGGTGTAATATTTCCTATATTTATGGGCGTATTAATGTGCATTGGGTACCAAGAGTAGGGGAGGGGTCTTCTTAGCTTGAAAATGTCCCTTTGTAAAGGGCCGACTCTTAGCATTCAGCTCTCAAGGAATGCTGGGAGTTTTATTTTTTTTAACTGGATTTAGGGGTGTTGGCCTTAATACCCTGGGACCCTTCTTCCTGACATTGGACCCAGAAGCAAAATCATTTTCAGTGAGTTCCTTTCTATTTAAATTCCTGTACAGGTCGACGAACGCTAGATTTTTAGCAGGATGGTGCCCTTTTATAGGCAAGTAAACCTTGCGCCACCATATGTTCTATACTCTTTTATTTCTATAGCTTAAAAGATATTGGCTTCTGAACCCTTCCCCCAGTCGTACCTTGCTGATCATCAGTGTCCCAGCGAGCCGCTGTAATGTGGCCAATACTAATGAAACTGGGGGCCCTCCTTCTAAGAAACTTGTAGTGCAAACGGGAAGACAGAATAAAGTTATCTGATGAAAGTGTACTACTTTATCCAGTTACCACTTACCAACCAATCCCTTGCTGCGAAAGGAGAAGTATCATCTGTTATAACATGATCTTTATCAGAGAGATTTCCTTATTGGTTAAAATGAGGCTCAGGGTTTGAAGATCACTTGCAGTACCTTTTTCCACCAGTGCTGGCAGTGTTTCCAACAGAACTGTGCCTCGACTATAGACAAGCTGCAACCCTTGTACAAAGCACCTCCCAGATGTTCTAGACCCTTTTTACTAAACAGAGTAAAGCCATACAGAGAGAAATGGTACCTCCCTTTTATATATATATTTTTTATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTATGGGGAGGGGGGATTTCTAGCCATAAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCAGTTAATAAAATGATTGAATTTTCAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                         2     2     4     4     4     4     5     5     5     5     5     5     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    11    12    11    12    12    13    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     7     8     7     8     6     8     7     9     7     8     7     8     7     8     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     6     6     6     7     7     7     7     7     7     7     7     5     5     5     5     5     5     5     5     5     5     7     7     9     9     9     9     8     8     8     8     8     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     3     4     4     5     4     5     4     5     4     5     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     1     3     1     3     2     3     1     3     2     4     2     4     2     4     3     5     3     5     4     6     4     6     4     6     4     6     4     6     5     7     5     7     6     7     6     7     6     7     6     7     6     7     7     8     7     8     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     5     6     5     6     5     7     5     7     5     7     6     7     6     7     6     6     6     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     7     8     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     5     6     6     6     6     6     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     7     7     7     7     6     7     5     6     5     6     5     6     5     6     4     6     4     6     4     6     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     6     8     8    10     8    11    10    13    10    13    10    14    10    14    10    13    10    14    11    15    11    15    12    15    16    18    17    19    18    20    18    20    20    22    21    23    22    23    21    22    22    22    23    23    23    24    24    24    24    24    23    23    23    23    22    23    23    23    23    23    24    24    24    24    24    24    24    24    24    24    24    24    24    24    26    26    26    26    26    26    25    25    24    24    24    24    24    24    22    24    24    24    24    24    24    24    24    24    24    24    24    24    24    25    22    25    16    26    15    25    15    25    15    25    15    24    15    24    15    24    15    24    13    24    13    24    13    24    13    24    13    24    13    24    12    24    10    23    10    22    10    21     9    21     7    20     4     8
  5   1   2      ests                                 Xt7.1-CAAN8788.5                                                                                                                    AAAAGAGCCGGAGAGAGGGATCGGCCTGTGATTGGCCGAGGAGGGTCACATGGCTTAGCTGGGCTCCGAGTTGGCGTACGCGGTTGTGTAGCCCGGTGCTCGGGTGCTAGGGAACTGGGCAGAGAGGGTGAGAGGTTACCGCCGAGGGCTGGACAGGGTTGGAGAGTTGTCTGGCATTTGGATGGGCGTAGGCTGCCGGCGGGGAGAGACGGAGCCCGGGAAGCCAGAGGCCGGAGAGTGACAGCCCCCCTTGCCGGGGTGGAAGAGATCCGGGCAGCATGGTGGAATACATTGTGGAATATGACTACGATGCTGTAAATGAGGACGAGTTGACGATACGAGTAGGAGACGTCATCAAGAACGTTAACAAGCTGGAAGAGGATGGCTGGCTGGAGGGTGAAGTCAATGGTAAAAGAGGCGCCTTCCCTGATAATTTTGTAAAGGAAGTAAAAAAAGATCCAGAACCAAAAGAAGAGAATGTATCAAATAAAAGGGAGAAATCTGGAAATGTTGCCAGCCTGGTGCAGCGGATGAGCGTGTATGGAATCCCTGGGATGGGGCCTCCACCGCAGCCCAAATCCATCAAAAAAAAATCCAAAAAGCGCCAGTGCAAGGTCCTGTATGAGTACATCCCGCAGAACGAAGATGAACTGGAGCTGAAAGTGGGGGAAGTCCTGGATATCATTGAGGAGGTAGAAGAAGGCTGGTGGAGTGGAAGCAACAGCGGCAAATCCGGCCTCTTTCCTTCCAACTTTGTAAAAGAAATTGATCTGTCGGACGATGGAGAGAGTCAGGAGAGCACTGAAGATTCAGAGCCATCTGTCACAACTCCTATAGCAACGCCGGCCTCCCCTGTACTGTCCCCAGCGAATGGACCTGATGCCTCCCCATTAGCCACGGCACAGCCAAAGAAGGTCATGGGAGTCGGCTTTGGGGACATTTTCAAAGAAGGCTCTGTGAAACTCAAGACTAGACTGCCAGCTCCTGAGCCAGAAGTGAAAAAGCCCGAAAAGCCATTACCAGTTCAGCCATCAGGTACCAAGGTTCTGCGCTCAACAAGCTCTGATGCTTCAAGAACAGAGACGGACAGTAAACCCAAAGCCAAGGAGATCTGCAAGGCGCTGTTTAACTATGAGTCTGTGAACGAGGATGAACTTTCATTTAAGGAAGGAGATATTATTCACCTGACTAGTAAAGAGACTGGTGACCCAGGCTGGTGGAAAGGAGAACTGAATGGCAAGGAAGGAGTTTTCCCCGACAACTTTGTTGCAATAATACAAGATTCTGAAAAAGAGAAGCCAAAGAAGCCACCACCTCCTATTAAAAGCCCAGCACCAAAGCCAGAACTTCGCATTGCAGAGAAAAAGTCAACTCCAACGAAGACAGAAGAGAAAGATGAAAAGCCATTGGTGGACCTCAAGCCCCCCAAACCTGCAGCTCCTCAGGTACCTCCGAAGAAACCAAATCTTACAAGCAAGAGTAATAGTATCCTAAAACCCGCGGTAATCCCGCCCAAGCGTCCGGAAAAGCCAGCGTTTGCCTCACCAACCTCCAAGCCTAATGGGGATTTACTGCTAAATCGCGCTAAGCCAGAATCAGAGACTTTTAATAAAGCAAAGACAGAGCCGGACCCACAGGTTCCAAGTCGACCAAAACCAGCAGAAGCAGAACCACATAATAAAACAAAAACTGACCTCGAGCAGATTCTAAGCCGACCCAAATCAGAAGTGGAACCGCATAATAAAACAAAAACTGATCTGGAGCAGATTCTGAACAGGCCAAAGTCAGAGGCAGAACCTCTTAATAAAACAAAGATGGATCTAGAGCAGATCCTGAGCAGACCAAAATCCAACGGGGAACATCATAACAAAACAAAGATGGACCTGGAACATATTCTGAGCAGACCAAAGTCAGTGGAAGTAGAGCCAGCGGCTAAAAGTCCCAGAGATGAGGTGGACTTTTTTGGTGATGTGATACCTACCTCAAACCATTTATCCCACCCGACTGCAAGCAGGCCAAAGATGCAAGGGAAGAGACCGCCCGGTCGATTTAATGGTTCCACTGCTCAAAGCAAAGATGTAACAGATTCTGTCAAAGTGCTTAAAGAAGAGGAGGAGGAAAGTGCCAAAGTAAAGACTCCTGAAGTAAAGAAGCCATTGGTTTCCAGCCCTGGTCCATTTGCACTCTCGGTTTCACCCCTTGTGCCACTCCCTGTGTCAAAACCAGCCCCCAGCCCTCAGGTCCCATTACCTGCTGAGGTGAAAGTGAAATCAGATGTGACTGACAGTAAGAAGAGCGAAAAGAGTGAAATGGAAGAACTTAAAGCCCAAATCGGGGAACTGCTCAGCATCGTGGATGCACTTAGGAAAGAACATAGGAAAGAGATGGATCACCTAAAGAAAGAGCTGGAAGAGGAGCGATTGTTACGGACCAGTTTAGAGACTGAGGTTGACAAGCTGAAGAAGGCAGTCCAGTTAACATGAGGCGGCCATTTTGTTAATGGCACCAGTCCAGATTAAAGTCCACGTCAGATATTTAATGCTGTCTCCTCTTTTCCTCGAGTTCATGGAAGCATGGTTCAACGATCCTCTGGCGCTTTCCTCTCGTTGCTTTGCCAATGGAATTAAAGAGGCCTTATCT
  5   1   2      ests                                 Xt7.1-CABI6512.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGCCTAACGGGGGGATACGATAGCCTTAGATTAATAACCACTCGTCACGGGAAGCAAAAACGATCATGTTCTTTTGTATATTTTAGACTTCTTATCCAGGGTTACACACTGCTGTGCCTGTCTGCGGCCCAAGTATTAATTGCATTGTGTATAATTAGATTTCTATCGGCCGGTTGTTGATACTGTATGTAGGAGGCAATTCCCCTACGCATATAAGCGAGAAGAATGCTACTTTGTGTTTTTAATGGAGAGCTTGTTACGTCACTTTGCACAAGGAGAACTTCAAGGGATTTGGGTCATTGTACTGGAGCTTTGCACTTACACTGGAATAGGGAGCAGCTTGGAGGGGGGTACTCCTTTCTTATAACACCACCTATTTTGGGGGGGACCAACAGACTCCAAAAGGGGGACGGGGACTTCCTTGGGGCATTGGTGGAATTAGGGAACAGCCTAAGCAGATCAGAGGTGTAATATTTCCTATATTTATGGGCGTATTAATGTGCATTGGGTACCAAGAGTAGGGGAGGGGTCTTCTTAGCTTGAAAATGTCCCTTTGTAAAGGGCCGACTCTTAGCATTCAGCTCTCAAGGAATGCTGGGAGTTTTATTTTTTTTAACTGGATTTAGGGGTGTTGGCCTTAATACCCTGGGACCCTTCTTCCTGACATTGGACCCAGAAGCAAAATCATTTTCAGTGAGTTCCTTTCTATTTAAATTCCTGTACAGGTCGACGAACGCTAGATTTTTAGCAGGATGGTGCCCTTTTATAGGCAAGTAAACCTTGCGCCACCATATGTTCTATACTCTTTTATTTCTATAGCTTAAAAGATATTGGCTTCTGAACCCTTCCCCCAGTCGTACCTTGCTGATCATCAGTGTCCCAGTGAGCCGCTGTAATGTGGCCAATACTAATGAAACTGGGGGCCCTCCTTCTAAGAAACTTGTAGTGCAAACGGGAAGACAGAATAAAGTTATCTGATGAAAGTGTACTACTTTATCCAGTTACCACTTACCAACCAATCCCTTGCTGCGAAAGGAGAAGTATCATCTGTTATAACATGATCTTTATCAGAGAGATTTCCTTATTGGTTAAAATGAGGCTCAGGGTTTGAAGATCACTTGCAGTACCTTTTTCCACCAGTGCTGGCAGTGTTTCCAACAGAACTGTGCCTCGACTATAGACAAGCTGCAACCCTTGTACAAAGCACCTCCCAGATGTTCTAGACCCTTTTTACTAAACAGAGTAAAGCCATACAGAGAGAAATGGTACCTCCCTTTTATATATATATTTTTTATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTATGGGGAGGGGGGATTTCTAGCCATAAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCAGTTAATAAAATGATTGAATTTTCAAAAAAAAAAAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --------A---
