Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAN3464.5                            4 END     3          11      100                Potassium voltage-gated channel KQT-like protein 4 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012154678 Xt7.1-CAAN3464.3.5 - 26 ESTs
                                                                       .........-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAN3464.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGGCATTATGATAGAATGATGAAATGTAAAATAGAGTAAGTTATATAGGTAGCATTATCTCCACCGATGTAAAGTGTAAGTACCTCACAGCTACATGGTATTACTATGACAGCATCCTACCTTCCTTCAGAGAGCTGCTCCTTTTGTTTGATACCTGGCATCGAACCTGCAGCCGAAATGGAGGGGTTAGGCTCTGTCAGGGGTCTCCTCGCTATCAGCCAGTCCCCTCCACCCCGAAACCTGCAACACCCCCTTTCTGTACTGGGGAAAGTAGTAAATTGGGCTTGAAAGACCGGATGCGAGGCACAGTTGCACCAAAACAGACCACACGAAGCAAGCAGTACCTGGCCCCACCAGAGCGGGCTTCACCCGGTACAGAGCCTGCAGCAGAGACTCCCAGCCCTACAAAAGTGCAAAAAAGTTGGAGCTTTAATGACCGCACAAGATTCCGTGCATCACTAAGACTAAAATCAAGGCCACAGGCTGATGAGGGTCCTGGAGACGACATTAATGATGAAAAGAGACTTCCAAATGATTTGACCATGGAGGATGTGATGCCAACTATAAAAACCCTGATTCGAGCCTTTAGAATCCTTAAATTCCTTGTGGCAAAGAGGAAGTTTAAGGAGACTCTACGGCCATATGATGTGAAGGATGTAATTGAGCAGTATTCAGCTGGACATTTGGATATGCTTGGGCGCATTAAGAGCCTGCAGGGCAGGGTGGATCAGATCATTGGCCGGGGGCCTGTGCCGGTAGAGAAAAAACCTAGAGATAAAGGAGAGAAGGTTTCCACCATGGGTCCTGAAGTTGAAGCTGCTGATGAGCTAAGCATGATGGGAAGGGTAGTAAAGGTTGAGAGACAGGTCCAGAGCATTGAAGATAAACTTGATATACTTCTAGGTTTCTACTCTCAGTGTATCCGGAAAGGTCCAGCAAGCTCTTTTACATTGACCTCTATGCAAATGCCATTGATTGACCAAGAAATGACATCTGATTACCAGAGCCCTGTGGATCCAGTGGACTTTTCAGTGTCAGCCCAGACACTTAATATATCTCATTCTGCCAGCACCAACATGGAGTGAGAAAGATGGAGCAATAGGGTAAGTTGTGACCATATTACCAGCTCCTTTTGAAAAGAAAAAGAAGGTGGGTGTGCCTTTACTCGAGGAGCAACAGGATGAGAGATCTTCTGTAGAGACTAAGTGATCCCTTCGACTGTCTTGCTTCTGCTGCTCCCACCAAATGTAGAAAGGCTAAAGAACTTATGCAGTTGAAAAAGCAAGTCCACTGGAAACAGAACTTTGGTCTTTTGAGCCACAGAGAGATTAGAAGTACTGTTCAAAGAAGCCATATTTACTCTCCTGTAAAGTGGAGAGGCTTGACTCCTTTGGCCCTTTTTTCACCATGACTTTTATAGGATGTTTTCCATCAGGATCCAGTGTCCCAAAACATAGTTTTTTCCCTGCAGCTGTGAAGAACAAATAATAGACTGCAACTTAAAAATTTTGTTTCCTCCATGTCTTGCTACCTTGACGGATGTCACACCTAGTCTCTAGAAAGTGCCTCAAAAACTTAAATATATAAATGCTGCTCCCATACAGCCTTCATCTCCTGGCATGGGCAGCAGGAGGTTTAGTTCACTTAAAATATGCCACTTTTCAAGCATGCTAGACAGGGACTTTTGCATTAATCCCACCAACACTATGCATTTCTACTTTTAGCTGTGCTTGCTATCTAATCACTCATATCATCACGTCTGACCATCAGCATAAACATACCTTCAACAATATGACTTCCTATAAATTAAGCACAATGCTACACATGTTCTTTGTTCTTAAGGTACTGCAGATATATAAGGTCTACATTCTGATGATCTTCCTCTGCTTTTGATACCAATATGTTTTGTTGTTTGATTTTATTTTTCTTCTGGTTGGAAGAGAACATTAAATGCTAGTGCTGTAGAGGATGGCAGTATAGGGTGAATGTAGTACTGTTTTTCACCCTGCAGCAGCATTCATAAAGCCACTATTTAGAACGAAAAGTATACCCTCTGTAACAGCTATCTCCAAAAATTGACCCTTGGTGTCAGATCAGTAAGAAGTCTTACAGAGGGCCATTACTGCGTACAGATAATGGTCTTCATTGCTTTATGGAAAGTCAGAAAAAGCTGGAAAACACATACATAGTCTTAAACCGTTTTAATTTCTAAACAATCTGCCTGATAGCTTCAGTCTAGGGAGTTTAGAAATGCTTTCTTTTTAACCTTTACAACAGAATTGGTAATGCCTTTGACATTAAGGTAACATAGGTATTTATATAAGGACACAGTCCTATTAATATAGGTAAGAAAGGTGAACAGATCTTTTTTTAAAGATATTTGGTTAAACCTTGTTAAAGCATTACTACAAAGAATCTTGTGCACAAATCTTTAGTTACGCAGCTATCAGCTCTAACATTCCCCTGCCTCTCATTTGCTGTAAAGGGTCAGCTTGGTTAGCACCCCCTAGGTGCTGGTATCTTGGTAGTAGTACCCTGCACGCTCCCAATGAATGCTATGCATGCTCTAGCATGAAGCTAGGATCTGCATCCGGTATAGGGGCTCCCCCCCATGCACACTCACACTCAGATGTTTACCTGCTCCTTCTCTGATAGCAGAGAATTTTGGAGCAATTTTCTGGGGGGGGACATTTGTAGTTAGATGAGGTTAGTTAAATGCTACTGAAACTTGACTTGGGAATAGAAATGTTTGCAATAGAACAGTTCTGTACCTCACTTGATTAATTTATTGACCTACTGGTTTCATTAAAGTTTTACTT
                                                  Xt7.1-CHK-1008265624                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTATGATAGAATGATGAAATGTAAAATAGAGTAAGTTATATAGGTAGCxTxxxCTCCACCGATGTAAxxxGTxxxTACCTCACAGCTACATGGTATTACTATGACAGCATCCTACCTTCCTTCAGAGAGCTGCTCCTTTTGTTTGATACCTGGCATCGAACCTGCAGCCGAAATGGAGGGGTTAGGCTCTGTCAGGGGTCTCCTCGCTATCAGCCAGTCCCCTCCACCCCGAAACCTGCAACACCCCCTTTCTGTACTGGGGAAAGTAGTAAATTGGGCTTGAAAGACCGGATGCGAGGCACAGTTGCACCAAAACAGACCACACGAAGCAAGCAGTACCTGGCCCCACCAGAGCGGGCTTCACCCGGTACAGAGCCTGCAGCAGAGACTCCCAGCCCTACAAAAGTGCAAAAAAGTTGGAGCTTTAATGACCGCACAAGATTCCGTGCATCACTAAGACTAAAATCAAGGCCACAGGCTGATGAGGGTCCTGGAGACGACATTAATGATGAAAAGAGACTTCCAAATGATTTGACCATGGAGGATGTGATGCCAACTATAAAAACCCTGATTCGAGCCTTTAGAATCCTTAAATTCCTTGTGGCAAAGAGGAAGTTTAAGGAGACTCTACGGCCATATGATGTGAAGGATGTAATTGAGCAGTATTCAGCTGGACATTTGGATATGCTTGGGCGCATTAAGAGCCTGCAGGGCAGGGTGGATCAGATCATTGGCCGGGGGCCTGTGCCGGTAGAGAAAAAACCTAGAGATAAAGGAGAGAAGGTTTCCACCATGGGTCCTGAAGTTGAAGCTGCTGATGAGCTAAGCATGATGGGAAGGGTAGTAAAGGTTGAGAGACAGGTCCAGAGCATTGAAGATAAACTTGATATACTTCTAGGTTTCTACTCTCAGTGTATCCGGAAAGGTCCAGCAAGCTCTTTTACATTGACCTCTATGCAAATGCCATTGATTGACCAAGAAATGACATCTGATTACCAGAGCCCTGTGGATCCAGTGGACTTTTCAGTGTCAGCCCAGACACTTAATATATCTCATTCTGCCAGCACCAACATGGAGTGAGAAAGATGGAGCAATAGGGTAAGTTGTGACCATATTACCAGCTCCTTTTGAAAAGAAAAAGAAGGTGGGTGTGCCTTTACTCGAGGAGCAACAGGATGAGAGATCTTCTGTAGAGACTAAGTGATCCCTTCGACTGTCTTGCTTCTGCTGCTCCCACCAAATGTAGAAAGGCTAAAGAACTTATGCAGTTGAAAAAGCAAGTCCACTGGAAACAGAACTTTGGTCTTTTGAGCCACAGAGAGATTAGAAGTACTGTTCAAAGAAGCCATATTTACTCTCCTGTAAAGTGGAGAGGCTTGACTCCTTTGGCCCTTTTTTCACCATGACTTTTATAGGATGTTTTCCATCAGGATCCAGTGTCCCAAAACATAGTTTTTTCCCTGCAGCTGTGAAGAACAAATAATAGACTGCAACTTAAAAATTTTGTTTCCTCCATGTCTTGCTACCTTGACGGATGTCACACCTAGTCTCTAGAAAGTGCCTCAAAAACTTAAATATATAAATGCTGCTCCCATACAGCCTTCATCTCCTGGCATGGGCAGCAGGAGGTTTAGTTCACTTAAAATATGCCACTTTTCAAGCATGCTAGACAGGGACTTTTGCATTAATCCCACCAACACTATGCATTTCTACTTTTAGCTGTGCTTGCTATCTAATCACTCATATCATCACGTCTGACCATCAGCATAAACATACCTTCAACAATATGACTTCCTATAAATTAAGCACAATGCTACACATGTTCTTTGTTCTTAAGGTACTGCAGATATATAAGGTCTACATTCTGATGATCTTCCTCTGCTTTTGATACCAATATGTTTTGTTGTTTGATTTTATTTTTCTTCTGGTTGGAAGAGAACATTAAATGCTAGTGCTGTAGAGGATGGCAGTATAGGGTGAATGTAGTACTGTTTTTCACCCTGCAGCAGCATTCATAAAGCCACTATTTAGAACGAAAAGTATACCCTCTGTAACAGCTATCTCCAAAAATTGACCCTTGGTGTCAGATCAGTAAGAAGTCTTACAGAGGGCCATTACTGCGTACAGATAATGGTCTTCATTGCTTTATGGAAAGTCAGAAAAAGCTGGAAAACACATACATAGTCTTAAACCGTTTTAATTTCTAAACAATCTGCCTGATAGCTTCAGTCTAGGGAGTTTAGAAATGCTTTCTTTTTAACCTTTACAACAGAATTGGTAATGCCTTTGACATTAAGGTAACATAGGTATTTATATAAGGACACAGTCCTATTAATATAGGTAAGAAAGGTGAACAGATCTTTTTTTAAAGATATTTGGTTAAACCTTGTTAAAGCATTACTACAAAGAATCTTGTGCACAAATCTTTAGTTACGCAGCTATCAGCTCTAACATTCCCCTGCCTCTCATTTGCTGTAAAGGGTCAGCTTGGTTAGCACCCCCTAGGTGCTGGTATCTTGGTAGTAGTACCCTGCACGCTCCCAATGAATGCTATGCATGCTCTAGCATGAAGCTAGGATCTGCATCCGGTATAGGGGCTCCCCCCCATGCACACTCACACTCAGATGTTTACCTGCTCCTTCTCTGATAGCAGAGAATTTTGGAGCAATTTTCTGGGGGGGGACATTTGTAGTTAGATGAGGTTAGTTAAATGCTACTGAAACTTGACTTGGGAATAGAAATGTTTGCAATAGAACAGTTCTGTACCTCACTTGATTAATTTATTGACCTACTGGTTTCATTAAAGTTTTACTTAGAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             2     5     2     5     2     5     2     5     2     5     2     4     2     5     2     4     2     4     2     4     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     3     4     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     3     5     3     5     4     4     4     4     4     4     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     2     3     2     3     2     3     2     3     2     3     2     4     4     6     6     7     6     7     6     7     9     9     9     9    10    10    10    10    12    12    11    11    12    12    12    12    12    12    11    12    12    12    12    12    12    12    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    11    10    10    10    10    10    10
  5   1   2       e50                                 Xt7.1-CABD2327.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGGCATTATGATAGAATGATGAAATGTAAAATAGAGTAAGTTATATAGGTAGCATTATCTCCACCGATGTAAAGTGTAAGTACCTCACAGCTACATGGTATTACTATGACAGCATCCTACCTTCCTTCAGAGAGCTGCTCCTTTTGTTTGATACCTGGCATCGAACCTGCAGCCGAAATGGAGGGGTTAGGCTCTGTCAGGGGTCTCCTCGCTATCAGCCAGTCCCCTCCACCCCGAAACCTGCAACACCCCCTTTCTGTACTGGGGAAAGTAGTAAATTGGGCTTGAAAGACCGGATGCGAGGCACAGTTGCACCAAAACAGACCACACGAAGCAAGCAGTACCTGGCCCCACCAGAGCGGGCTTCACCCGGTACAGAGCCTGCAGCAGAGACTCCCAGCCCTACAAAAGTGCAAAAAAGTTGGAGCTTTAATGACCGCACAAGATTCCGTGCATCACTAAGACTAAAATCAAGGCCACAGGCTGATGAGGGTCCTGGAGACGACATTAATGATGAAAAGAGACTTCCAAATGATTTGACCATGGAGGATGTGATGCCAACTATAAAAACCCTGATTCGAGCCTTTAGAATCCTTAAATTCCTTGTGGCAAAGAGGAAGTTTAAGGAGACTCTACGGCCATATGATGTGAAGGATGTAATTGAGCAGTATTCAGCTGGACATTTGGATATGCTTGGGCGCATTAAGAGCCTGCAGGGCAGGGTGGATCAGATCATTGGCCGGGGGCCTGTGCCGGTAGAGAAAAAACCTAGAGATAAAGGAGAGAAGGTTTCCACCATGGGTCCTGAAGTTGAAGCTGCTGATGAGCTAAGCATGATGGGAAGGGTAGTAAAGGTTGAGAGACAGGTCCAGAGCATTGAAGATAAACTTGATATACTTCTAGGTTTCTACTCTCAGTGTATCCGGAAAGGTCCAGCAAGCTCTTTTACATTGACCTCTATGCAAATGCCATTGATTGACCAAGAAATGACATCTGATTACCAGAGCCCTGTGGATCCAGTGGACTTTTCAGTGTCAGCCCAGACACTTAATATATCTCATTCTGCCAGCACCAACATGGAGTGAGAAAGATGGAGCAATAGGGTAAGTTGTGACCATATTACCAGCTCCTTTTGAAAAGAAAAAGAAGGTGGGTGTGCCTTTACTCGAGGAGCAACAGGATGAGAGATCTTCTGTAGAGACTAAGTGATCCCTTCGACTGTCTTGCTTCTGCTGCTCCCACCAAATGTAGAAAGGCTAAAGAACTTATGCAGTTGAAAAAGCAAGTCCACTGGAAACAGAACTTTGGTCTTTTGAGCCACAGAGAGATTAGAAGTACTGTTCAAAGAAGCCATATTTACTCTCCTGTAAAGTGGAGAGGCTTGACTCCTTTGGCCCTTTTTTCACCATGACTTTTATAGGATGTTTTCCATCAGGATCCAGTGTCCCAAAACATAGTTTTTTCCCTGCAGCTGTGAAGAACAAATAATAGACTGCAACTTAAAAATGTTGTTTCCTCCATGTCTTGCTACCTTGACGGATGTCACACCTAGTCTCTAGAAAGTGCCTCAAAAACTTAAATATATAAATGCTGCTCCCATACAGCCTTCATCTCCTGGCATGGGCAGCAGGAGGTTTAGTTCACTTAAAATATGCCACTTTTCAAGCATGCTAGACAGGGACTTTTGCATTAATCCCACCAACACTATGCATTTCTACTTTTAGCTGTGCTTGCTATCTAATCACTCATATCATCACGTCTGACCATCAGCATAAACATACCTTCAACAATATGACTTCCTATAAATTAAGCACAATGCTACACATGTTCTTTGTTCTTAAGGTACTGCAGATATATAA
  5   1   2       e50                                 Xt7.1-CAAN3464.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCTTTTGAGCCACAGAGAGATTAGAAGTACTGTTCAAAGAAGCCATATTTACTCTCCTGTAAAGTGGAGAGGCTTGACTCCTTTGGCCCTTTTTTCACCATGACTTTTATAGGATGTTTTCCATCAGGATCCAGTGTCCCAAAACATAGTTTTTTCCCTGCAGCTGTGAAGAACAAATAATAGACTGCAACTTAAAAATTTTGTTTCCTCCATGTCTTGCTACCTTGACGGATGTCACACCTAGTCTCTAGAAAGTGCCTCAAAAACTTAAATATATAAATGCTGCTCCCATACAGCCTTCATCTCCTGGCATGGGCAGCAGGAGGTTTAGTTCACTTAAAATATGCCACTTTTCAAGCATGCTAGACAGGGACTTTTGCATTAATCCCACCAACACTATGCATTTCTACTTTTAGCTGTGCTTGCTATCTAATCACTCATATCATCACGTCTGACCATCAGCATAAACATACCTTCAACAATATGACTTCCTATAAATTAAGCACAATGCTACACATGTTCTTTGTTCTTAAGGTACTGCAGATATATAAGGTCTACATTCTGATGATCTTCCTCTGCTTTTGATACCAATATGTTTTGTTGTTTGATTTTATTTTTCTTCTGGTTGGAAGAGAACATTAAATGCTAGTGCTGTAGAGGATGGCAGTATAGGGTGAATGTAGTACTGTTTTTCACCCTGCAGCAGCATTCATAAAGCCACTATTTAGAACGAAAAGTATACCCTCTGTAACAGCTATCTCCAAAAATTGACCCTTGGTGTCAGATCAGTAAGAAGTCTTACAGAGGGCCATTACTGCGTACAGATAATGGTCTTCATTGCTTTATGGAAAGTCAGAAAAAGCTGGAAAACACATACATAGTCTTAAACCGTTTTAATTTCTAAACAATCTGCCTGATAGCTTCAGTCTAGGGAGTTTAGAAATGCTTTCTTTTTAACCTTTACAACAGAATTGGTAATGCCTTTGACATTAAGGTAACATAGGTATTTATATAAGGACACAGTCCTATTAATATAGGTAAGAAAGGTGAACAGATCTTTTTTTAAAGATATTTGGTTAAACCTTGTTAAAGCATTACTACAAAGAATCTTGTGCACAAATCTTTAGTTACGCAGCTATCAGCTCTAACATTCCCCTGCCTCTCATTTGCTGTAAAGGGTCAGCTTGGTTAGCACCCCCTAGGTGCTGGTATCTTGGTAGTAGTACCCTGCACGCTCCCAATGAATGCTATGCATGCTCTAGCATGAAGCTAGGATCTGCATCCGGTATAGGGGCTCCCCCCCATGCACACTCACACTCAGATGTTTACCTGCTCCTTCTCTGATAGCAGAGAATTTTGGAGCAATTTTCTGGGGGGGGACATTTGTAGTTAGATGAGGTTAGTTAAATGCTACTGAAACTTGACTTGGGAATAGAAATGTTTGCAATAGAACAGTTCTGTACCTCACTTGATTAATTTATTGACCTACTGGTTTCATTAAAGTTTTACTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----------C