                                               BLH ATG     278    1267                                                                                                                    
                                               BLH MIN     218     155                                                                                                                    
                                               BLH OVR     278    1082                                                                                                                    
                                               EST CLI       0       1                                                                                                                    
                                               ORF LNG     278     195                                                                                                                    
                                                                       PROTEIN --- Sc ---- 1e-009     NP_011880.1 SH3 domain in C-terminus [Saccharomyces cerevisiae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ci ---- 8e-012     BAD99568.1 neutrophil cytosolic factor 1 [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ce ---- 1e-031     NP_491143.2 Y44E3A.4 [Caenorhabditis elegans] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Dm ---- 1e-039     NP_733405.2 CG31012-PC [Drosophila melanogaster] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 8e-073     XP_786341.2 PREDICTED: similar to SH3-domain kinase binding protein 1 [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Mm ---- 8e-078     NP_067364.2 SH3-domain kinase binding protein 1; Sh3 containing, expressed in astrocytes[Mus musculus] -------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Dr ==== 2e-079     NP_001008583.1 zgc:103705 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                     PROTEIN --- Gg ---- 1e-105     NP_001025976.1 SH3-domain kinase binding protein 1 [Gallus gallus] -------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Hs ==== 2e-159     NP_036252.1 CD2-associated protein [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xt ==== 0          CAJ83986.1 CD2-associated protein [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xl ==== 0          AAH97671.1 LOC445851 protein [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = ?? ==== 0          NP_001086432.1 hypothetical protein LOC445851 [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABI6512.3.5                                                                                                                                                                                                                               TAG------------------TGA---------------------------------------------------------TAG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------TGA---------------------------------TAA------------------------------------------------------ATG------------------------------------------------TAA---------------------------------------------------------------------------ATG------------------------------TGA------ATGTAA------------------------------------------------------------------TAG------------------TAG---TAG------------------------------------ATG---------------TAG---------------------------------------------------------------------TAG------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG------------------TAG------------------------ATG---------------------------------------------------------------------------TAG------------TAA---------------------------------------------------------------------TAA------------------------TAG------------ATG------------------------------------------------------------------TAA---------------------------------------------------------------------TAA------------TAATGA------------------TAA------------------------------TAA---------ATG------------------------------------------------------------------------------TGA---------------------------------TGA---------------------------------------------------------------------------------------------------------------------ATG---TAG---------------------------------------ATG---------------------------------------------------------------------------------------------TAG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------ATG---------------------------------------------------ATG---TGA------TAGTAA---------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------TAATAA------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  0   1   1           Gas  FLsh                   TGas060m05.FL-Sanger                                                                                                                                                                                                                                    AACTGGGCAGAGAGGGTGAGAGGTTACCGCCGAGGGCTGGACAGGGTTGGAGAGTTGTCTGGCATTTGGATGGGCGTAGGCTGCCGGCGGGGAGAGACGGAGCCCGGGAAGCCAGAGGCCGGAGAGTGACAGCCCCCCTTGCCGGGGTGGAAGAGATCCGGGCAGCATGGTGGAATACATTGTGGAATATGACTACGATGCTGTAAATGAGGACGAGTTGACGATACGAGTAGGAGACGTCATCAAGAACGTTAACAAGCTGGAAGAGGATGGCTGGCTGGAGGGTGAAGTCAATGGTAAAAGAGGCGCCTTCCCTGATAATTTTGTAAAGGAAGTAAAAAAAGATCCAGAACCAAAAGAAGAGAATGTATCAAATAAAAGGGAGAAATCTGGAAATGTTGCCAGCCTGGTGCAGCGGATGAGCGTGTATGGAATCCCTGGGATGGGGCCTCCACCGCAGCCCAAATCCATCAAAAAAAAATCCAAAAAGCGCCAGTGCAAGGTCCTGTATGAGTACATCCCGCAGAACGAAGATGAACTGGAGCTGAAAGTGGGGGAAGTCCTGGATATCATTGAGGAGGTAGAAGAAGGCTGGTGGAGTGGAAGCAACAGCGGCAAATCCGGCCTCTTTCCTTCCAACTTTGTAAAAGAAATTGATCTGTCGGACGATGGAGAGAGTCAGGAGAGCACTGAAGATTCAGAGCCATCTGTCACAACTCCTATAGCAACGCCGGCCTCCCCTGTACTGTCCCCAGCGAATGGACCTGATGCCTCCCCATTAGCCACGGCACAGCCAAAGAAGGTCATGGGAGTCGGCTTTGGGGACATTTTCAAAGAAGGCTCTGTGAAACTCAAGACTAGACTGCCAGCTCCTGAGCCAGAAGTGAAAAAGCCCGAAAAGCCATTACCAGTTCAGCCATCAGGTACCAAGGTTCTGCGCTCAACAAGCTCTGATGCTTCAAGAACAGAGACGGACAGTAAACCCAAAGCCAAGGAGATCTGCAAGGCGCTGTTTAACTATGAGTCTGTGAACGAGGATGAACTTTCATTTAAGGAAGGAGATATTATTCACCTGACTAGTAAAGAGACTGGTGACCCAGGCTGGTGGAAAGGAGAACTGAATGGCAAGGAAGGAGTTTTCCCCGACAACTTTGTTGCAATAATACAAGATTCTGAAAAAGAGAAGCCAAAGAAGCCACCACCTCCTATTAAAAGCCCGGGGATTCCCCGGGCCCGGGGATTCCCCGGGGCTATGGCGCCGAGTAAAGACAAAAAGCCAAAGAAGGCCTGGAGTTTTACCCTGGATCTCACACATCCAGTGGAAGATGGGATCTTTGATTCTGTCAACTTTGAACAGTTTCTGAAAGAGAGAATAAAGGTTAATGGTAAAACCGGAAACCTCGGAAGCATTGTTCATATTGGACGTTTAAAAAGCAAGATTACAGTTTCTTCTGAGAAAAAATTTTCTAAAAGGTACCTAAAATACCTGACTAAGAAATATCTCAAGAAAAACAACTTGCGAGACTGGCTACGGGTAGTTGCATCTGACAAAGAGACCTATGAGCTCAGATACTTCCAGATAAGCCAGGATGATGAATCAGAATCTGAAGAATAAAATGTTTAATAAACACCATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2      ests                                 Xt7.1-CAAN8788.5                                                                                                                    AAAAGAGCCGGAGAGAGGGATCGGCCTGTGATTGGCCGAGGAGGGTCACATGGCTTAGCTGGGCTCCGAGTTGGCGTACGCGGTTGTGTAGCCCGGTGCTCGGGTGCTAGGGAACTGGGCAGAGAGGGTGAGAGGTTACCGCCGAGGGCTGGACAGGGTTGGAGAGTTGTCTGGCATTTGGATGGGCGTAGGCTGCCGGCGGGGAGAGACGGAGCCCGGGAAGCCAGAGGCCGGAGAGTGACAGCCCCCCTTGCCGGGGTGGAAGAGATCCGGGCAGCATGGTGGAATACATTGTGGAATATGACTACGATGCTGTAAATGAGGACGAGTTGACGATACGAGTAGGAGACGTCATCAAGAACGTTAACAAGCTGGAAGAGGATGGCTGGCTGGAGGGTGAAGTCAATGGTAAAAGAGGCGCCTTCCCTGATAATTTTGTAAAGGAAGTAAAAAAAGATCCAGAACCAAAAGAAGAGAATGTATCAAATAAAAGGGAGAAATCTGGAAATGTTGCCAGCCTGGTGCAGCGGATGAGCGTGTATGGAATCCCTGGGATGGGGCCTCCACCGCAGCCCAAATCCATCAAAAAAAAATCCAAAAAGCGCCAGTGCAAGGTCCTGTATGAGTACATCCCGCAGAACGAAGATGAACTGGAGCTGAAAGTGGGGGAAGTCCTGGATATCATTGAGGAGGTAGAAGAAGGCTGGTGGAGTGGAAGCAACAGCGGCAAATCCGGCCTCTTTCCTTCCAACTTTGTAAAAGAAATTGATCTGTCGGACGATGGAGAGAGTCAGGAGAGCACTGAAGATTCAGAGCCATCTGTCACAACTCCTATAGCAACGCCGGCCTCCCCTGTACTGTCCCCAGCGAATGGACCTGATGCCTCCCCATTAGCCACGGCACAGCCAAAGAAGGTCATGGGAGTCGGCTTTGGGGACATTTTCAAAGAAGGCTCTGTGAAACTCAAGACTAGACTGCCAGCTCCTGAGCCAGAAGTGAAAAAGCCCGAAAAGCCATTACCAGTTCAGCCATCAGGTACCAAGGTTCTGCGCTCAACAAGCTCTGATGCTTCAAGAACAGAGACGGACAGTAAACCCAAAGCCAAGGAGATCTGCAAGGCGCTGTTTAACTATGAGTCTGTGAACGAGGATGAACTTTCATTTAAGGAAGGAGATATTATTCACCTGACTAGTAAAGAGACTGGTGACCCAGGCTGGTGGAAAGGAGAACTGAATGGCAAGGAAGGAGTTTTCCCCGACAACTTTGTTGCAATAATACAAGATTCTGAAAAAGAGAAGCCAAAGAAGCCACCACCTCCTATTAAAAGCCCAGCACCAAAGCCAGAACTTCGCATTGCAGAGAAAAAGTCAACTCCAACGAAGACAGAAGAGAAAGATGAAAAGCCATTGGTGGACCTCAAGCCCCCCAAACCTGCAGCTCCTCAGGTACCTCCGAAGAAACCAAATCTTACAAGCAAGAGTAATAGTATCCTAAAACCCGCGGTAATCCCGCCCAAGCGTCCGGAAAAGCCAGCGTTTGCCTCACCAACCTCCAAGCCTAATGGGGATTTACTGCTAAATCGCGCTAAGCCAGAATCAGAGACTTTTAATAAAGCAAAGACAGAGCCGGACCCACAGGTTCCAAGTCGACCAAAACCAGCAGAAGCAGAACCACATAATAAAACAAAAACTGACCTCGAGCAGATTCTAAGCCGACCCAAATCAGAAGTGGAACCGCATAATAAAACAAAAACTGATCTGGAGCAGATTCTGAACAGGCCAAAGTCAGAGGCAGAACCTCTTAATAAAACAAAGATGGATCTAGAGCAGATCCTGAGCAGACCAAAATCCAACGGGGAACATCATAACAAAACAAAGATGGACCTGGAACATATTCTGAGCAGACCAAAGTCAGTGGAAGTAGAGCCAGCGGCTAAAAGTCCCAGAGATGAGGTGGACTTTTTTGGTGATGTGATACCTACCTCAAACCATTTATCCCACCCGACTGCAAGCAGGCCAAAGATGCAAGGGAAGAGACCGCCCGGTCGATTTAATGGTTCCACTGCTCAAAGCAAAGATGTAACAGATTCTGTCAAAGTGCTTAAAGAAGAGGAGGAGGAAAGTGCCAAAGTAAAGACTCCTGAAGTAAAGAAGCCATTGGTTTCCAGCCCTGGTCCATTTGCACTCTCGGTTTCACCCCTTGTGCCACTCCCTGTGTCAAAACCAGCCCCCAGCCCTCAGGTCCCATTACCTGCTGAGGTGAAAGTGAAATCAGATGTGACTGACAGTAAGAAGAGCGAAAAGAGTGAAATGGAAGAACTTAAAGCCCAAATCGGGGAACTGCTCAGCATCGTGGATGCACTTAGGAAAGAACATAGGAAAGAGATGGATCACCTAAAGAAAGAGCTGGAAGAGGAGCGATTGTTACGGACCAGTTTAGAGACTGAGGTTGACAAGCTGAAGAAGGCAGTCCAGTTAACATGAGGCGGCCATTTTGTTAATGGCACCAGTCCAGATTAAAGTCCACGTCAGATATTTAATGCTGTCTCCTCTTTTCCTCGAGTTCATGGAAGCATGGTTCAACGATCCTCTGGCGCTTTCCTCTCGTTGCTTTGCCAATGGAATTAAAGAGGCCTTATCT
                                                  Xt7.1-CHK-1008229634                                                                                                                          GCCGGAGAGAGGGATCGGCCTGTGATTGGCCGAGGAGGGTCACATGGCTTAGCTGGGCTCCGAGTTGGCGTACGCGGTTGTGTAGCCCGGTGCTCGGGTGCTAGGGAACTGGGCAGAGAGGGTGAGAGGTTACCGCCGAGGGCTGGACAGGGTTGGAGAGTTGTCTGGCATTTGGATGGGCGTAGGCTGCCGGCGGGGAGAGACGGAGCCCGGGAAGCCAGAGGCCGGAGAGTGACAGCCCCCCTTGCCGGGGTGGAAGAGATCCGGGCAGCATGGTGGAATACATTGTGGAATATGACTACGATGCTGTAAATGAGGACGAGTTGACGATACGAGTAGGAGACGTCATCAAGAACGTTAACAAGCTGGAAGAGGATGGCTGGCTGGAGGGTGAAGTCAATGGTAAAAGAGGCGCCTTCCCTGATAATTTTGTAAAGGAAGTAAAAAAAGATCCAGAACCAAAAGAAGAGAATGTATCAAATAAAAGGGAGAAATCTGGAAATGTTGCCAGCCTGGTGCAGCGGATGAGCGTGTATGGAATCCCTGGGATGGGGCCTCCACCGCAGCCCAAATCCATCAAAAAAAAATCCAAAAAGCGCCAGTGCAAGGTCCTGTATGAGTACATCCCGCAGAACGAAGATGAACTGGAGCTGAAAGTGGGGGAAGTCCTGGATATCATTGAGGAGGTAGAAGAAGGCTGGTGGAGTGGAAGCAACAGCGGCAAATCCGGCCTCTTTCCTTCCAACTTTGTAAAAGAAATTGATCTGTCGGACGATGGAGAGAGTCAGGAGAGCACTGAAGATTCAGAGCCATCTGTCACAACTCCTATAGCAACGCCGGCCTCCCCTGTACTGTCCCCAGCGAATGGACCTGATGCCTCCCCATTAGCCACGGCACAGCCAAAGAAGGTCATGGGAGTCGGCTTTGGGGACATTTTCAAAGAAGGCTCTGTGAAACTCAAGACTAGACTGCCAGCTCCTGAGCCAGAAGTGAAAAAGCCCGAAAAGCCATTACCAGTTCAGCCATCAGGTACCAAGGTTCTGCGCTCAACAAGCTCTGATGCTTCAAGAACAGAGACGGACAGTAAACCCAAAGCCAAGGAGATCTGCAAGGCGCTGTTTAACTATGAGTCTGTGAACGAGGATGAACTTTCATTTAAGGAAGGAGATATTATTCACCTGACTAGTAAAGAGACTGGTGACCCAGGCTGGTGGAAAGGAGAACTGAATGGCAAGGAAGGAGTTTTCCCCGACAACTTTGTTGCAATAATACAAGATTCTGAAAAAGAGAAGCCAAAGAAGCCACCACCTCCTATTAAAAGCCCAGCACCAAAGCCAGAACTTCGCATTGCAGAGAAAAAGTCAACTCCAACGAAGACAGAAGAGAAAGATGAAAAGCCATTGGTGGACCTCAAGCCCCCCAAACCTGCAGCTCCTCAGGTACCTCCGAAGAAACCAAATCTTACAAGCAAGAGTAATAGTATCCTAAAACCCGCGGTAATCCCGCCCAAGCGTCCGGAAAAGCCAGCGTTTGCCTCACCAACCTCCAAGCCTAATGGGGATTTACTGCTAAATCGCGCTAAGCCAGAATCAGAGACTTTTAATAAAGCAAAGACAGAGCCGGACCCACAGGTTCCAAGTCGACCAAAACCAGCAGAAGCAGAACCACATAATAAAACAAAAACTGACCTCGAGCAGATTCTAAGCCGACCCAAATCAGAAGTGGAACCGCATAATAAAACAAAAACTGATCTGGAGCAGATTCTGAACAGGCCAAAGTCAGAGGCAGAACCTCTTAATAAAACAAAGATGGATCTAGAGCAGATCCTGAGCAGACCAAAATCCAACGGGGAACATCATAACAAAACAAAGATGGACCTGGAACATATTCTGAGCAGACCAAAGTCAGTGGAAGTAGAGCCAGCGGCTAAAAGTCCCAGAGATGAGGTGGACTTTTTTGGTGATGTGATACCTACCTCAAACCATTTATCCCACCCGACTGCAAGCAGGCCAAAGATGCAAGGGAAGAGACCGCCCGGTCGATTTAATGGTTCCACTGCTCAAAGCAAAGATGTAACAGATTCTGTCAAAGTGCTTAAAGAAGAGGAGGAGGAAAGTGCCAAAGTAAAGACTCCTGAAGTAAAGAAGCCATTGGTTTCCAGCCCTGGTCCATTTGCACTCTCGGTTTCACCCCTTGTGCCACTCCCTGTGTCAAAACCAGCCCCCAGCCCTCAGGTCCCATTACCTGCTGAGGTGAAAGTGAAATCAGATGTGACTGACAGTAAGAAGAGCGAAAAGAGTGAAATGGAAGAACTTAAAGCCCAAATCGGGGAACTGCTCAGCATCGTGGATGCACTTAGGAAAGAACATAGGAAAGAGATGGATCACCTAAAGAAAGAGCTGGAAGAGGAGCGATTGTTACGGACCAGTTTAGAGACTGAGGTTGACAAGCTGAAGAAGGCAGTCCAGTTAACATGAGGCGGCCATTTTGTTAATGGCACCAGTCCAGATTAAAGTCCACGTCAGATATTTAATGCTGTCTCCTCTTTTCCTCGAGTTCATGGAAGCATGGTTCAACGATCCTCTGGCGCTTTCCTCTCGTTGCTTTGCCAATGGAATTAAAGAGGCC
  5   1   2       bld Egg       in                   TEgg077p06.p1kSP6                                                                                                                    AAAAGAGCCGGAGAGAGGGATCGGCCTGTGATTGGCCGAGGAGGGTCACATGGCTTAGCTGGGCTCCGAGTTGGCGTACGCGGTTGTGTAGCCCGGTGCTCGGGTGCTAGGGAACTGGGCAGAGAGGGTGAGAGGTTACCGCCGAGGGCTGGACAGGGTTGGAGAGTTGTCTGGCATTTGGATGGGCGTAGGCTGCCGGCGGGGAGAGACGGAGCCCGGGAAGCCAGAGGCCGGAGAGTGACAGCCCCCCTTGCCGGGGTGGAAGAGATCCGGGCAGCATGGTGGAATACATTGTGGAATATGACTACGATGCTGTAAATGAGGACGAGTTGACGATACGAGTAGGAGACGTCATCAAGAACGTTAACAAGCTGGAAGAGGATGGCTGGCTGGAGGGTGAAGTCAATGGTAAAAGAGGCGCCTTCCCTGATAATTTTGTAAAGGAAGTAAAAAAAGATCCAGAACCAAAAGAAGAGAATGTATC
  3   1   2       bld Egg       in                    TEgg077p06.q1kT7                                                                                                                    AAAAGAGCCGGAGAGAGGGATCGGCCTGTGATTGGCCGAGGAGGGTCACATGGCTTAGCTGGGCTCCGAGTTGGCGTACGCGGTTGTGTAGCCCGGTGCTCGGGTGCTAGGGAACTGGGCAGAGAGGGTGAGAGGTTACCGCCGAGGGCTGGACAGGGTTGGAGAGTTGTCTGGCATTTGGATGGGCGTAGGCTGCCGGCGGGGAGAGACGGAGCCCGGGAAGCCAGAGGCCGGAGAGTGACAGCCCCCCTTGCCGGGGTGGAAGAGATCCGGGCAGCATGGTGGAATACATTGTGGAATATGACTACGATGCTGTAAATGAGGACGAGTTGACGATACGAGTAGGAGACGTCATCAAGAACGTTAACAAGCTGGAAGAGGATGGCTGGCTGGAGGGTGAAGTCAATGGTAAAAGAGGCGCCTTCCCTGATAATTTTGTAAAGGAAGTAAAAAGGGATCCAGAACCAAAAGAAGAGAATGTATCAAAAAAAAAAAAAAA
  5   1   2       bld Gas8      in                          st76f12.5p                                                                                                                     AAAGAGCCGGAGAGAGGGATCGGCCTGTGATTGGCCGAGGAGGGTCACATGGCTTAGCTGGGCTCCGAGTTGGCGTACGCGGTTGTGTAGCCCGGTGCTCGGGTGCTAGGGAACTGGGCAGAGAGGGTGAGAGGTTACCGCCGAGGGCTGGGCAGGGTTGGAGAGTTGTCTGGCATTTGGATGGGCGTAGGCTGCCGGCGGGGAGAGACGGAGCCCGGGAAGCCAGAGGCCGGAGAGTGACAGCCCCCCTTGCCGGGGTGGAAGAGATCCGGGCAGCATGGTGGAATACATTGTGGAATATGACTACGATGCTGTAAATGAGGACGAGTTGACGATACGAGTAGGAGACGTCATCAAGAACGTTAACAAGCTGGAAGAGGATGGCTGGCTGGAGGGTGAAGTCAATGGTAAAAGAGGCGCCTTCCCTGATAATTTTGTAAAGTAAAAAAAGATCCAGAACCAAAAGAAGAGAATGTATCAAATAAAAGGGAGAAATCTGGAAATGTTGCCAGCCTGGTGCAGCGGATGAGCGTGTATGGAATCCCTGGGATGGGGCCTCCACCGCAGCCCAAATCCATCAAAAAAAAATCCAAAAAGCGCCAGTGCAAGGTCCTGTATGAGTACATCCCGC
  5   1   2       bld Egg  5g                        TEgg094i20.p1kSP6                                                                                                                              GAGAGAGGGATCGGCCTGTGATTGGCCGAGGAGGGTCACATGGCTTAGCTGGGCTCCGAGTTGGCGTACGCGGTTGTGTAGCCCGGTGCTCGGGTGCTAGGGAACTGGGCAGAGAGGGTGAGAGGTTACCGCCGAGGGCTGGACAGGGTTGGAGAGTTGTCTGGCATTTGGATGGGCGTAGGCTGCCGGCGGGGAGAGACGGAGCCCGGGAAGCCAGAGGCCGGAGAGTGACAGCCCCCCTTGCCGGGGTGGAAGAGATCCGGGCAGCATGGTGGAATACATTGTGGAATATGACTACGATGCTGTAAATGAGGACGAGTTGACGATACGAGTAGGAGACGTCATCAAGAACGTTAACAAGCTGGAAGAGGATGGCTGGCTGGAGGGTGAAGTCAATGGTAAAAGAGGCGCCTTCCCTGATAATTTTGTAAAGGAAGTAAAAAAAGATCCAGAACCAAAAGAAGAGAATGTATCAAATAAAAGGGAGAAATCTGGAAATGTTGCCAGCCTGGTGCAGCGGATGAGCGTGTATGGAATCCCTGGGATGGGGCCTCCACCGCAGCCCAATCCATC
  5   1   2   14  bld Te3  5g3  in                         CAAM1464.5p ..................................................................................................................................................TTGGCCGAGGAGGGTCACATGGCTTAGCTGGGCTCCGAGTTGGCGTACGCGGTTGTGTAGCCCGGTGCTCGGGTGCTAGGGAACTGGGCAGAGAGGGTGAGAGGTTACCGCCGAGGGCTGGACAGGGTTGGAGAGTTGTCTGGCATTTGGATGGGCGTAGGCTGCCGGCGGGGAGAGACGGAGCCCGGGAAGCCAGAGGCCGGAGAGTGACAGCCCCCCTTGCCGGGGTGGAAGAGATCCGGGCAGCATGGTGGAATACATTGTGGAATATGACTACGATGCTGTAAATGAGGACGAGTTGACGATACGAGTAGGAGACGTCATCAAGAACGTTAACAAGCTGGAAGAGGATGGCTGGCTGGAGGGTGAAGTCAATGGTAAAAGAGGCGCCTTCCCTGATAATTTTGTAAAGGAAGTAAAAAAAGATCCAGAACCAAAAGAAGAGAATGTATCAAATAAAAGGGAGAAATCTGGAAATGTTGCCAGCCTGGTGCAGCGGATGAGCGTGTATGGAATCCCTGGGATGGGGCCTCCACCGCAGCCCAAATCCATCAAAAAAAATCCAAAAAGCGCCAGTGCAAGGTCCTGTATGAGTACATCCCGCAGAACGAAGATGAACTGGAGCTGAAAGTGGGGGAAGTCCTGGATATCATTGAGGAGGTAGAAGAAGGCTGGTGGAGTGGAAGCAACAGCGGCAAATCCGGCCTCTTTCCTTCCACTTTGTAA