                                               BLH MIN      30      69                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                                                                                                          PROTEIN --- Ce ---- 8e-019     NP_741820.1 potassium channel, KvQLT family (77.4 kD) (kqt-1) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dm ---- 2e-024     NP_788299.2 CG33135-PB, isoform B [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PREDICTED - Dr ---- 4e-064     XP_697081.1 PREDICTED: similar to potassium voltage-gated channel subfamily Q member 5 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - ?? ---- 1e-065     XP_684855.1 PREDICTED: similar to potassium voltage-gated channel subfamily Q member 5 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Gg ---- 1e-099     XP_417791.2 PREDICTED: similar to potassium channel voltage-gated KQ-subfamily member 4 [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Hs ---- 3e-113     NP_004691.2 potassium voltage-gated channel KQT-like protein 4 isoform a [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                          PREDICTED - Mm ---- 2e-114     XP_983139.1 PREDICTED: similar to potassium voltage-gated channel KQT-like protein 4 isoform a [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                  PROTEIN --- Xt ---- 1e-157     AAI21944.1 Potassium voltage-gated channel KQT-like protein 4 [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAN3464.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGATAG---------ATGTAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG---------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------ATG---------------------------------------------------------------------------------------ATG---TGA------------------------------------------------TGA---------------------------------------------TGA------------------TAA---------------------------------------------------------------------TGA------------------------------------TGA---------------------------------------------------TAA------------TGA------------------------------------ATG------------------------------TAG---------------------------------------------------------------------------------------------------TAG------------------------------------------------------------ATG---------------------------------------------ATG------------------------------------ATG------------TAG------------------------------------TGA---------TAA---------------------------TAA---------------------------------TAA---------------TAA------------------------------------------------------TGA------------------------------------------------------------------TGAATGTAG------------------------------------------TAG---------------------------------------------------------------------------------------------------ATG------------------------------------------------TAG---TAA---------------------------TGATAG---------------------------------------------------------ATG---------------TAA------------------------------------TAG---------------------------------------------------------------------------------------TAG------------------TAA------------------------TAA------------------------TAG---------------TAGTAG------------------TGAATG------ATG---TAG------------------------------------------------------------------------------------------------------------------------------------TGA---TAG------------------TGA---------------------------------------------TGA---------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2       e50                                 Xt7.1-CABD2327.