  5   1   2   24  bld Te4  5g                              CAAN8788.5p ..................................................................................................................................................................................CTCCGAGTTGGCGTACGCGGTTGTGGAGCCCGGTGCTTGGGTGCTAGGGAACTGGGCAGAGAGGGTGAGAGGTTACCGCCGAGGGCTGGACAGGGTTGGAGAGTTGTCTGGCATTTGGATGGGCGTAGGCTGCCGGCGGGGAGAGACGGAGCCCGGGAAGCCAGAGGCCGGAGAGTGACAGCCCCCCTTGCCGGGGTGGAAGAGATCCGGGCAGCATGGTGGAATACATTGTGGAATATGACTACGATGCTGTAAATGAGGACGAGTTGACGATACGAGTAGGAGACGTCATCAAGAACGTTAACAAGCTGGAAGAGGATGGCTGGCTGGAGGGTGAAGTCAATGGTAAAAGAGGCGCCTTCCCTGATAATTTTGTAAAGGAAGTAAAAAAAGATCCAGAACCAAAAGAAGAGAATGTATCAAATAAAAGGGAGAAATCTGGAAATGTTGCCAGCCTGGTGCAGCGGATGAGCGTGTATGGAATCCCTGGGATGGGGCCTCCACCGCAGCCCAAATCCATCAAAAAAAAATCCAAAAAGCGCCAGTGCAAGGTCCTGTATGAGTACATCCCGCAGAACGAAGATGAACTGGAGCTGAAAGTGGGGGAAGTCCTGGATATCATTGAGGAGGTAGAAGAAGGCTGGTGGAGTGGAAGCAACAGCGGCAAATCCGGCCTCTTTCCTTCCAACTTTGTAAAAGAAATTGATCTGTCGGACGATGGAGAGAGTCAGGAGAGCACTGAAGATTCAGAGCCATCTGTCACAACTCCTATAGNCACGCCGGCCTCCCCTGTACTGTCCCCAGCGAATGGACCTGATGCCTCCCCATTAGCCACGGCACAGCCAAAGAAGGTCATGGGAGTCGGCTTT
  5   1   2   14  bld Te3  PIPE in                         CAAM6737.5p ...........................................................................................................................................................................................GGCGTACGCGGTTGTGTAGCCCGGTGCTCGGGTGCTAGGGAACTGGGCGGAGAGGGTGAGAGGTTACCGCCGAGGGCTGGACAGGGTTGGAGAGTTGTCTGGCATTTGGATGGGCGTAGGCTGCCGGCGGGGAGAGACGGAGCCCGGGAAGCCAGAGGCCGGAGAGTGACAGCCCCCCTTGCCGGGGTGGAAGAGATCCGGGCAGCATGGTGGAATACATTGTGGAATATGACTACGATGCTGTAAATGAGGACGAGTTGACGATACGAGTAGGAGACGTCATCAAGAACGTTAACAAGCTGGAAGAGGATGGCTGGCTGGAGGGTGAAGTCAATGGTAAAAGAGGCGCCTTCCCTGATAATTTTGTAAAGGAAGTAAAAAAAGATCCAGAACCAAAAGAAGAGAATGTATCAAATAAAAGGGAGAAATCTGGAAATGTTGCCAGCCTGGTGCAGCGGATGAGCGTGTATGGAATCCCTGGGATGGGGCCTCCACCGCAGCCCAAATCCATCAAAAAAAAATCCAAAAAGCGCCAGTGCAAGGTCCTGTATGAGTACATCCCGCAGAACGAAGATGAACTGGAGCTGAAAGTGGGGGAAGTCCTGGATATCATTGAGGAGGTAGAAGAAGGCTGGTGGAGTGGAAGCAACAGCGGCAAATCCGGCCTCTTTCCTTCCAACTTTGNTAAAGAAATTGATCTGTCGGACGATGGAGAGAGTCAGGAGAGCACTGAAGATTCAGAGCCATCTGTCACAACTCCTATAGC
  5   1   2       bld Gas  FLsh out                  TGas060m05.p1cSP6                                                                                                                                                                                                                                    AACTGGGCAGAGAGGGTGAGAGGTTACCGCCGAGGGCTGGACAGGGTTGGAGAGTTGTCTGGCATTTGGATGGGCGTAGGCTGCCGGCGGGGAGAGACGGAGCCCGGGAAGCCAGAGGCCGGAGAGTGACAGCCCCCCTTGCCGGGGTGGAAGAGATCCGGGCAGCATGGTGGAATACATTGTGGAATATGACTACGATGCTGTAAATGAGGACGAGTTGACGATACGAGTAGGAGACGTCATCAAGAACGTTAACAAGCTGGAAGAGGATGGCTGGCTGGAGGGTGAAGTCAATGGTAAAAGAGGCGCCTTCCCTGATAATTTTGTAAAGGAAGTAAAAAAAGATCCAGAACCAAAAGAAGAGAATGTATCAAATAAAAGGGAGAAATCTGGAAATGTTGCCAGCCTGGTGCAGCGGATGAGCGTGTATGGAATCCCTGGGATGGGGCCTCCACCGCAGCCCAAATCCATCAAAAAAAAATCCAAAAAGCGCCAGTGCAAGGTCCTGTATGAGTACATCCCGCAGAACGAAGATGAACTGGAGCTGAAAGTGGGGGA
  5   1   2      seed Egg  5g3  in                   TEgg075p12.p1kSP6                                                                                                                                                                                                                                                                                                              CGTAGGCTGCCGGCGGGGAGAGACGGAGCCCGGGAAGCCAGAGGCCGGAGAGTGACAGCCCCCCTTGCCGGGGTGGAAGAGATCCGGGCAGCATGGTGGAATACATTGTGGAATATGACTACGATGCTGTAAATGAGGACGAGTTGACGATACGAGTAGGAGACGTCATCAAGAACGTTAACAAGCTGGAAGAGGATGGCTGGCTGGAGGGTGAAGTCAATGGTAAAAGAGGCGCCTTCCCTGATAATTTTGTAAAGGAAGTAAAAAAAGATCCAGAACCAAAAGAAGAGAATGTATCAAATAAAAGGGAGAAATCTGGAAATGTTGCCAGCCTGGTGCAGCGGATGAGCGTGTATGGAATCCCTGGGATGGGGCCTCCACCGCAGCCCAAATCCATCAAAAAAAAATCCAAAAAGCGCCAGTGCAAGGTCCTGTATGAGTACATCCCGCAGAACGAAGATGAACTGGAGCTGAAAGTGGGGGAAGTCCTGGATATCATTGAGGAGGTAGAAGAAGGCTGGTGGAGTGGAAGCAACAGCGGCAAATCCGGCCTCTTTCCTTCCAACTTTGTAAAAGAAATTGATCTGTCGGACGATGGAGAGAGTCAGGAGAGCACTGAAGATTCAGAGCCATCTGTCACAACTCCTATAGC
  3   1   2       bld Neu       in                    TNeu125m15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                           AGAGATCCGGGCAGCATGGTGGAATACATTGTGGAATATGACTACGATGCTGTAAATGAGGACGAGTTGACGATACGAGTAGGAGACGTCATCAAGAACGTTAACAAGCTGGAAGAGGATGGCTGGCTGGAGGGTGAAGTCAATGGTAAAAGAGGCGCCTTCCCTGATAATTTTGTAAAGGAAGTAAAAAAAGATCCAGAACCAAAAGAAGAGAATGTATCAAATAAAAGGGAGAAATCTGGAAATGTTGCCAGCCTGGTGCAGCGGATGAGCGTGTATGGAATCCCTGGGATGGGGCCTCCACCGCAGCCCAAATCCATCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu       in                   TNeu125m15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                            GAGATCCGGGCAGCATGGTGGAGTACATTGTGGAATATGACTCCGATGCTGTAAATGAGGACGAGTTGACGATACGAGTAGGAGACGTCATCAAGAACGTTAACAAGCTGGAAGAGGATGGCTGGCTGGAGGGTGAAGTCAATGGTAAAAGAGGCGCCTTCCCTGATAATTTTGTAAAGGAAGTAAAAAAAGATCCAGAACCAAAAGAAGAGAATGTATCAAATAAAAGGGAGAAATCTGGAAATGTTGCCAGCCTGGTGCAGCGGATGAGCGTGTATGGAATCCCTGGGATGGGGCCTCCACCGCAGCCCAAATCCATC
  5   1   2       bld Tad5      in                         XZT52587.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCGCCTTCCCTGATAATTTTGTAAAGGAAGTAAAAAAAGATCCAGAACCAAAAGAAGAGAATGTATCAAATAAAAGGGAGAAATCTGGAAATGTTGCCAGCCTGGTGCAGCGGATGAGCGTGTATGGAATCCCTGGGATGGGGCCTCCACCGCAGCCCAAATCCATCAAAAAAAAATCCAAAAAGCGCCAGTGCAAGGTCCTGTATGAGTACATCCCGCAGAACGAAGATGAACTGGAGCTGAAAGTGGGGGAAGTCCTGGATATCATTGAGGAGGTAGAAGAAGGCTGGTGGAGTGGAAGCAACAGCGGCAAATCCGGCCTCTTTCCTTCCAACTTTGTAAAAGAAATTGATCTGTCGGACGATGGAGAGAGTCAGGAGAGCACTGAAGATTCAGAGCCATCTGTCACAACTCCTATAGCAACGCCGGCCTCCCCTGTACTGTCCCCAGCGAATGGACCTGATGCCTCCCCATTAGCCACGGCACAGCCAAAGAAGGTCATGGGAGTCGGCTTTGGGGACATTTTCAAAGAAGGCTCTGTGAAACTCAAGACTAGACTGCCAGCTCCTGAGCCAGAAGTGAAAAAGCCCGAAAAGCCATTACCAGTTCAGCCATCAGGTACCAAGGTTCTGCGCTCAACAAGCTCTGATGCTTCAAGAACAGAGACGGACAGTAAACCCAAAGCCAAGGAGATCTGCAAGGCGCTGTTTAACTATGAGTCTGTGAACGAGGATGAACTTTCATTNTAGGAAGGAGATATTATTCACCTGACTAGTAAAGAGACTGGTGACCCAGGCTGGTGGAAAGGAGAACT
  5   1   2       bld Int1      in                         CAAP1411.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGAACCAAAAGAAGAGAATGTATCAAATAAAAGGGAGAAATCTGGAAATGTTGCCAGCCTGGTGCAGCGGATGAGCGTGTATGGAATCCCTGGGATGGGGCCTCCACCGCAGCCCAAATCCATCAAAAAAAAATCCAAAAAGCGCCAGTGCAAGGTCCTGTATGAGTACATCCCGCAGAACGAAGATGAACTGGAGCTGAAAGTGGGGGAAGTCCTGGATATCATTGAGGAGGTAGAAGAAGGCTGGTGGAGTGGAAGCAACAGCGGCAAATCCGGCCTCTTTCCTTCCAACTTTGTAAAAGAAATTGATCTGTCGGACGATGGAGAGAGTCAGGAGAGCACTGAAGATTCAGAGCCATCTGTCACAACTCCTATAGCAACGCCGGCCTCCCCTGTACTGTCCCCAGCGAATGGACCTGATGCCTCCCCATTAGCCACGGCACAGCCAAAGAAGGTCATGGGAGTCGGCTTTGGGGACATTTTCAAAGAAGGCTCTGTGAAACTCAAGACTAGACTGCCAGCTCCTGAGCCAGAAGTGAAAAAGCCCGAAAAGCCATTACCAGTTCAGCCATCAGGTACCAAGGTTCTGCGCTCAACAAGCTCTGATGCTTCAAGAACAGAGACGGACAGTAAACCCAAAGCCAAGGAGATCTGCAAGGCGCTGTTTAACTATGAGTCTGTGAACGAGGATGAACTTTCATTTAAGGAAGGAGATATTATTCACCTGACTAGTANAGAGACTGGTGACCCAGGCTGGTGGAAAGGAGAACTGAATGGCAAGGAAGGAGTTTTCCCCGACAACTTTGTTGCAATAATACAAGATTCT
  5   1   2       bld Gas       in                   TGas116c15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCAGTGCAAGGTCCTGTATGAGTACATCCCGCAGAACGAAGATGAACTGGAGCTGAAAGTGGGGGAAGTCCTGGATATCATTGAGGAGGTAGAAGAAGGCTGGTGGAGTGGAAGCAACAGCGGCAAATCCGGCCTCTTTCCTTCCAACTTTGTAAAAGAAATTGATCTGTCGGACGATGGAGAGAGTCAGGAGAGCACTGAAGATTCAGAGCCATCTGTCACAACTCCTATAGCAACGCCGGCCTCCCCTGTACTGTCCCCAGCGAATGGACCTGATGCCTCCCCATTAGCCACGGCACAGCCAAAGAAGGTCATGGGAGTCGGCTTTGGGGACATTTTCAAAGAAGGCTCTGTGAACTCAAGACTAGACTGCCAGCTCCTGAGCCAGAAGTGAAAAAGCCCGAAAAGCCATTACCAGTTCAGCCATCAGGTACCAAGGTCTGCGCTCAACAGCTCTGATGCTTCA
  5   1   2       bld Egg                            TEgg085j08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGACGATGGAGAGAGTCAGGAGAGCACTGAAGATTCAGAGCCATCTGTCACAACTCCTATAGCAACGCCGGCCTCCCCTGTACTGTCCCCAGCGAATGGACCTGATGCCTCCCCATTAGCCACGGCACAGCCAAAGAAGGTCATGGGAGTCGGCTTTGGGGACATTTTCAAAGAAGGCTCTGTGAAACTCAAGACTAGACTGCCAGCTCCTGAGCCAGAAGTGAAAAAGCCCGAAAAGCCATTACCAGTTCAGCCATCAGGTACCAAGGTTCTGCGCTCAACAAGCTCTGATGCTTCAAGAACAGAGACGGACAGTAAACCCAAAGCCAAGGAGATCTGCAAGGCGCTGTTTAACTATGAGTCTGTGAACGAGGATGAACTTTCATTTAAGGAAGGAGATATTATTCACCTGACTAGTAAAGAGACTGGTGACCCAGGCTGGTGGAAAGGAGAACTGAATGGCAAGGAAGGAGTTTTCCCCGACAACTTTGTTGCAATAATACAAGATTCTGAAAAAGAGAAGCCAAAGAAGCCACCACCTCCTATTAAAAGCCCAGCACCAAAGCCAGAACTTCGCATTGCAGAGAAAAAGTCAACTCCAACGAAGACAGAAGAGAAAGATGAAAAGCCATTGGTGGACCTCAAGCCC
  3   1   2       bld Gas       in                    TGas116c15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGCCTCCCCATTAGCCACGGCACAGCCAAAGAAGGTCATGGGAGTCGGCTTTGGGGACATTTTCAAAGAAGGCTCTGTGAAACTCAAGACTAGACTGCCAGCTCCTGAGCCAGAAGTGAAAAAGCCCGAAAAGCCATTACCAGTTCAGCCATCAGGTACCAAGGTTCTGCGCTCAACAAGCTCTGATGCTTCAAGAACAGAGACGGACAGTAAACCCAAAGCCAAGGAGATCTGCAAGGCGCTGTTTAACTATGAGTCTGTGAACGAGGATGAACTTTCATTTAAGGAAGGAGATATTATTCACCTGACTAGTAAAGAGACTGGTGACCCAGGCTGGTGGAAAGGAGAACTGAATGGCAAGGAAGGAGTTTTCCCCGACAACTTTGTTGCAATAATACAAGATTCTGAAAAAGAGAAGCCAAAGAAGCCACCACCTCCTATTAAAAGCCCAGCACCAAAGCCAGAACTTCGCATTGCAGAGAAAAAGTCAACTCCAACGAAGACAGAAGAGAAAGATGAAAAGCCATTGGTGGACCTCAAGCCCCCCAAACCTGCAGCTCCTCAGGTACCTCCGAAGAAACCAAATCTTACAAGCAAGAGTAATAGTATCCTAAAACCCGCGGTAATCCCGCCCAAGCGTCCGGAAAAGCCAGCGTTTGCCTCACCAACCTCCAAGCCTAATGGGGATTTACTGCTAAATCGCGCTAAGCCAGAATCAGAGACTTTTAATAAAGCAAAGACAGAGCCGGACCCACAGGTTCCAAGTCGACCAAAACCAGCAGAAGCAGAACCACATAATAAAACAAAAACTGACCTCGAGCAGATTCTAAGCCGACCCAAATCAGAAGTGAACC
  3   1   2       bld Gas8      in                          st76f12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATTAGCCACGGCACAGCCAAAGAAGGTCATGGGAGTCGGCTTTGGGGACATTTTCAAAGAAGGCTCTGTGAAACTCAAGACTAGACTGCCAGCTCCTGAGCCAGAAGTGAAAAAGCCCGAAAAGCCATTACCAGTTCAGCCATCAGGTACCAAGGTTCTGCGCTCAACAAGCTCTGATGCTTCAAGAACAGAGACGGACAGTAAACCCAAAGCCAAGGAGATCTGCAAGGCGCTGTTTAACTATGAGTCTGTGAACGAGGATGAACTTTCATTTAAGGAAGGAGATATTATTCACCTGACTAGTAAAGAGACTGGTGACCCAGGCTGGTGGAAAGGAGAACTGAACGGCAAGGAAGGAGTTTTCCCCGACAACTTTGTTGCAATAATACAAGATTCTGAAAAAGAGAAGCCAAAGAAGCCACCACCTCCTATTAAAAGCCCAGCACCAAAGCCAGAACTTCGCATTGCAGAGAAAAAGTCAACTCCAACGAAGACAGAAGAGAAAGATGAAAAGCCATTGGTGGACCTCAAGCCCCCCAAACCTGCAGCTCCTCAGGTACCTCCGAAGAAACCAAATCTTACAAGCAAGAGTAATAGTATCCTAAAACCCGCGGTAATCCCGCCCAAGCGTCCGGAAAAGCCAGCGTTTGCCTCACCAACCTCCAAGCCTAATGGGGATTTACTGCTAAATCGCGCTAAGCCAGAATCAGAGACTT
  5   1   2       bld Egg       in                   TEgg018a05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTAGCCACGGCACAGCCAAAGAAAGTCATGGGAGTCGGCTTTGGGGACATTTTCAAAGAAGGCTCTGTGAAACTCAAGACTAGACTGCCAGCTCCTGAGCCAGAAGTGAAAAAGCCCGAAAAGCCATTACCAGTTCAGCCATCAGGTACCAAGGTTCTGCGCTCAACAAGCTCTGATGCTTCAAGAACAGAGACGGACAGTAAACCCAAAGCCAAGGAGATCTGCAAGGCGCTGTTTAACTATGAGTCTGTGAACGAGGATGAACTTTCATTTAAGGAAGGAGATATTATTCACCTGACTAGTAAAGAGACTGGTGACCCAGGCTGGTGGAAAGGAGAACTGAATGGCAAGGAAGGAGTTTTCCCCGACAACTTTGTTGCAATAATACAAGATTCTGAAAAAGAGAAGCCAAAGAAGCCACCACCTCCTATTAAAAGCCCAGCACCAAAGCCAGAACTTCGCATTGCAGAGAAAAAGTCAACTCCAACGAAGACAGAAGAGAAAGATGAAAAGCCATTGGTGGACCTCAAGCCCCCCAAACCTGCAGCTCCTCAGGTACCTCCCGAAGAAACCAAATCTTACAAGCAAGAGTAATAGTATCCTAAAACCCGCAGTAATCCCGCCCAAGCGT
  5   1   2       bld Egg       in                   TEgg018b06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTAGCCACGGCACAGCCAAAGAAAGTCATGGGAGTCGGCTTTGGGGACATTTTCAAAGAAGGCTCTGTGAAACTCAAGACTAGACTGCCAGCTCCTGAGCCAGAAGTGAAAAAGCCCGAAAAGCCATTACCAGTTCAGCCATCAGGTACCAAGGTTCTGCGCTCAACAAGCTCTGATGCTTCAAGAACAGAGACGGACAGTAAACCCAAAGCCAAGGAGATCTGCAAGGCGCTGTTTAACTATGAGTCTGTGAACGAGGATGAACTTTCATTTAAGGAAGGAGATATTATTCACCTGACTAGTAAAGAGACTGGTGACCCAGGCTGGTGGAAAGGAGAACTGAATGGCAAGGAAGGAGTTTTCCCCGACAACTTTGTTGCAATAATACAAGATTCTGAAAAAGAGAAGCCAAAGAAGCCACCACCTCCTATTAAAAGCCCAGCACCAAAGCCAGAACTTCGCATTGCAGAGAAAAAGTCAACTCCAACGAAGACAGAAGAGAAAGATGAAAAGCCATTGGTGGACCTCAAGCCCCCCAAACCTGCAGCTCCTCAAGTACCTCCGAAGAAACCAAATCTTACAAGCAAGAGTAATAGTATCCTAAAACCCGCAGTAATCCCGCCCAAGCGTCCG
  5   1   2       bld Brn3      in                         CAAK4650.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAAACCAAATCTTACAAGCAAGAGTAATAGTATCCTAAAACCCGCGGTAATCCCGCCCAAGCGTCCGGAAAAGCCAGCGTTTGCCTCACCAACCTCCAAGCCTAATGGGGATTTACTGCTAAATCGCGCTAAGCCAGAATCAGAGACTTTTAATAAAGCAAAGACAGAGCCGGACCCACAGGTTCCAAGTCGACCAAAACCAGCAGAAGCAGAACCACATAATAAAACAAAAACTGACCTCGAGCAGATTCTAAGCCGACCCAAATCAGAAGTGGAACCGCATAATAAAACAAAAACTGATCTGGAGCAGATTCTGAACAGGCCAAAGTCAGAGGCAGAACCTCTTAATAAAACAAAGATGGATCTAGAGCAGATCCTGAGCAGACCAAAATCCAACGGGGAACATCATAACAAAACAAAGATGGACCTGGAACATATTCTGAGCAGACCAAAGTCAGTGGAAGTAGAGCCAGCGGCTAAAAGTCCCAGAGATGAGGTGGACTTTTTTGGTGATGTGATACCTACCTCAAACCATTTATCCCACCCGACTGCAAGCAGGCCAAAGATGCAAGGGAAGAGACTGCCCGGTCGATTCAATGGTTCCACTGCTCAAAGCAAAGATGTAACAGATTCTGTCAAAGTGCTTAAAGAAGAGGAGGAGGAAAGTGCCAAAGTAAAGACTCCTGAAGTAAAGAAGCCATTGGTTTCCAGCCCTGGTCCATTTGCACTCTCGGTTTCACCCCTTGTGCCACTCCCTGTGTCAAAACCAGCCCCCAGCCCTCAGGTCCCATTACCTGCTGAGGTGAAAGTGAAATCAGATGTGACTGACAGTAAGAAGAGCGAAAAGAGTGAAATGG
  5   1   2       bld Limb      in                       CBSU10345.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAGAAGCAGAACCACATAATAAAACAAAAACTGACCTAGAGCAGATTCTAAGCCGACCCAAATCAGAAGTGGAACCGCATAATAAAACAAAAACTGATCTGGAGCAGATTCTGAACAGGCCAAAGTCAGAGGCAGAACCTCTTAATAAAACAAAGATGGATCTAGAGCAGATCCTGAGCAGACCAAAATCCAACGGGGAACATCATAACAAAACAAAGATGGACCTGGAACATATTCTGAGCAGACCAAAGTCAGTGGAAGTAGAGCCAGCGGCTAAAAGTCCCAGAGATGAGGTGGACTTTTTTGGTGATGTGATACCTACCTCAAACCATTTATCCCACCCGACTGCAAGCAGGCCAAAGATGCAAGGGAAGAGACCGCCCGGTCGATTTAATGGTTCCACTGCTCAAAGCAAAGATGTAACAGATTCTGTCAAAGTGCTTAAAGAAGAGGAGGAGGAAAGTGCCAAAGTAAAGACTCCTGAAGTAAAGAAGCCATTGGTTTCCAGCCCTGGTCCATTTGCACTCTCGGTTTCACCCCTTGTGCCACTCCCTGTGTCAAAACCAGCCCCCAGCCCTCAGGTCCCATTACCTGCTGAGGTGAAAGTGAAATCAGATGTGACTGACAGTAAGAAGAGAGAAAAGAGTGAAATGGAAGAACTTAAAGACCAAATCGGGGAACTGCTCAGCATCGTGGATGCACTTAGGAAAGAACATAGGAAAGAGATGGATCACCTAAAGA
  5   1   2       bld Gas       in                   TGas066k02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAAGAAGAGGAGGAGGAAAGTGCCAAAGTAAAGACTCCTGAAGTAAAGAAGCCATTGGTTTCCAGCCCTGGTCCATTTGCACTCTCGGTTTCACCCCTTGTGCCACTCCCTGTGTCAAAACCAGCCCCCAGCCCTCAGGTCCCATTACCTGCTGAGGTGAAAGTGAAATCAGATGTGACTGACAGTAAGAAGAGCGAAAAGAGTGAAATGGAAGAACTTAAAGCCCAAATCGGGGAACTGCTCAGCATCGTGGATGCACTTAGGAAAGAACATAGGAAAGAGATGGATCACCTAAAGAAAGAGCTGGAAGAGGAGCGATTGTTACGGACCAGTTTAGAGACTGAGGTTGACAAGCTGAAGAAAGCAGTCCAGTTAACATGATGCGGCCATTTTGTTAATGGCACCAGTCCAGATTAAAGTCCACGTCAGATATTTAATGCTGTCTCCTCTTTTCCTCGAGTTCATGGAAGCATGGTCCAACGATCCTCTGGCGCTTTCCTCTCGTTGCTTTGCCAATGGAATTAAAGAGGCCTTATCTCTTACTGTGCTGGAGTG
  5   1   2       bld In62                            IMAGE:8952801.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAGGTTTAGGGAACGGTATGGGTGGTGCCTAACGAATTCGTCCCGTGAAATCAGATGTGACTGACAGTAAGAAGAGCGAAAAGAGTGAAATGGAAGAACTTAAAGCCCAAATCGGGGAACTGCTCAGCATCGTGGATGCACTTAGGAAAGAACATAGGAAAGAGATGGATCACCTAAAGAAAGAGCTGGAAGAGGAGCGATTGTTACGGACCAGTTTAGAGACTGAGGTTGACAAGCTGAAGAAGGCAGTCCAGTTAACATGAGGCGGCCATTTTGTTAATGGCACCAGTCCAGATTAAAGTCCACGTCAGATATTTAATGCTGTCTCCTCTTTTCCTCGAGTTCATGGAAGCATGGTTCAACGATCCTCTGGCGCTTTCCTCTCGTTGCTTTGCCAATGGAATTAAAGAGGCCTTATCTCCTTACTGTGCTGGAGTGGCAGACCCTCGGACAACGGTTTGCTTCAAGATACTACTGAGTTTATGTACAAAGCGGGGATTCTGTACGAATTTTATTGAAAACTTATGTAATTTTTTTTTTTTTTTTTAAAATGCTCTGAATACGGTGATATATATATATCTTTAGATATAATCTGTAATATAGCCTAACGGGGGGATACGATAGCCTTAGATTAATAACCACTCGTCACGGGAAGCAAAAACGATCATGTTCTTTTGTATATTTTAGACTTCTTATCCAGGGTTACACACTGCTGTGCCTGTCTGCGGCCCAGTATTATTGCATTGTGTAAAATTAGATTTCTATCGGCCGGTTGTTGATACTGTATGTAGGAAGGCAATTCCCCTACGCATATAAGCGAGAAGAATTGCTACTTTGTGTTTTTAATTGGAGAGCTTGTTTACGTCACTTTGGCACAAGAGAGAACTTTCAAGGGATTTGGTTCAATGGTACTGGGAGCTTTGACCACTTACCATGGATAGGAGACAGCTTGAAGGGGGACTCCTTTCTTATAAAACACCACTCTAATTGTTTGTCG