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGGCATTATGATAGAATGATGAAATGTAAAATAGAGTAAGTTATATAGGTAGCATTATCTCCACCGATGTAAAGTGTAAGTACCTCACAGCTACATGGTATTACTATGACAGCATCCTACCTTCCTTCAGAGAGCTGCTCCTTTTGTTTGATACCTGGCATCGAACCTGCAGCCGAAATGGAGGGGTTAGGCTCTGTCAGGGGTCTCCTCGCTATCAGCCAGTCCCCTCCACCCCGAAACCTGCAACACCCCCTTTCTGTACTGGGGAAAGTAGTAAATTGGGCTTGAAAGACCGGATGCGAGGCACAGTTGCACCAAAACAGACCACACGAAGCAAGCAGTACCTGGCCCCACCAGAGCGGGCTTCACCCGGTACAGAGCCTGCAGCAGAGACTCCCAGCCCTACAAAAGTGCAAAAAAGTTGGAGCTTTAATGACCGCACAAGATTCCGTGCATCACTAAGACTAAAATCAAGGCCACAGGCTGATGAGGGTCCTGGAGACGACATTAATGATGAAAAGAGACTTCCAAATGATTTGACCATGGAGGATGTGATGCCAACTATAAAAACCCTGATTCGAGCCTTTAGAATCCTTAAATTCCTTGTGGCAAAGAGGAAGTTTAAGGAGACTCTACGGCCATATGATGTGAAGGATGTAATTGAGCAGTATTCAGCTGGACATTTGGATATGCTTGGGCGCATTAAGAGCCTGCAGGGCAGGGTGGATCAGATCATTGGCCGGGGGCCTGTGCCGGTAGAGAAAAAACCTAGAGATAAAGGAGAGAAGGTTTCCACCATGGGTCCTGAAGTTGAAGCTGCTGATGAGCTAAGCATGATGGGAAGGGTAGTAAAGGTTGAGAGACAGGTCCAGAGCATTGAAGATAAACTTGATATACTTCTAGGTTTCTACTCTCAGTGTATCCGGAAAGGTCCAGCAAGCTCTTTTACATTGACCTCTATGCAAATGCCATTGATTGACCAAGAAATGACATCTGATTACCAGAGCCCTGTGGATCCAGTGGACTTTTCAGTGTCAGCCCAGACACTTAATATATCTCATTCTGCCAGCACCAACATGGAGTGAGAAAGATGGAGCAATAGGGTAAGTTGTGACCATATTACCAGCTCCTTTTGAAAAGAAAAAGAAGGTGGGTGTGCCTTTACTCGAGGAGCAACAGGATGAGAGATCTTCTGTAGAGACTAAGTGATCCCTTCGACTGTCTTGCTTCTGCTGCTCCCACCAAATGTAGAAAGGCTAAAGAACTTATGCAGTTGAAAAAGCAAGTCCACTGGAAACAGAACTTTGGTCTTTTGAGCCACAGAGAGATTAGAAGTACTGTTCAAAGAAGCCATATTTACTCTCCTGTAAAGTGGAGAGGCTTGACTCCTTTGGCCCTTTTTTCACCATGACTTTTATAGGATGTTTTCCATCAGGATCCAGTGTCCCAAAACATAGTTTTTTCCCTGCAGCTGTGAAGAACAAATAATAGACTGCAACTTAAAAATGTTGTTTCCTCCATGTCTTGCTACCTTGACGGATGTCACACCTAGTCTCTAGAAAGTGCCTCAAAAACTTAAATATATAAATGCTGCTCCCATACAGCCTTCATCTCCTGGCATGGGCAGCAGGAGGTTTAGTTCACTTAAAATATGCCACTTTTCAAGCATGCTAGACAGGGACTTTTGCATTAATCCCACCAACACTATGCATTTCTACTTTTAGCTGTGCTTGCTATCTAATCACTCATATCATCACGTCTGACCATCAGCATAAACATACCTTCAACAATATGACTTCCTATAAATTAAGCACAATGCTACACATGTTCTTTGTTCTTAAGGTACTGCAGATATATAA
                                                  Xt7.1-CHK-1008234618                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTATGATAGAATGATGAAATGTAAAATAGAGTAAGTTATATAGGTAGCxTxxxCTCCACCGATGTAAxxxGTxxxTACCTCACAGCTACATGGTATTACTATGACAGCATCCTACCTTCCTTCAGAGAGCTGCTCCTTTTGTTTGATACCTGGCATCGAACCTGCAGCCGAAATGGAGGGGTTAGGCTCTGTCAGGGGTCTCCTCGCTATCAGCCAGTCCCCTCCACCCCGAAACCTGCAACACCCCCTTTCTGTACTGGGGAAAGTAGTAAATTGGGCTTGAAAGACCGGATGCGAGGCACAGTTGCACCAAAACAGACCACACGAAGCAAGCAGTACCTGGCCCCACCAGAGCGGGCTTCACCCGGTACAGAGCCTGCAGCAGAGACTCCCAGCCCTACAAAAGTGCAAAAAAGTTGGAGCTTTAATGACCGCACAAGATTCCGTGCATCACTAAGACTAAAATCAAGGCCACAGGCTGATGAGGGTCCTGGAGACGACATTAATGATGAAAAGAGACTTCCAAATGATTTGACCATGGAGGATGTGATGCCAACTATAAAAACCCTGATTCGAGCCTTTAGAATCCTTAAATTCCTTGTGGCAAAGAGGAAGTTTAAGGAGACTCTACGGCCATATGATGTGAAGGATGTAATTGAGCAGTATTCAGCTGGACATTTGGATATGCTTGGGCGCATTAAGAGCCTGCAGGGCAGGGTGGATCAGATCATTGGCCGGGGGCCTGTGCCGGTAGAGAAAAAACCTAGAGATAAAGGAGAGAAGGTTTCCACCATGGGTCCTGAAGTTGAAGCTGCTGATGAGCTAAGCATGATGGGAAGGGTAGTAAAGGTTGAGAGACAGGTCCAGAGCATTGAAGATAAACTTGATATACTTCTAGGTTTCTACTCTCAGTGTATCCGGAAAGGTCCAGCAAGCTCTTTTACATTGACCTCTATGCAAATGCCATTGATTGACCAAGAAATGACATCTGATTACCAGAGCCCTGTGGATCCAGTGGACTTTTCAGTGTCAGCCCAGACACTTAATATATCTCATTCTGCCAGCACCAACATGGAGTGAGAAAGATGGAGCAATAGGGTAAGTTGTGACCATATTACCAGCTCCTTTTGAAAAGAAAAAGAAGGTGGGTGTGCCTTTACTCGAGGAGCAACAGGATGAGAGATCTTCTGTAGAGACTAAGTGATCCCTTCGACTGTCTTGCTTCTGCTGCTCCCACCAAATGTAGAAAGGCTAAAGAACTTATGCAGTTGAAAAAGCAAGTCCACTGGAAACAGAACTTTGGTCTTTTGAGCCACAGAGAGATTAGAAGTACTGTTCAAAGAAGCCATATTTACTCTCCTGTAAAGTGGAGAGGCTTGACTCCTTTGGCCCTTTTTTCACCATGACTTTTATAGGATGTTTTCCATCAGGATCCAGTGTCCCAAAACATAGTTTTTTCCCTGCAGCTGTGAAGAACAAATAATAGACTGCAACTTAAAAATGTTGTTTCCTCCATGTCTTGCTACCTTGACGGATGTCACACCTAGTCTCTAGAAAGTGCCTCAAAAACTTAAATATATAAATGCTGCTCCCATACAGCCTTCATCTCCTGGCATGGGCAGCAGGAGGTTTAGTTCACTTAAAATATGCCACTTTTCAAGCATGCTAGACAGGGACTTTTGCATTAATCCCACCAACACTATGCATTTCTACTTTTAGCTGTGCTTGCTATCTAATCACTCATATCATCACGTCTGACCATCAGCATAAACATACCTTCAACAATATGACTTCCTATAAATTAAGCACAATGCTACACATGTTCTTTGTTCTTAAGGTACTGCAGATATATAAGGTTAT
  5   1   0       add Te4       in                          CAAN469.5p                                                                                  TAGGCAACCTTAGTGCCTTTTATTATATAACCTGTATGAGTATCTGTTTTGATTAGGAGTATACAGCCATTTCTCTCATGTGTGCATGAATTTCAGCATAGGACAATTCTAAAGAAATGCCTTCCTTTCAATCGAATTTAGTGAATAGTATTTTCATTAATCTGTTTCAGATGTTTTAGTGTTACTGAAATGGACTGCAGAGAGTTTCAAGAGTGTGTTGCATACTCCAAAACTAAGAATTTACAGTTATTATTGGAATATTAAGCAAATATACTTTTTTTAACATGTTATTTTCCATTTATTTGAATAGAAAACTTTTAGGAAGCAGTTTGTACACAAAGAAATTCTCAAGAAATTTCCCAAAAGTGCAGGTTTTCCCCTCTGGCTTCAGCAGTGGTTAGTTGAAAAACTTGTGGGGATGATCTGCAGGTTATATTATCTGGACAAAACTTTTGCCACTGAAAAAAATAAGATTTAAGTTGCCATTTGTGCTGTAGGAAGGTTTACAGTAATTGAGTGCAGCAGTGAATGTAGCCAGAACATGAGTTGACATGCTCATATTTTTCCAAAATCAGAGATGGAAAAAAATTATTCTTTACTGATGCAGGAACCCCATGCTGTTTAGGGTGCTTCCCAAAATCCTCCTTAAATACAATAATATTTCCTGCTATAGTCAACAAGATTAGGCATGTCAGGTGACTATATGGTCTTTGCTTACAGTTGTCTTTTGAAAACATTATTAATGCCACTTAGTGATGGAGCGATTGTATAAGGCTCTACATATATTTATGAATGCAGAAAAGGGTTGTTTTCTGC
  5   1   0       add Int1      in                         CAAP7134.5p                                                                                                                                                                                                                                                                TTTTAGTGTTACTGAAATGGACTGCAGAGAGTTTCAAGAGTGTGTTGCATACTCCAAAACTAAGAATTTACAGTTATTATTGGAATATTAAGCAAATATACTTTTTTAACATGTTATTTTCCATTTATTTGAATAGAAAACTTTTAGGAAGCAGTTTGTACACAAAGAAATTCTCAAGAAATTTCCCAAAAGTGCAGGTTTTCCCCTCTGGCTTCAGCAGTGGTTAGTTGAAAAACTTGTGGGGATGATCTGCAGGTTATATTATCTGGACAAAACTTTTGCCACTGAAAAAGATAAGATTTAAGTTGCCATTTGTGCTGTAGGAAGGTTTACAGTAATAGAGTGCAGCAGTGAATGTAGCCAGAACATGAGTTGACATGCTCATATTTTTCCAAAATCAGAGATGGAAAAAAATTATTCTTTACTGATGCAGGAACCCCATGCTGTTTAGGGTGCTTCCCAAAATCCTCCTTAAATACAATAATATTTCCTGCTATAGTCAACAAGATTAGGCATGTCAGGTGACTATATGGTCTTTGCTTACAGTTGTCTTTTGAAAACATTATTAATGCCACTTAGTGATGTAGCGATTGTATAAGGCTCTACATATATTTATGAATGCAGAAAAGGGTTGTTTTCTGCGAATAACTTAAAAAATGAGAGGCCTCCTTCCCTCTCATGAATACAGTGCTACCTAACAGCACTGCTAACTTATATAATAACTTTTTTTATTTAATGTCCATTGTGGCATTATGATAGAATGATGAAATGTAAAATAGAGTAAGTTATATAGGTAGCATTATCCATCTNGTGTTTAAGTGTAAGTACTTTCT