  5   1   2      ests                                 Xt7.1-CABI6512.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGCCTAACGGGGGGATACGATAGCCTTAGATTAATAACCACTCGTCACGGGAAGCAAAAACGATCATGTTCTTTTGTATATTTTAGACTTCTTATCCAGGGTTACACACTGCTGTGCCTGTCTGCGGCCCAAGTATTAATTGCATTGTGTATAATTAGATTTCTATCGGCCGGTTGTTGATACTGTATGTAGGAGGCAATTCCCCTACGCATATAAGCGAGAAGAATGCTACTTTGTGTTTTTAATGGAGAGCTTGTTACGTCACTTTGCACAAGGAGAACTTCAAGGGATTTGGGTCATTGTACTGGAGCTTTGCACTTACACTGGAATAGGGAGCAGCTTGGAGGGGGGTACTCCTTTCTTATAACACCACCTATTTTGGGGGGGACCAACAGACTCCAAAAGGGGGACGGGGACTTCCTTGGGGCATTGGTGGAATTAGGGAACAGCCTAAGCAGATCAGAGGTGTAATATTTCCTATATTTATGGGCGTATTAATGTGCATTGGGTACCAAGAGTAGGGGAGGGGTCTTCTTAGCTTGAAAATGTCCCTTTGTAAAGGGCCGACTCTTAGCATTCAGCTCTCAAGGAATGCTGGGAGTTTTATTTTTTTTAACTGGATTTAGGGGTGTTGGCCTTAATACCCTGGGACCCTTCTTCCTGACATTGGACCCAGAAGCAAAATCATTTTCAGTGAGTTCCTTTCTATTTAAATTCCTGTACAGGTCGACGAACGCTAGATTTTTAGCAGGATGGTGCCCTTTTATAGGCAAGTAAACCTTGCGCCACCATATGTTCTATACTCTTTTATTTCTATAGCTTAAAAGATATTGGCTTCTGAACCCTTCCCCCAGTCGTACCTTGCTGATCATCAGTGTCCCAGTGAGCCGCTGTAATGTGGCCAATACTAATGAAACTGGGGGCCCTCCTTCTAAGAAACTTGTAGTGCAAACGGGAAGACAGAATAAAGTTATCTGATGAAAGTGTACTACTTTATCCAGTTACCACTTACCAACCAATCCCTTGCTGCGAAAGGAGAAGTATCATCTGTTATAACATGATCTTTATCAGAGAGATTTCCTTATTGGTTAAAATGAGGCTCAGGGTTTGAAGATCACTTGCAGTACCTTTTTCCACCAGTGCTGGCAGTGTTTCCAACAGAACTGTGCCTCGACTATAGACAAGCTGCAACCCTTGTACAAAGCACCTCCCAGATGTTCTAGACCCTTTTTACTAAACAGAGTAAAGCCATACAGAGAGAAATGGTACCTCCCTTTTATATATATATTTTTTATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTATGGGGAGGGGGGATTTCTAGCCATAAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCAGTTAATAAAATGATTGAATTTTCAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008226730                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACGGGGGGATACGATAGCCTTAGATTAATAACCACTCGTCACGGGAAGCAAAAACGATCATGTTCTTTTGTATATTTTAGACTTCTTATCCAGGGTTACACACTGCTGTGCCTGTCTGCGGCCCAAGTATTAATTGCATTGTGTATAATTAGATTTCTATCGGCCGGTTGTTGATACTGTATGTAGGAGGCAATTCCCCTACGCATATAAGCGAGAAGAATGCTACTTTGTGTTTTTAATGGAGAGCTTGTTACGTCACTTTGCACAAGGAGAACTTCAAGGGATTTGGGTCATTGTACTGGAGCTTTGCACTTACACTGGAATAGGGAGCAGCTTGGAGGGGGGTACTCCTTTCTTATAACACCACCTATTTTGGGGGGGACCAACAGACTCCAAAAGGGGGACGGGGACTTCCTTGGGGCATTGGTGGAATTAGGGAACAGCCTAAGCAGATCAGAGGTGTAATATTTCCTATATTTATGGGCGTATTAATGTGCATTGGGTACCAAGAGTAGGGGAGGGGTCTTCTTAGCTTGAAAATGTCCCTTTGTAAAGGGCCGACTCTTAGCATTCAGCTCTCAAGGAATGCTGGGAGTTTTATTTTTTTTAACTGGATTTAGGGGTGTTGGCCTTAATACCCTGGGACCCTTCTTCCTGACATTGGACCCAGAAGCAAAATCATTTTCAGTGAGTTCCTTTCTATTTAAATTCCTGTACAGGTCGACGAACGCTAGATTTTTAGCAGGATGGTGCCCTTTTATAGGCAAGTAAACCTTGCGCCACCATATGTTCTATACTCTTTTATTTCTATAGCTTAAAAGATATTGGCTTCTGAACCCTTCCCCCAGTCGTACCTTGCTGATCATCAGTGTCCCAGTGAGCCGCTGTAATGTGGCCAATACTAATGAAACTGGGGGCCCTCCTTCTAAGAAACTTGTAGTGCAAACGGGAAGACAGAATAAAGTTATCTGATGAAAGTGTACTACTTTATCCAGTTACCACTTACCAACCAATCCCTTGCTGCGAAAGGAGAAGTATCATCTGTTATAACATGATCTTTATCAGAGAGATTTCCTTATTGGTTAAAATGAGGCTCAGGGTTTGAAGATCACTTGCAGTACCTTTTTCCACCAGTGCTGGCAGTGTTTCCAACAGAACTGTGCCTCGACTATAGACAAGCTGCAACCCTTGTACAAAGCACCTCCCAGATGTTCTAGACCCTTTTTACTAAACAGAGTAAAGCCATACAGAGAGAAATGGTACCTCCCTTTTATATATATATTTTTTATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTATGGGGAGGGGGGATTTCTAGCCATAAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCAGTTAATAAAATGATTGAATTTTCAAAAAAAAAAAA
  5   1   2       bld Limb      out                       CBSU1136.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAATCAGATGTGACTGACAGTAAGAAGAGCGAAAAGAGTGAAATGGAAGAACTTAAAGCCCAAATCGGGGAACTGCTCAGCATCGTGGATGCACTTAGGAAAGAACATAGGAAAGAGATGGATCACCTAAAGAAAGAGCTGGAAGAGGAGCGATTGTTACGGACCAGTTTAGAGACTGAGGTTGACAAGCTGAAGAAGGCAGTCCAGTTAACATGAGGCGGCCATTTTGTTAATGGCACCAGTCCAGATTAAAGTCCACGTCAGATATTTAATGCTGTCTCCTCTTTTCCTCGAGTTCATGGAAGCATGGTCCAACGATCCTCTGGCGCTTTCCTCTCGTTGCTTTGCCAATGGAATTAAAGAGGCCTTATCTCCTTACTGTGCTGGAGTGGCAGACCCTCGGACAACGGTTTGCTTCAAGATACTACTGAGTTTATGTACAAAGCGGGGATTCTGTACGAATTTTATTGAAAACTTATGTAATTTTTTTTTTTTTTAAATGCTCTGAATACGGTGATATATATATATCTTTAGATATAATCTGTAATATAGCCTAACGGGGGGATACGATAGCCTTAGATTAATAACCACTCGTCACGGGAAGCAAAAACGATCATGTTCTTTTGTATATTTTAGACTTCTTATCCAGGGTTACACACTGCTGTGCCTGTCTGCGGCCCAAGTATTAATTGCATTGTGTATAATTAGATTTCTATCGGCCGGTTGTTGATACTGTATGTAGGAGGCAATTCCCCTACGCATATAAGCG
  5   1   2       bld HdA                            THdA034h22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGACCCTCGGACACGGTTGCTTCACATTTACTGAGTTTTGTCAAAGCGGGGATTCTGTACGAATTTTATTGAAAACTTATGTAATTTTTTTTTTTTTTTTTAAATGCTCTGAATACGGTGATATATATATATCTTTAGATATAATCTGTAATATAGCCTAACGGGAGGGATACGATAGCCTTAAATTAATAACCACTCGTCACGGGAAGCAAAAACGATCATGTTCTTTTGTATATTTTAGACTTCTTATCCAGGGTTACACACTGCTGTGCCTGTCTGCGGCCCATAGTATTAATTGCATTGTGTATAATTAGATTTCTATCGGCCGGTTGTTGATACTGTATGTAGGAGGCATTTCCCCTACGCATATTAGCGAGAAGAATGCTACTTTGTGTTTTTAATGAAGAGCTTGTTACGTCGCTTTGCACGAAGAGAACTTCAAGGGATTTGGGTCATTGTACTGGATCTTTGCTCTTAC
  3  -1   2       bld Gas8      in                          st64l02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATCTGTAATATAGCCTAACGGGGGGATACGATAGCCTTAGATTAATAACCACTCGTCACGGGAAGCAAAAACGATCATGTTCTTTTGTATATTTTAGACTTCTTATCCAGGGTTACACACTGCTGTGCCTGTCTGCGGCCCAAGTATTAATTGCATTGTGTATAATTAGATTTCTATCGGCCGGTTGTTGATACTGTATGTAGGAGGCAATTCCCCTACGCATATAAGCGAGAAGAATGCTACTTTGTGTTTTTAATGGAGAGCTTGTTACGTCACTTTGCACAAGGAGAACTTCAAGGGATTTGGGTCATTGTACTGGAGCTTTGCACTTACACTGGAATAGGGAGCAGCTTGGAGGGGGGTACTCCTTTCTTATAACACCACCTATTTTGGGGGGGACCAACAGACTCCAAAAGGGGGACGGGGACTTCCTTGGGGCATTGGTGGAATTAGGGAACAGCCTAAGCAGATCAGAGGTGTAATATTTCCTATATTTATGGGCGTATTAATGTGCATTGGGTACCAAGAGTAGGGGAGGGGTCTTCTTAGCTTGAAAATGTCCCTTTGTAAAGGGCCGACTCTTAGCATTCAGCTCTCAAGGAATGCTGGGAGTTTTATTTTTTTTTAACTGGATTTAGGGGTGTTGGCCTTAATACCCTGGGACCCTTCTTCCTGACATTGGACCCAGAAGCAAAATCATTTTCAGTGA
  5   1   2       bld Spl1      in                         CABK3890.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTTAGATTAATAACCACTCGTCACGGGAAGCAAAAACGATCATGTTCTTTTGTATATTTTAGACTTCTTATCCAGGGTTACACACTGCTGTGCCTGTCTGCGGCCCAAGTATTAATTGCATTGTGTATAATTAGATTTCTATCGGCCGGTTGTTGATACTGTATGTAGGAGGCAATTCCCCTACGCATATAAGCGAGAAGAATGCTACTTTGTGTTTTTAATGGAGAGCTTGTTACGTCACTTTGCACAAGGAGAACTTCAAGGGATTTGGGTCATTGTACTGGAGCTTTGCACTTACACTGGAATAGGGAGCAGCTTGGAGGGGGGTACTCCTTTCTTATAACACCACCTATTTTGGGGGGGACCAACAGACTCCAAAAGGGGGACGGGGACTTCCTTGGGGCATTGGTGGAATTAGGGAACAGCCTAAGCAGATCAGAGGTGTAATATTTCCTATATTTATGGGCGTATTAATGTGCATTGGGTACCAAGAGTAGGGGAGGGGTCTTCTTAGCTTGAAAATGTCCCTTTGTAAAGGGCCGACTCTTAGCATTCAGCTCTCAAGGAATGCTGGGAGTTTTATTTTTTTTAACTGGATTTAGGGGTGTTGGCCTTAATACCCTGGGACCCTTCTTCCTGACATTGGACCCAGAAGCAAAATCATTTTCAGTGAGTTCCTTTCTATTTAAATTCCTGTACAGGTCGACGAACGCTAGATTTTTAGCAGGATGGTGCCCTTTTATAGGCAAGTAAACCTTGCGCCACCATATGTTCTATACTCTTTTATTTCTATAGCTT
  5   1   2       bld Neu       out                  TNeu108e04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGAAGCAAAAACGATCATGTTCTTTTGTATATTTTAGACTTCTTATCCAGGGTTACACACTGCTGTGCCTGTCTGCGGCCCAAGTATTAATTGCATTGTGTATAATTAGATTTCTATCGGCCGGTTGTTGATACTGTATGTAGGAGGCAATTCCCCTACGCATATAAGCGAGAAGAATGCTACTTTGTGTTTTTAATGGAGAGCTTGTTACGTCACTTTGCACAAGGAGAACTTCAAGGGATTTGGGTCATTGTACTGGAGCTTTGCACTTACACTGGAATAGGGAGCAGCTTGGAGGGGGGTACTCCTTTCTTATAACACCACCTATTTTGGGGGGGACCAACAGACTCCAAAAGGGGGACGGGGACTTCCTTGGGGCATTGGTGGAATTAGGGAACAGCCTAAGCAGATCAGAGGTGTAATATTTCCTATATTTATGGGCGTATTAATGTGCATTGGGTACCAAGAGTAGGGGAGGGGTCTTCTTAGCTTGAAAATGTCCCTTTGTAAAGGGCCGACTCTTAGCATTCAGCTCTCAAGGAATGCTGGGAGTTTATTTTTTTTAACTGGAT
  5   1   2       bld TpA       out                  TTpA069d01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACTGCTGTGCCTGTCTGCGGCCCAAGTATTAATTGCATTGTGTATAATTAGATTTCTATCGGCCGGTTGTTGATACTGTATGTAGGAGGCAATTCCCCTACGCATATAAGCGAGAAGAATGCTACTTTGTGTTTTTAATGGAGAGCTTGTTACGTCACTTTGCACAAGGAGAACTTCAAGGGATTTGGGTCATTGTACTGGAGCTTTGCACTTACACTGGAATAGGGAGCAGCTTGGAGGGGGGTACTCCTTTCTTATAACACCACCTATTTTGGGGGGGACCAACAGACTCCAAAAGGGGGACGGGGACTTCCTTGGGGCATTGGTGGAATTAGGGAACAGCCTAAGCAGATCAGAGGTGTAATATTTCCTATATTTATGGGCGTATTAATGTGCATTGGGTACCAAGAGTAGGGGAGGGGTCTTCTTAGCTTGAAAATGTCCCTTTGTAAAGGGCCGACTCTTAGCATTCAGCTCTCAAGGAATGCTGGGAGTTTTATTTTTTTTAACTGGATTTAGGGGTGTTGGCCTTAATACCCTGGGACCCTTCTTCCTGACATTGGACCCAGAAGCAAAATCATTTTCAGTGAGTTCCTTTCTATTTAAATTCCTGTACAGGTCGACGAACGCTAGATTTTTAGCAGGATGGTGCCCTTTTATAGGCAAGTAAACCTTGCGCCACCATATGTTCTATACTCTTTTATTTCTATAGCTTAAAAGATATTGGCTTCTGAACCCTTCCCCCAGTCGTACCTTGCTGATCATCAGTGTCCCAGCGAGCCGCTGTAATGTGGCCAATACTAATGAAACTGGNGGCCCTCCTTCTAAGANACTTGTAGTGCANACGGGGAGACAGAATAAGTTATCTGATGAAAGTGTACTACTTTATCCAGTTACC
  5   1   2       bld Gas7                                 XZG19510.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGCAATTCCCCTACGCATATAAGCGAGAAGAATGCTACTTTGTGTTTTTAATGGAGAGCTTGTTACGTCACTTTGCACAAGGAGAACTTCAAGGGATTTGGGTCATTGTACTGGAGCTTTGCACTTACACTGGAATAGGGAGCAGCTTGGAGGGGGGTACTCCTTTCTTATAACACCACCTATTTTGGGGGGGACCAACAGACTCCAAAAGGGGGACGGGGACTTCCTTGGGGCATTGGTGGAATTAGGGAACAGCCTAAGCAGATCAGAGGTGTAATATTTCCTATATTTATGGGCGTATTAATGTGCATTGGGTACCAAGAGTAGGGGAGGGGTCTTCTTAGCTTGAAAATGTCCCTTTGTAAAGGGCCGACTCTTAGCATTCAGCTCTCAAGGAATGCTGGGAGTTTTATTTTTTTTAACTGGATTTAGGGGTGTTGGCCTTAATACCCTGGGACCCTTCTTCCTGACATTGGACCCAGAAGCAAAATCATTTTCAGTGAGTTCCTTTCTATTTAAATTCCTGTACAGGTCGACGAACGCTAGATTTTTAGCAGGATGG