  5   1   2       bld Te4       in                         CAAN9170.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTGATTGATTTTATTGTTCTGGTGGCTTCACTGGCTGTTATTGCAGCTGGGACTCAGGGTAACATTTTTGCCACATCTGCTCTGCGTAGCATGCGGTTTCTTCAGATCCTGCGTATGGTACGCATGGATCGGCGAGGAGGCACATGGAAACTACTGGGTTCTGTAGTGTATGCGCACAGTAAGGAACTGATCACTGCTTGGTACATTGGATTCCTGGTGCTTATATTTGCTTCCTTTCTGGTATACCTGGCAGAAAAGGATGCTAATAAAGAGTTTTCCACATATGCAGACTCTCTCTGGTGGGGCACGATTACATTGACAACTATTGGATATGGTGATAAGACCCCTCACACATGGCTTGGGCGGGTGCTGGCAGCTGGATTTGCACTTCTGGGTATCTCTTTCTTTGCCCTGCCTGCGGGAATTTTAGGTTCTGGGTTTGCCCTTAAAGTCCAAGAACAACATCGACAGAAGCATTTTGAGAAGCGACGGACACCAGCAGCTAATCTTATTCAGGCTGCCTGGCGTTTGTACTCCACCGATGTAAGCCGTTCCTACCTCACAGCTACATGGTATTACTATGACAGCATCCTACCTTCCTTCAGAGAGCTGCTCCTTTTGTTTGATACCTGGCATCGAACCTGCAGCCGAAATGGAGGGGTTAGGCTCTGTCAGGGGTCTCCTCGCTATCAGCCAGTCCCCTCCACCCCGAAACCTGCAACACCCCCTTTCTGTACTGNGGAAAGTAGTAA
  5   1   2       bld Int1      in                         CAAP3308.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTTTCCAAATCAGAGATGGAAAAAAATTATTCTTTACTGATGCAGGAACCCCATGCTGTTTAGGGTGCTTCCCAAAATCCTCCTTAAATACAATAATATTTCCTGCTATAGTCAACAAGATTAGGCATGTCAGGTGACTATATGGTCTTTGCTTACAGTTGTCTTTTGAAAACATTATTAATGCCACTTAGTGATGGAGCGATTGTATAAGGCTCTACATATATTTATGAATGCAGAAAAGGGTTGTTTTCTGCGAATAACTTAAAAAATGAGAGGCCTCCTTCCCTCTCATGAATACAGTGCTACCTAACAGCACTGCTAACTTATATAATAACTTTTTTTATTTAATGTCCATTGTGGCATTATGATAGAATGATGAAATGTAAAATAGAGTAAGTTATATAGGTAGCATTATCCATCTGTTGTTTAAGTGTAAGTACTTTCTTCTATTTCCCTCACAGTAGTAACTTTGCCTGCTCCTTAACTCATATCTTCCTTTTGCCTTTGTCTTTGTCCCTCACACCTTTGCCATAAACACCTTTCCTTTCTTAGTTCTTCCCTGTCTCACCTCTTACTCTACTTTTTCTCATTTACCATTTGAATTATTGCTGTCCTTACCACTCCATAGTAGTAAATTGGGCTTGAAAGACCGGATGCGAGGCACAGTTGCACCAAAACAGACCACACGAAGCAAGCAGTACCTGGCCCCACCAGAGCGGGCTTCACCCGGTACAGAGCCTGCAGCAGAGACTCCCAGCCCTACAAAAGTGCAAAAAAGTTGGAGCTTTAATGACCGCACAAGATTCCGTGCATCACTAAAACTAAAATC
  5   1   2       bld Te4       in                        CAAN10350.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGCAGCTAATCTTATTCAGGCTGCCTGGCGTTTGTACTCCACCGATGTAAGCCGTTCCTACCTCACAGCTACATGGTATTACTATGACAGCATCCTACCTTCCTTCAGTTCTGCATTACAGGTTTTTGGATATGGGATCCCATACTTGTAACTGCAACACATTTTGTAAATAAGAGAGCTGCTCCTTTTGTTTGATACCTGGCATCGAACCTGCAGCCGAAATGGAGGGGTTAGGCTCTGTCAGGGGTCTCCTCGCTATCAGCCAGTCCCCTCCACCCCGAAACCTGCAACACCCCCTTTCTGTACTGGGGAAAGTAGTAAATTGGGCTTGAAAGACCGGATGCGAGGCACAGTTGCACCAAAACAGACCACACGAAGCAAGCAGTACCTGGCCCCACCAGAGCGGGCTTCACCCGGTACAGAGCCTGCAGCAGAGACTCCCAGCCCTACAAAAGTGCAAAAAAGTTGGAGCTTTAATGACCGCACAAGATTCCGTGCATCACTAAGACTAAAATCAAGGCCACAGGCTGATGAGGGTCCTGGAGACGACATTAATGATGAAAAGAGACTTCCAAATGATTTGACCATGGAGGATGTGATGCCAACTATAAAAACCCTGATTCGAGCCTTTAGAATCCTTAAATTCCTTGTGGCAAAGAGGAAGTTTAAGGAGACTCTACGGCCATATGATGTGAAGGATGTAATTGAGCAGTATTCAGCTGGACATTTGGATATGCTTGGGCGCATTAAGAGCCTGCAGGGCAGGGTGGATCAGATCATTGGCCGGGGGCCTGTGCCGGTAGAGAAAAAACTAGAGATAAGGAG
  5   1   2       bld Thy1      in                        CBST8519.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCGACAGAAGCATTTTGAGAAGCGACGGACACCAGCAGCTAATCTTATTCAGGCTGCCTGGCGTTTGTACTCCACCGATGTAAGCCGTTCCTACCTCACAGCTACATGGTATTACTATGACAGCATCCTACCTTCCTTCAGAGAGCTGCTCCTTTTGTTTGATACCTGGCATCGAACCTGCAGCCGAAATGGAGGGGTTAGGCTCTGTCAGGGGTCTCCTCGCTATCAGCCAGTCCCCTCCACCCCGAAACCTGCAACACCCCCTTTCTGTACTGGGGAAAGTAGTAAATTGGGCTTGAAAGACCGGATGCGAGGCACAGTTGCACCAAAACAGACCACACGAAGCAAGCAGTACCTGGCCCCACCAGAGCGGGCTTCACCCGGTACAGAGCCTGCAGCAGAGACTCCCAGCCCTACAAAAGTGCAAAAAAGTTGGAGCTTTAATGACCGCACAAGATTCCGTGCATCACTAAGACTAAAATCAAGGCCACAGGCTGATGAGGGTCCTGGAGACGACATTAATGATGAAAAGAGACTTCCAAATGATTTGACCATGGAGGATGTGATGCCAACTATAAAAACCCTGATTCGAGCCTTTAGAATCCTTAAATTCCTTGTGGCAAAGAGGAAGTTTAAGGAGACTCTACGGCCATATGATGTGAAGGATGTAATTGAGCAGTATTCAGCTGGACATTTGGATATGCTTGGGCGCATTAAGAGCCTGCAGGGCAGGGTGGATCAGATCATTGGCCGGGGGCCTGTGCCGGT
  3   1   2       bld Int1      in                         CAAP3308.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCATAGTAGTAAATTGGGCTGAAAAGACCGGATGCGAGGCACAGTTGCACCAAAACAGACCACACGAAGCAAGCAGTACTGGGCCCCACCAGAGCGGGCTTCACCCGGTACAGAGCCTGCAGCAGAGACTCCCAGCCCTACAAAAGTGCAAAAAAGTTGGAGCTTTAATGACCGCACAAGATTCCGTGCATCACTAAGACTAAAATCAAGGCCACAGGCTGATGAGGGTCCTGGAGACGACATTAATGATGAAAAGAGACTTCCAAATGATTTGACCATGGAGGATGTGATGCCAACTATAAAAACCCTGATTCGAGCCTTTAGAATCCTTAAATTCCTTGTGGCAAAGAGGAAGTTTAAGGAGACTCTACGGCCATATGATGTGAAGGATGTAATTGAGCAGTATTCAGCTGGACATTTGGATATGCTTGGGCGCATTAAGAGCCTGCAGGGCAGGGTGGATCAGATCATTGGCCGGGGGCCTGTGCCGGTAGAGAAAAAACCTAGAGATAAAGGAGAGAAGGTTTCCACCATGGGTCCTGAAGTTGAAGCTGCTGATGAGCTAAGCATGATGGGAAGGGTAGTAAAGGTTGAGAGACAGGTCCAGAGCATTGAAGATAAACTTGATATACTTCTAGGTTTCTACTCTCAGTGTATCCGGAAAGGTCCAGCAAGCTCTTTTACATTGACCTCTATGCAAATGCCATTGATTGACCAAGAAATGACATCTGATTACCAGAGCCCTGTGGATCCAGTGGACTTTTCAGTGTCAGCCCAGACACTTAATATATCTCATTCTGCCAGCACCAACATGGAGTGAGAAAGATGGAGCAATAGGGTAAGTTGTGACCATATTACCAGCTCCTTTGAAAAGAAAAAGAAGGTGGGTGTGCCTTTA