  5   1   2       bld Gas       in                   TGas097i20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGGAGGGGGGTACTCCTTTCTTATAACACCACCTATTTTGGGGGGGGACCAACAAACTCCAAAAGGGGGACGGGGACTTCCTTGGGGCATTGGTGGAATTAGGGAACAGCCTAAGCAAATCAAAGGTGTAATATTTCCTATATTTATGGGCGTATTAATGTGCATTGGGTACCAAGAGTAGGGGAGGGGTCTTCTTAGCTTGAAAATGTCCCTTTGTAAAGGGCCGACTCTTAGCATTCAGCTCTCAAGGAATGCTGGGAGTTTTATTTTTTTTAACTGGATTTAGGGGTGTTGGCCTTAATACCCTGGGACCCTTCTTCCTGACATTGGACCCAGAAGCAAAATCATTTTCAGTGAGTTCCTTTCTATTTAAATTCCTGTACAGGTCGACGAACGCTAGATTTTTAGCAGGATGGTGCCCTTTTATAGGCAAGTAAACCTTGCGCCACCATATGTTCTATACTCTTTTATTTCTATAGCTTAAAAGATATTGGCTTCTGAACCCTTCCCCCAGTCGTACCTTGCTGATCATCAGTGTCCCAGTGAGCCGCTGTAATGTGGCCAATACTAATGAAACT
  5   1   2       bld In54                            IMAGE:8943334.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACCCGGTGATTCAAGAGGAGACCGTCGATTCGAATTCGTCCCAGCCTAAGCAGATCAGAGGTGTAATATTTCCTATATTTATGGGCGTATTAATGTGCATTGGGTACCAAGAGTAGGGGAGGGGTCTTCTTAGCTTGAAAATGTCCCTTTGTAAAGGGCCGACTCTTAGCATTCAGCTCTCAAGGAATGCTGGGAGTTTTATTTTTTTTAACTGGATTTAGGGGTGTTGGCCTTAATACCCTGGGACCCTTCTTCCTGACATTGGACCCAGAAGCAAAATCATTTTCAGTGAGTTCCTTTCTATTTAAATTCCTGTACAGGTCGACGAACGCTAGATTTTTAGCAGGATGGTGCCCTTTTATAGGCAAGTAAACCTTGCGCCACCATATGTTCTATACTCTTTTATTTCTATAGCTTAAAAGATATTGGCTTCTGAACCCTTCCCCCAGTCGTACCTTGCTGATCATCAGTGTCCCAGCGAGCCGCTGTAATGTGGCCATACTAATGAAACTGGGGGCCCTCCTTCTAAGAAACTTGTAGTGCAACGGGAGACGAATAAAGTTATCTGATGAAAGTGTACTACCTTATCCAGTTACCACTTACCACCATTCCTTGCCTGGGAAAGAGAGAGTATCCACTCTGTTTAATAAAATAAATTCTTTTTCAGAGAGATTTCTTTATTGGTTTAAAATGAGGGCTCACGGCTTGGAAATACTTGCGTTACCCTTTCCCAGTCTGGCAGGTTCCAGAACTGTGTCCTCGCATTAACACCTGACACCTGTCAGACCTCAGTTCTGCTTTTCAGAGGTAGGCCCTCAGAGAAGT
  5   1   2       bld Brn2      in                        CAAJ14603.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTTCTTAGCTTGAAAATGTCCCTTTGTAAAGGGCCGACTCTTAGCATTCAGCTCTCAAGGAATGCTGGGAGTTTTATTTTTTTTAACTGGATTTAGGGGTGTTGGCCTTAATACCCTGGGACCCTTCTTCCTGACATTGGACCCAGAAGCAAAATCATTTTCAGTGAGTTCCTTTCTATTTAAATTCCTGTACAGGTCGACGAACGCTAGATTTTTAGCAGGATGGTGCCCTTTTATAGGCAAGTAAACCTTGCGCCACCATATGTTCTATACTCTTTTATTTCTATAGCTTAAAAGATATTGGCTTCTGAACCCTTCCCCCAGTCGTACCTTGCTGATCATCAGTGTCCCAGTGAGCCGCTGTAATGTGGCCAATACTAATGAAACTGGGGGCCCTCCTTCTAAGAAACTTGTAGTGCAAACGGGAAGACAGAATAAAGTTATCTGATGAAAGTGTACTACTTTATCCAGTTACCACTTACCAACCAATCCCTTGCTGCGAAAGGAGAAGTATCATCTGTTATAACATGATCTTTATCAGAGAGATTTCCTTATTGGTTAAAATGAGGCTCAGGGTTTGAAGATCACTTGCAGTACCTTTTTCCACCAGTGCTGGCAGTGTTTCCAACAGAACTGTGCCTCGACTATAGACAAGCTGCAACCCTTGTACAAAGCACCTCCCAGATGTTCTAGACCCTTTTTACTAAACAGAGTAAAGCCATACAGAGAGAAATGGTACCTCCCTTTTATATATATATTTTTTATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTANAACGTTCACGAATATAGTCAAATATATTGTATT
  5   1   2       bld Gas7      in                         XZG12413.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAAATCATTTTCAGTGAGTTCCTTTCTATTTAAATTCCTGTACAGGTCGACGAACGCTAGATTTTTAGCAGGATGGTGCCNCTTTTATAGGCAAGTAAACCTTGCGCCACCATATGTTCTATACTCTTTTATTTCTATAGCTTAAAAGATATTGGCTTCTGAACCCTTCCCCCAGTCGTACCTTGCTGATCATCAGTGTCCCAGCGAGCCGCTGTAATGTGGCCAATACTAATGAAACTGGGGGCCCTCCTTCTAAGAAACTTGTAGTGCAAACGGGAAGACAGAATAAAGTTATCTGATGAAAGTGTACTACTTTATCCAGTTACCACTTACCAACCAATCCCTTGCTGCGAAAGGAGAAGTATCATCTGTTATAACATGATCTTTATCAGAGAGATTTCCTTATTGGTTAAAATGAGGCTCAGGGTTTGGAGATCACTTGCAGTACCCTTTTCCACCAGTGCTGGCAGTGTTTCCAACAGAACTGTGCCTCGACTATAGACAAGCTGCAACCCTTGTACAAAGCACCTCCCCCATGTTCTAGACCCTTTTTACTAAACAGAGTAAAGCCATACAGAGAGAAATGGTACCTCCCTTTTATATATATATTTTTTATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTG
  5   1   2       bld Ova1      in                        CABE11113.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAACCTTGCGCCACCATATGTTCTATACTCTTTTATTTCTATAGCTTAAAAGATATTGGCTTCTGAACCCTTCCCCCAGTCGTACCTTGCTGATCATCAGTGTCCCAGTGAGCCGCTGTAATGTGGCCAATACTAATGAAACTGGGGGCCCTCCTTCTAAGAAACTTGTAGTGCAAACGGGAAGACAGAATAAAGTTATCTGATGAAAGTGTACTACTTTATCCAGTTACCACTTACCAACCAATCCCTTGCTGCGAAAGGAGAAGTATCATCTGTTATAACATGATCTTTATCAGAGAGATTTCCTTATTGGTTAAAATGAGGCTCAGGGTTTGAAGATCACTTGCAGTACCTTTTTCCACCAGTGCTGGCAGTGTTTCCAACAGAACTGTGCCTCGACTATAGACAAGCTGCAACCCTTGTACAAAGCACCTCCCAGATGTTCTAGACCCTTTTTACTAAACAGAGTAAAGCCATACAGAGAGAAATGGTACCTCCCTTTTATATATATATTTTTTATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGNTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTG
  5   1   2       bld Eye       in                         CCAX2553.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGTCCCAGTGAGCCGCTGTAATGTGGCCAATACTAATGAAACTGGGGGCCCTCCTTCTAAGAAACTTGTAGTGCAAACGGGAAGACAGAATAAAGTTATCTGATGAAAGTGTACTACTTTATCCAGTTACCACTTACCAACCAATCCCTTGCTGCGAAAGGAGAAGTATCATCTGTTATAACATGATCTTTATCAGAGAGATTTCCTTATTGGTTAAAATGAGGCTCAGGGTTTGAAGATCACTTGCAGTACCTTTTTCCACCAGTGCTGGCAGTGTTTCCAACAGAACTGTGCCTCGACTATAGACAAGCTGCAACCCTTGTACAAAGCACCTCCCAGATGTTCTAGACCCTTTTTACTAAACAGAGTAAAGCCATACAGAGAGAAATGGTACCTCCCTTTTATATATATATTTTTTATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTAC
  5   1   2       bld TbA                            TTbA031a15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTTATCCAGTTACCACTTACCAACCAATCCCTTGCTGTGAAAGGAGAAGTATCATCTGTTATAAAATGATCTTTATCAGAGAGATTTCCTTATTGGTTAAAATGAGGCTCAGGGTTTGGAGATCACTTGCAGTACCCTTTTCCACCAGTGCTGGCAGTGTTTCCAACAGAACTGTGCCTCGACTATAGACAAGCTGCAACCCTTGTACAAAGCACCTCCCAGATGTTCTAGACCCTTTTTACTAAACAGAGTAAAGCCATACAGAGAGAAATGGTACCTCCCTTTTATATATATATTTTTTTTATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACAATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGTGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTT
  5   1   2       bld Tad5      in                         XZT60070.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTTTATCCAGTTACCACTTACCAACCAATCCCTTGCTGCGAAAGGAGAAGTATCATCTGTTATAACATGATCTTTATCAGAGAGATTTCCTTATTGGTTAAAATGAGGCTCAGGGTTTGAAGATCACTTGCAGTACCTTTTTCCACCAGTGCTGGCAGTGTTTCCAACAGAACTGTGCCTCGACTATAGACAAGCTGCAACCCTTGTACAAAGCACCTCCCAGATGTTCTAGACCCTTTTTACTAAACAGAGTAAAGCCATACAGAGAGAAATGGTACCTCCCTTTTATATATATATTTTTTATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTGCATAGCAATAAAATTGA
  3   1   2       bld Spl1      in                         CABK3890.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTGCTGGCAGTGTTTCCAACAGAACTGTGCCTCGACTATAGACAAGCTGCAACCCTTGTACAAAGCACCTCCCAGATGTTCTAGACCCTTTTTACTAAACAGAGTAAAGCCATACAGAGAGAAATGGTACCTCCCTTTTATATATATATTTTTTATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTATGGGGAGGGGGGATTTCTAGCCATAAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCCAGTTAATAAAATGATTGNAATTTTCAC
  3   1   2       bld Ovi1                                 CABI6512.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCAGTGTTCCCAACAGAACTGTGCCTCGACTATAGACAAGCTGCAACCCTTGTACAAAGCACCTCCCAGATGTTCTAGACCCTTTTTACTAAACAGAGTAAAGCCATACAGAGAGAAATGGTACCTCCCTTTTATATATATATTTTTTATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTATGGGGAGGGGGGATTTCTAGCCATAAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATACTGCATGCTTACAGAGCAGTTAATAAAATGATTGAATTTTCAC
  3   1   2       bld Neu  5x3  ?                     TNeu108c02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAGTGTTTCCAACAGAACTGTGCCTCGACTATAGACAAGCTGCAACCCTTGTACAAAGCACCTCCCAGATGTTCTAGACCCTTTTTACTAAACAGAGTAAAGCCATACAGAGAGAAATGGTACCTCCCTTTTATATATATATTTTTTATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTAAGGGGAGGGGGGATTTCTAGCCATAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCAGTTAATAAAATGATGAATTTCACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Int1      in                         CAAP1411.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAATGGCACCAGTCCAGATTAAAGTCCACGTCAGATATTTAATGCTGTCTCCTCTTTTCCTCGAGTTCATGGAAGCATGGTCCAACGATCCTCTGGCGCTTTCCTCTCGTTGCTTTGCCAATGGAATTAAAGAGGCCTTATCTCCTTACTGTGCTGGAGTGGCAGACCCTCGGACAACGGTTTGCTTCAAGATACTACTGAGTTTATGTACAAAGCGGGGATTCTGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTATGGGGAGGGGGGATTTCTAGCCATAAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTAAAAATGACTGTTACAGGTGCTG