  3   1   2       bld Int1      in                         CAAP7134.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCACCCGGTACAGAGCCTGCAGCAGAGACTCCCAGCCCTACAAAAGTGCAAAAAAGTTGGAGCTTTAATGACCGCACAAGATTCCGTGCATCACTAAGACTAAAATCAAGGCCACAGGCTGATGAGGGTCCTGGAGACGACATTAATGATGAAAAGAGACTTCCAAATGATTTGACCATGGAGGATGTGATGCCAACTATAAAAACCCTGATTCGAGCCTTTAGAATCCTTAAATTCCTTGTGGCAAAGAGGAAGTTTAAGGAGACTCTACGGCCATATGATGTGAAGGATGTAATTGAGCAGTATTCAGCTGGACATTTGGATATGCTTGGGCGCATTAAGAGCCTGCAGGGCAGGGTGGATCAGATCATTGGCCGGGGGCCTGTGCCGGTAGAGAAAAAACCTAGAGATAAAGGAGAGAAGGTTTCCACCATGGGTCCTGAAGTTGAAGCTGCTGATGAGCTAAGCATGATGGGAAGGGTAGTAAAGGTTGAGAGACAGGTCCAGAGCATTGAAGATAAACTTGATATACTTCTAGGTTTCTACTCTCAGTGTATCCGGAAAGGTCCAGCAAGCTCTTTTACATTGACCTCTATGCAAATGCCATTGATTGACCAAGAAATGACATCTGATTACCAGAGCCCTGTGGATCCAGTGGACTTTTCAGTGTCAGCCCAGACACTTAATATATCTCATTCTGCCAGCACCAACATGGAGTGAGAAAGATGGAGCAATAGGGTAAGTTGTGACCATATTACCAGCTCCTTTGAAAAGAAAAAGAAGGTGGGTGTGCCTTTA
  5   1   2       bld BrSp      in                     EC2BBA17CE12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGCAAAGAGGAAGTTTAAGGAGACTCTACGGCCATATGATGTGAAGGATGTAATTGAGCAGTATTCAGCTGGACATTTGGATATGCTTGGGCGCATTAAGAGCCTGCAGGGCAGGGTGGATCAGATCATTGGCCGGGGGCCTGTGCCGGTAGAGAAAAAACCTAGAGATAAAGGAGAGAAGGTTTCCACCATGGGTCCTGAAGTTGAAGCTGCTGATGAGCTAAGCATGATGGGAAGGGTAGTGAAGGTTGAGAGACAGGTCCAGAGCATTGAAGATAAACTTGATATACTTCTAGGTTTCTACTCTCAGTGTATCCGGAAAGGTCCAGCAAGCTCTTTTACATTGACCTCTATGCAAATGCCATTGATTGACCAAGAAATGACATCTGATTACCAGAGCCCTGTGGATCCAGTGGACTTTTCAGTGTCAGCCCAGACACTTAATATATCTCATTCTGCCAGCACCAACATGGAGTGAGAAAGATGGAGCAATAGGGTAAGTTGTGACCATATTACCAGCTCCTTTTGAAAAGAAAAAGAAGGTGGGTGTGCCTTTACTCGAGGAGCAACAGGATGAGAGATCTTCTGTAGAGACTAAGTGATCCCTTCGACTGTCTTGCTTCTGCTGCTCCCACC
  5   1   2       bld Lun1      in                         CABD2327.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCCACCATGGGTCCTGAAGTTGAAGCTGCTGATGAGCTAAGCATGATGGGAAGGGTAGTAAAGGTTGAGAGACAGGTCCAGAGCATTGAAGATAAACTTGATATACTTCTAGGTTTCTACTCTCAGTGTATCCGGAAAGGTCCAGCAAGCTCTTTTACATTGACCTCTATGCAAATGCCATTGATTGACCAAGAAATGACATCTGATTACCAGAGCCCTGTGGATCCAGTGGACTTTTCAGTGTCAGCCCAGACACTTAATATATCTCATTCTGCCAGCACCAACATGGAGTGAGAAAGATGGAGCAATAGGGTAAGTTGTGACCATATTACCAGCTCCTTTTGAAAAGAAAAAGAAGGTGGGTGTGCCTTTACTCGAGGAGCAACAGGATGAGAGATCTTCTGTAGAGACTAAGTGATCCCTTCGACTGTCTTGCTTCTGCTGCTCCCACCAAATGTAGAAAGGCTAAAGAACTTATGCAGTTGAAAAAGCAAGTCCACTGGAAACAGAACTTTGGTCTTTTGAGCCACAGAGAGATTAGAAGTACTGTTCAAAGAAGCCATATTTACTCTCCTGTAAAGTGGAGAGGCTTGACTCCTTTGGCCCTTTTTTCACCATGACTTTTATAGGATGTTTTCCATCAGGATCCAGTGTCCCAAAACATAGTTTTTTCCCTGCAGCTGTGAAGAACAAATAATAGACTGCAACTTAAAAATGTTGTTTCCTCCATGTCTTGCTACCTTGACGGATGTCACACCTAGTCTCTAGAAAGTGCCTCANAAACTTAAATATATAAATGCTGCTCCCATACAGCCTTCATCTCCTGGCATGGGCAGCAGGAGGTTTAGTTCACT
  5   1   2      seed Te1       in                        CBWN12740.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGATGGAGCAATAGGGTAAGTTGTGACCATATTACCAGCTCCTTTTGAAAAGAAAAAGAAGGTGGGTGTGCCTTTACTCGAGGAGCAACAGGATGAGAGATCTTCTGTAGAGACTAAGTGATCCCTTCGACTGTCTTGCTTCTGCTGCTCCCACCAAATGTAGAAAGGCTAAAGAACTTATGCAGTTGAAAAAGCAAGTCCACTGGAAACAGAACTTTGGTCTTTTGAGCCACAGAGAGATTAGAAGTACTGTTCAAAGAAGCCATATTTACTCTCCTGTAAAGTGGAGAGGCTTGACTCCTTTGGCCCTTTTTTCACCATGACTTTTATAGGATGTTTTCCATCAGGATCCAGTGTCCCAAAACATAGTTTTTTCCCTGCAGCTGTGAAGAACAAATAATAGACTGCAACTTAAAAATTTTGTTTCCTCCATGTCTTGCTACCTTGACGGATGTCACACCTAGTCTCTAGAAAGTGCCTCAAAAACTTAAATATATAAATGCTGCTCCCATACAGCCTTCATCTCCTGGCATGGGCAGCAGGAGGTTTAGTTCACTTAAAATATGCCACTTTTCAAGCATGCTAGACAGGGACTTTTGCATTAATCCCACCAACACTATGCATTTCTACTTTTAGCTGTGCTTGCTATCTAATCACTCATATCATCACGTCTGACCATCAGCATAAACATACCTTCAACAATATGACTTCCTATAAATTAAGCACAATGCTACACATGTTCTTTGTTCTTAAGGTACTGCAGATATATAAGGTCTACATTCTGATGATCTTCCTCTGCTTTTGATACCAAT
  5   1   2       bld BrSp      in                     EC2BBA11DC08.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAGACTAAGTGATCCCTTCGACTGTCTTGCTTCTGCTGCTCCCACCAAATGCAGAAAGGCTAAAGAACTTATGCAGTTGAAAAAGCAAGTCCACTGGAAACAGAACTTTGGTCTTTTGAGCCACAGAGAGATTAGAAGTACTGTTCAAAGAAGCCATATTTACTCTCCTGTAAAGTGGAGAGGCTTGACTCCTTTGGCCCTTTTTTCACCATGACTTTTATAGGATGTTTTCCATCTGGATCCAGTGTCCCAAAACATAGTTTTTTCCCTGCAGCTGTGAAGAACAAATAATAGACTGCAACTTAAAAATGTTGTTTCCTCCATGTCTTGCTACCTTGACGGATGTCACACCTAGTCTCTAGAAAGTGCCTCAAAAACTTAAATATATAAATGCTGCTCCCATACAGCCTTCATCTCCTGGCATGGGCAGCAGGAGGTTTAGTTCACTTAAAATATGCCACTTTTCAAGCATGCTAGACAGGGACTTTTGCATTAATCCCACCAACACTATGCATTTCTACTTTTAGCTGTGCTTGCTATCTAATCACTCATATCATCACGTCTGACCATCAGCATAAACATACCTTCAACAATATGACTTCCTATAAATTAAGCACAATGCTACACATGTTCTTTGTTCTTAAGGTACTGCAGATATATAAGGTTATAGTAAGTCTACATTCTGAAGATCTTCCTCTGCTTTTGATACCAATATGTTTTGTTGTTTGATTTTATTTTTCTTCTGGTTGGAAGAGAACATTAAATGCTAGTGCTGTAGAGGATGGCAGTATAGGGTAAATGTATTACTGTTTTTTCACCCTGC
  5   1   2       e50                                 Xt7.1-CAAN3464.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCTTTTGAGCCACAGAGAGATTAGAAGTACTGTTCAAAGAAGCCATATTTACTCTCCTGTAAAGTGGAGAGGCTTGACTCCTTTGGCCCTTTTTTCACCATGACTTTTATAGGATGTTTTCCATCAGGATCCAGTGTCCCAAAACATAGTTTTTTCCCTGCAGCTGTGAAGAACAAATAATAGACTGCAACTTAAAAATTTTGTTTCCTCCATGTCTTGCTACCTTGACGGATGTCACACCTAGTCTCTAGAAAGTGCCTCAAAAACTTAAATATATAAATGCTGCTCCCATACAGCCTTCATCTCCTGGCATGGGCAGCAGGAGGTTTAGTTCACTTAAAATATGCCACTTTTCAAGCATGCTAGACAGGGACTTTTGCATTAATCCCACCAACACTATGCATTTCTACTTTTAGCTGTGCTTGCTATCTAATCACTCATATCATCACGTCTGACCATCAGCATAAACATACCTTCAACAATATGACTTCCTATAAATTAAGCACAATGCTACACATGTTCTTTGTTCTTAAGGTACTGCAGATATATAAGGTCTACATTCTGATGATCTTCCTCTGCTTTTGATACCAATATGTTTTGTTGTTTGATTTTATTTTTCTTCTGGTTGGAAGAGAACATTAAATGCTAGTGCTGTAGAGGATGGCAGTATAGGGTGAATGTAGTACTGTTTTTCACCCTGCAGCAGCATTCATAAAGCCACTATTTAGAACGAAAAGTATACCCTCTGTAACAGCTATCTCCAAAAATTGACCCTTGGTGTCAGATCAGTAAGAAGTCTTACAGAGGGCCATTACTGCGTACAGATAATGGTCTTCATTGCTTTATGGAAAGTCAGAAAAAGCTGGAAAACACATACATAGTCTTAAACCGTTTTAATTTCTAAACAATCTGCCTGATAGCTTCAGTCTAGGGAGTTTAGAAATGCTTTCTTTTTAACCTTTACAACAGAATTGGTAATGCCTTTGACATTAAGGTAACATAGGTATTTATATAAGGACACAGTCCTATTAATATAGGTAAGAAAGGTGAACAGATCTTTTTTTAAAGATATTTGGTTAAACCTTGTTAAAGCATTACTACAAAGAATCTTGTGCACAAATCTTTAGTTACGCAGCTATCAGCTCTAACATTCCCCTGCCTCTCATTTGCTGTAAAGGGTCAGCTTGGTTAGCACCCCCTAGGTGCTGGTATCTTGGTAGTAGTACCCTGCACGCTCCCAATGAATGCTATGCATGCTCTAGCATGAAGCTAGGATCTGCATCCGGTATAGGGGCTCCCCCCCATGCACACTCACACTCAGATGTTTACCTGCTCCTTCTCTGATAGCAGAGAATTTTGGAGCAATTTTCTGGGGGGGGACATTTGTAGTTAGATGAGGTTAGTTAAATGCTACTGAAACTTGACTTGGGAATAGAAATGTTTGCAATAGAACAGTTCTGTACCTCACTTGATTAATTTATTGACCTACTGGTTTCATTAAAGTTTTACTT
                                                  Xt7.1-CHK-1008233259                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAGCCACAGAGAGATTAGAAGTACTGTTCAAAGAAGCCATATTTACTCTCCTGTAAAGTGGAGAGGCTTGACTCCTTTGGCCCTTTTTTCACCATGACTTTTATAGGATGTTTTCCATCAGGATCCAGTGTCCCAAAACATAGTTTTTTCCCTGCAGCTGTGAAGAACAAATAATAGACTGCAACTTAAAAATTTTGTTTCCTCCATGTCTTGCTACCTTGACGGATGTCACACCTAGTCTCTAGAAAGTGCCTCAAAAACTTAAATATATAAATGCTGCTCCCATACAGCCTTCATCTCCTGGCATGGGCAGCAGGAGGTTTAGTTCACTTAAAATATGCCACTTTTCAAGCATGCTAGACAGGGACTTTTGCATTAATCCCACCAACACTATGCATTTCTACTTTTAGCTGTGCTTGCTATCTAATCACTCATATCATCACGTCTGACCATCAGCATAAACATACCTTCAACAATATGACTTCCTATAAATTAAGCACAATGCTACACATGTTCTTTGTTCTTAAGGTACTGCAGATATATAAGGTCTACATTCTGATGATCTTCCTCTGCTTTTGATACCAATATGTTTTGTTGTTTGATTTTATTTTTCTTCTGGTTGGAAGAGAACATTAAATGCTAGTGCTGTAGAGGATGGCAGTATAGGGTGAATGTAGTACTGTTTTTCACCCTGCAGCAGCATTCATAAAGCCACTATTTAGAACGAAAAGTATACCCTCTGTAACAGCTATCTCCAAAAATTGACCCTTGGTGTCAGATCAGTAAGAAGTCTTACAGAGGGCCATTACTGCGTACAGATAATGGTCTTCATTGCTTTATGGAAAGTCAGAAAAAGCTGGAAAACACATACATAGTCTTAAACCGTTTTAATTTCTAAACAATCTGCCTGATAGCTTCAGTCTAGGGAGTTTAGAAATGCTTTCTTTTTAACCTTTACAACAGAATTGGTAATGCCTTTGACATTAAGGTAACATAGGTATTTATATAAGGACACAGTCCTATTAATATAGGTAAGAAAGGTGAACAGATCTTTTTTTAAAGATATTTGGTTAAACCTTGTTAAAGCATTACTACAAAGAATCTTGTGCACAAATCTTTAGTTACGCAGCTATCAGCTCTAACATTCCCCTGCCTCTCATTTGCTGTAAAGGGTCAGCTTGGTTAGCACCCCCTAGGTGCTGGTATCTTGGTAGTAGTACCCTGCACGCTCCCAATGAATGCTATGCATGCTCTAGCATGAAGCTAGGATCTGCATCCGGTATAGGGGCTCCCCCCCATGCACACTCACACTCAGATGTTTACCTGCTCCTTCTCTGATAGCAGAGAATTTTGGAGCAATTTTCTGGGGGGGGACATTTGTAGTTAGATGAGGTTAGTTAAATGCTACTGAAACTTGACTTGGGAATAGAAATGTTTGCAATAGAACAGTTCTGTACCTCACTTGATTAATTTATTGACCTACTGGTTTCATTAAAGTTTTACTTAGAAAA
  3  -1   2       bld Kid1      in                         CABA3657.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGGTCGAGGAGCAACAGGATGAGAGATCTTCTGTAGAGACTAAGTGATCCCTTCGACTGTCTTGCTTCTGCTGCTCCCACCAAATGTAGAAAGGCTAAAGAACTTATGCAGTTGAAAAAGCAAGTCCACTGGAAACAGAACTTTGGTCTTTTGAGCCACAGAGAGATTAGAAGTACTGTTCAAAGAAGCCATATTTACTCTCCTGTAAAGTGGAGAGGCTTGACTCCTTTGGCCCTTTTTTCACCATGACTTTTATAGGATGTTTTCCATCAGGATCCAGTGTCCCAAAACATAGTTTTTTCCCTGCAGCTGTGAAGAACAAATAATAGACTGCAACTTAAAAATTTTGTTTCCTCCATGTCTTGCTACCTTGACGGATGTCACACCTAGTCTCTAGAAAGTGCCTCAAAAACTTAAATATATAAATGCTGCTCCCATACAGCCTTCATCTCCTGGCATGGGCAGCAGGAGGTTTAGTTCACTTAAAATATGCCACTTTTCAAGCATGCTAGACAGGGACTTTTGCATTAATCCCACCAACACTATGCATTTCTACTTTTAGCTGTGCTTGCTATCTAATCACTCATATCATCACGTCTGACCATCAGCATAAACATACCTTCAACAATATGACTTCCTATAAATTAAGCACAATGCTACACATGTTCTTTGTTCTTAAGGTACTGCAGATATATAAGGTCTACATTCTGATGATCTTCCTCTGCTTTTGATACCAATATGTTTTGTTGTTTGATTTTATTTTTCTTCTGGTTGGAAGAGAACATTAAATGCTAGTGCTGTAGAGGATGGCAGTATAGGGTGAATGTAGTACTGTTTTTCACCCTGCAGCAGCATTCATAAAGCCACTATTTAGAACGAAAAGTATACCCTCTGTAACAGCTATCTCCAAAAAATGACC
  5  -1   2       bld Kid1      in                         CABA3657.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCTTTTGAGCCACAGAGAGATTAGAAGTACTGTTCAAAGAAGCCATATTTACTCTCCTGTAAAGTGGAGAGGCTTGACTCCTTTGGCCCTTTTTTCACCATGACTTTTATAGGATGTTTTCCATCAGGATCCAGTGTCCCAAAACATAGTTTTTTCCCTGCAGCTGTGAAGAACAAATAATAGACTGCAACTTAAAAATTTTGTTTCCTCCATGTCTTGCTACCTTGACGGATGTCACACCTAGTCTCTAGAAAGTGCCTCAAAAACTTAAATATATAAATGCTGCTCCCATACAGCCTTCATCTCCTGGCATGGGCAGCAGGAGGTTTAGTTCACTTAAAATATGCCACTTTTCAAGCATGCTAGACAGGGACTTTTGCATTAATCCCACCAACACTATGCATTTCTACTTTTAGCTGTGCTTGCTATCTAATCACTCATATCATCACGTCTGACCATCAGCATAAACATACCTTCAACAATATGACTTCCTATAAATTAAGCACAATGCTACACATGTTCTTTGTTCTTAAGGTACTGCAGATATATAAGGTCTACATTCTGATGATCTTCCTCTGCTTTTGATACCAATATGTTTTGTTGTTTGATTTTATTTTTCTTCTGGTTGGAAGAGAACATTAAATGCTAGTGCTGTAGAGGATGGCAGTATAGGGTGAATGTAGTACTGTTTTTCACCCTGCAGCAGCATTCATAAAGCCACTATTTAGAACGAAAAGTATACCCTCTGTAACAGCTATCTCCAAAAATTGACCCTTGGTGTCAGATCAGTAAGAAGTCTTACAGAGGGCCATTACTGCGTACAGATAATGGTCTTCATTGCTTTATGGAAAGTCAGAAAAAGCTGG