  3   1   2       bld Gas       in                    TGas097i20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTATAGACAAGCTGCAACCCTTGTACAAAGCACCTCCCAGATGTTCTAGACCCTTTTTACTAAACAGAGTAAAGCCATACAGAGAGAAATGGTACCTCCCTTTTATATATATATTTTTTATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTAAGGGGAGGGGGGATTTCTAGCCATAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCAGTTAATAAAATGATGAATTTAAAAAAAAAAAAAAAAAA
  3   1   2      seed Ova1      in                        CABE11113.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTATAGACAAGCTGCAACCCTTGTACAAAGCACCTCCCAGATGGTCTAGACCCTTTTTACTAAACAGAGTAAAGCCATACAGAGAGAAATGGTACCTCCCTTTTATATATATATTTTTTATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTATGGGGAGGGGGGATTTCTAGCCATAAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCAGTTAATAAAATGATTGAATTTTCACAAT
  5   1   2       bld Gas8      in                          st33l20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGCACCTCCCAGATGTTCTAGACCCTTTTTACTAAACAGAGTAAAGCCATACAGAGAGAAATGGTACCTCCCTTTTATATATATATTTTTTATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTG
  3   1   2       bld Tad5      in                         XZT52587.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAAACAGAGTAAAGCCATACAGAGAGAAATGGTACCTCCCTTTTATATATATATTTTTTTTTATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACAATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGTGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTATGGGGAGGGGGGATTTCTAGCCATAAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCAGTTAATAAAATGATTGAATTTTCACAAAAAAAAAAAAAAAGG
  3   1   2       bld Brn2      in                        CAAJ14603.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGTAAAGCCATACAGAGAGAAATGGTACCTCCCTTTTATATATATATTTNTTATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCATGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTAAGGGGAGGGGGGATTTCTAGCCATAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCAGTTAATAAAATGATTGAATTTTCAC
  3   1   2       bld Brn3      in                         CAAK4650.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATATATTTTTTATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCATGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTAAGGGGAGGGGGGATTTCTAGCCATAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCAGTTAATAAAATGATTGAATTTTCAC
  3   1   2       bld TpA                             TTpA021c12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTTATCCAGNGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTAAGGGGAGGGGGGATTTCTAGCCATAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCAGTTAATAAAATGATGAATTTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te3  5g3  in                         CAAM1464.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTTATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCATGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTAAGGGGAGGGGGGATTTCTAGCCATAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCAGTTAATAAAATGATTGAATTTTC
  3   1   2       bld Te3  PIPE in                         CAAM6737.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCCAGTGCATGTATGTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCATGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTAAGGGGAGGGGGGATTTCTAGCCATAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACACCGCAGTTAATAAAATGATTGAATTTTCACAAT
  3   1   2       bld Limb      in                       CBSU10345.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGACGGCATCTCCGATCAGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTATGGGGAGGGGGGATTTCTAGCCATAAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCAGTTAATAAAATGATTGAATTTTCAC
  3   1   2       bld Gas7      in                         XZG12413.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCAGCTTAAGGATGATCTAAAACGTTCACGAAAATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCATATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGATGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTAAGGGGAGGGGGGATTTCTAGCCATAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTG
  3   1   2       bld Egg  5g3  in                    TEgg075p12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCTTAAGGATGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGATGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTAAGGGGAGGGGGGATTTCTAGCCATAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCAGTTAATAAAATGATTGAATTTTCAAAAAAAAAAAAAAGGAAAAAAAAA
  3   1   2       bld Eye       in                         CCAX2553.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGATCTAAAACGTTCACGAATATAGTCAAATATATTGTATTCTAGGATATTTTTTTACCAGTACGATTGGATGCTATGGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTAAGGGGAGGGGGGATTTCTAGCCATAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCAGTTAATAAAATGATTGAATTTTC
  3   1   2       bld Egg       in                    TEgg018b06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTTACCAGTACGATTGGATGCTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTCTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTATGGGGAGGGGGGATTTCTAGCCATAAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCAGTTAATAAAATGATTGAATTTTCAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg018a05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTGGATGTTATTGGCTGCTCGGATTATACCCAATCAGGAACTGAGCCTCTTGTTTCCAAGATTCCTTTGCAGATTCCATGCTGACCTCTCTATCAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATACTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTATGGGGAGGGGGGATTTCTAGCCATAAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCAGTTAATAAAATGATGAATTTTCAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT60070.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGCACGGGTGGCCTAAGCTTCTCCAGGAGTTGTAATATTACAACACTTCACCTCCCAAAGACTCCCGACAGGGTGCTGAGAGTTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCCCCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTCCAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGGGATGATTTAACTAGTAAATTTTTTATAAGCTGCTATGGGGAGGGGGGATTTCTAGCCATAAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTCCAGAGCAGTTAATAAAATGATTGAATTTTCC
  5   1   2       bld Egg       in                   TEgg072d20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGAAGTTTGGCAATAAATGGCCCAAAGAGCTGCCTGTTCCGTACTGACCATATTGCGCGGTGCACCTTGAGCGACAGACTGAGCAGTTCCGGCGCTGGGAATAGCAATCTGCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTATAACAATGGAATGGCCTTGGTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTATGGGGAGGGGGGATTTCTAGCCATAAAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCAGTTAATAAAATGATTGAATTTTCAC
  3   1   2       bld Egg       in                    TEgg072d20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGAAGTTTGGCAATAAATGCCCCAAAGAGCTGCCTGTTCCGTACTGCCCATATTGCGCGGTGCCCCTTGAGCGACAGATGGAGCAGTTCCGGCGCTGGGAATAGCAATCCCCATGTAGGCTTGGGGGCCGGCGAGACAATCCGTTTCAACTGAACTGTACAGTTTAACAATGGAAGGGCCTGGGTTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTGGTAAATTTTTTGTAAGCTGCTATGGGGAGGGGGGATTTTTACCCTTAAAAAAATAAATTCCACTAATATCTTTCCTTTGAAAGATTTATACGAAAACTTTCCAGGGGTTTCAAAAATCAGCGCGTAAAAAAAGACTGTTTACAGGTGCTGTTAAATAATGCAGATAACAGAGCAGTTAAAAAAAAAAGGAATTTTCACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas8      in                          st33l20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ANGGNATGGCCNTGGNTTTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTATGGGGAGGGGGGATTTCTAGCCATAAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACCAGGTGCTGTAAATAATGC
  5  -1   2       bld Gas8      in                          st64l02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTTTTTTTGCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTATGGGGAGGGGGGATTTCTAGCCATAAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCAGTTAATAAAATGAT
  3   1   2       bld Gas       in                    TGas066k02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCATAGCAATAAAATTGAAAAACAAAAGTGCAATGAGATGATTTAACTAGTAAATTTTTTATAAGCTGCTAAGGGGAGGGGGGATTTCTAGCCATAAAAAAAATTACACTAATATCTTTACTTTGAAAGATTTATACGAAAACATTCCAAGAGCTTCAGAAATCAGCGCGTAAAAATGACTGTTTACAGGTGCTGTTAAATAATGCATGCTTACAGAGCAGTAATAAAATGATGAATTTCACAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)