  3   1   2       bld BrSp      in                     EC2BBA11DC08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGTTAGTGCTGTAGAGGATGGCAGTATAGGGGTAAATGTAGTACTGTTTTTCACCCTGCAGCAGCATTCATAAAGCCACTATTTAGAACGAAAAGTATACCCTCTGTAACAGCTATCTCCAAAAATTGACCCTTGGTGTCAGATCAGTAAGAAGTCTTACAGAGGGCCATTACTGCGTACAGAAAATGGTCTTCATTGCTTTATGGAAAGTCAGAAAAAGCTGGAAAACACATACATAGTCTTAAACCGTTTTAATTTCTAAACAATCTGCCTGATAGCTTCAGTCTAGGGAGTTTAGAAATGCTTTCTTTTTAACCTTTACAACAGAATTGGTAATGCCTTTGACATTAAGGTAACATAGGTATTTATATAAGGACACAGTCCTATTAATATAGGTAAGAAAGGTGAACAGATCTTTTTTTAAAGATATTTGGTTAAACCTTGTTAAAGCATTACTACAAAGAATCTTGTGCACAAATCTTTAGTTACGCAGCTATCAGCTCTAACATTCCCCTGCCTCTCATTTGCTGTAAAGGGTCAGCTTGGTTAGCACCCCCTAGGTGCTGGTATCTTGGTAGTAGTACCCTGCACGCTCCCAATGAATGCTATGCATGCTCTAGCATGAAGCTAGGATCTGCATCCGGTATAGGGGCTCCCCCCCATGCACACTCACACTCAGATGTTTACCTGCTCCTTCTCTGATAGCAGAGAATTTTGGAGCAATTTTCTGGGGGGGGACATTTGTAGTTAGATGAGGTTAGTTAAATGCTACTGAAACTTGACTTGGGAATAGAAATGTTTGCAATAGAACAGTTCTGTACCT
  3   1   2      seed Te4  5g3  out                        CAAN3464.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGTAGAGGATGGCAGTATAGGGTGAATGTAGTACTGTTTTTCACCCTGCAGCAGCATTCATAAAGCCACTATTTAGAACGAAAAGTATACCCTCTGTAACAGCTATCTCCAAAAATTGACCCTTGGTGTCAGATCAGTAAGAAGTCTTACAGAGGGCCATTACTGTGTACAGATAATGGTCTTCATTGCTTTATGGAAAGTCAGAAAAAGCTGGAAAACACATACATAGTCTTAAACCGTTTTAATTTCTAAACAATCTGCCTGATAGCTTCAGTCTAGGGAGTTTAGAAATGCTTTCTTTTTAACCTTTACAACAGAATTGGTAATGCCTTTGACATTAAGGTAACATAGGTACTTATATAAGGACACAGTCCTATTAATATAGGTAAGAAAGGTGAACAGATCTTTTTTTAAAGATATTTGGTTAAACCTTGTTAAAGCATTACTACAAAGAATCTTGTGCACAAATCTTTAGTTACGCAGCTATCAGCTCTAACATTCCCCTGCCTCTCATTTGCTGTAAAGGGTCAGCTTGGTTAGCACCCCCTAGGTGCTGGTATCTTGGTAGTAGTACCCTGCACGCTCCCAATGAATGCTATGCATGCTCTAGCATGAAGCTAGGATCTGCATCCGGTATAGGGGCTCCCCCCCATGCACACTCACACTCAGATGTTTACCTGCTCCTTCTCTGATAGCAGAGAATTTTGGAGCAATTTTCTGGGGGGGGACATTTGTAGTTAGATGAGGTTAGTTAAATGCTACTGAAACTTGACTTGGGAATAGAAATGTTTGCAATAGAACAGTTCTGTACCTCACTTGATTAATTTATTGACCTACTGGTTTCATTAAAGTTTTACTTAG
  3   1   2       bld Te4  FL   out                        CAAN5750.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGGCAGTATAGGGTGAATGTAGTACTGTTTTTCACCCTGCAGCAGCATTCATAAAGCCACTATTTAGAACGAAAAGTATACCCTCTGTAACAGCTATCTCCAAAAATTGACCCTTGGTGTCAGATCAGTAAGAAGTCTTACAGAGGGCCATTACTGTGTACAGATAATGGTCTTCATTGCTTTATGGAAAGTCAGAAAAAGCTGGAAAACACATACATAGTCTTAAACCGTTTTAATTTCTAAACAATCTGCCTGATAGCTTCAGTCTAGGGAGTTTAGAAATGCTTTCTTTTTAACCTTTACAACAGAATTGGTAATGCCTTTGACATTAAGGTAACATAGGTACTTATATAAGGACACAGTCCTATTAATATAGGTAAGAAAGGTGAACAGATCTTTTTTTAAAGATATTTGGTTAAACCTTGTTAAAGCATTACTACAAAGAATCTTGTGCACAAATCTTTAGTTACGCAGCTATCAGCTCTAACATTCCCCTGCCTCTCATTTGCTGTAAAGGGTCAGCTTGGTTAGCACCCCCTAGGTGCTGGTATCTTGGTAGTAGTACCCTGCACGCTCCCAATGAATGCTATGCATGCTCTAGCATGAAGCTAGGATCTGCATCCGGTATAGGGGCTCCCCCCCATGCACACTCACACTCAGATGTTTACCTGCTCCTTCTCTGATAGCAGAGAATTTTGGAGCAATTTTCTGGGGGGGGACATTTGTAGTTAGATGAGGTTAGTTAAATGCTACTGAAACTTGACTTGGGAATAGAAATGTTTGCAATAGAACAGTTCTGTACCTCACTTGATTAATTTATTGACCTACTGGTTTCATTAAAGTTTTACTTAG
  3   1   2       bld Te4       in                         CAAN9170.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTATAGGGTGAATGTAGTACTGTTTTTCACCCTGCAGCAGCATTCATAAAGCCACTATTTAGAACGAAAAGTATACCCTCTGTAACAGCTATCTCCAAAAATTGACCCTTGGTGTCAGATCAGTAAGAAGTCTTACAGAGGGCCATTACTGTGTACAGATAATGGTCTTCATTGCTTTATGGAAAGTCAGAAAAAGCTGGAAAACACATACATAGTCTTAAACCGTTTTAATTTCTAAACAATCTGCCTGATAGCTTCAGTCTAGGGAGTTTAGAAATGCTTTCTTTTTAACCTTTACAACAGAATTGGTAATGCCTTTGACATTAAGGTAACATAGGTACTTATATAAGGACACAGTCCTATTAATATAGGTAAGAAAGGTGAACAGATCTTTTTTTAAAGATATTTGGTTAAACCTTGTTAAAGCATTACTACAAAGAATCTTGTGCACAAATCTTTAGTTACGCAGCTATCAGCTCTAACATTCCCCTGCCTCTCATTTGCTGTAAAGGGTCAGCTTGGTTAGCACCCCCTAGGTGCTGGTATCTTGGTAGTAGTACCCTGCACGCTCCCAATGAATGCTATGCATGCTCTAGCATGAAGCTAGGATCTGCATCCGGTATAGGGGCTCCCCCCCATGCACACTCACACTCAGATGTTTACCTGCTCCTTCTCTGATAGCAGAGAATTTTGGAGCAATTTTCTGGGGGGGGACATTTGTAGTTAGATGAGGTTAGTTAAATGCTACTGAAACTTGACTTGGGAATAGAAATGTTTGCAATAGAACAGTTCTGTACCTCACTTGATTAATTTATTGACCTACTGGTTTCATTAAAGTTTTACTTAG
  3   1   2       bld Te4       in                        CAAN10350.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCAGCAGCATTCATAAAGCCACTATTTAGAACGAAAAGTATACCCTCTGTAACAGCTATCTCCAAAAATTGACCCTTGGTGTCAGATCAGTAAGAAGTCTTACAGAGGGCCATTACTGTGTACAGATAATGGTCTTCATTGCTTTATGGAAAGTCAGAAAAAGCTGGAAAACACATACATAGTCTTAAACCGTTTTAATTTCTAAACAATCTGCCTGATAGCTTCAGTCTAGGGAGTTTAGAAATGCTTTCTTTTTAACCTTTACAACAGAATTGGTAATGCCTTTGACATTAAGGTAACATAGGTACTTATATAAGGACACAGTCCTATTAATATAGGTAAGAAAGGTGAACAGATCTTTTTTTAAAGATATTTGGTTAAACCTTGTTAAAGCATTACTACAAAGAATCTTGTGCACAAATCTTTAGTTACGCAGCTATCAGCTCTAACATTCCCCTGCCTCTCATTTGCTGTAAAGGGTCAGCTTGGTTAGCACCCCCTAGGTGCTGGTATCTTGGTAGTAGTACCCTGCACGCTCCCAATGAATGCTATGCATGCTCTAGCATGAAGCTAGGATCTGCATCCGGTATAGGGGCTCCCCCCCATGCACACTCACACTCAGATGTTTACCTGCTCCTTCTCTGATAGCAGAGAATTTTGGAGCAATTTTCTGGGGGGGGACATTTGTAGTTAGATGAGGTTAGTTAAATGCTACTGAAACTTGACTTGGGAATAGAAATGTTTGCAATAGAACAGTTCTGTACCTCACTTGATTAATTTATTGACCTACTGGTTTCATTAAAGTTTTACTTAGAAAAGTT
  3   1   2       bld Lun1      in                         CABD2327.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCAGCAGCATTCATAAAGCCACTATTTAGAACGAAAAGTATACCCTCTGTAACAGCTATCTCCAAAAATTGACCCTTGGTGTCAGATCAGTAAGAAGTCTTACAGAGGGCCATTACTGTGTACAGATAATGGTCTTCATTGCTTTATGGAAAGTCAGAAAAAGCTGGAAAACACATACATAGTCTTAAACCGTTTTAATTTCTAAACAATCTGCCTGATAGCTTCAGTCTAGGGAGTTTAGAAATGCTTTCTTTTTAACCTTTACAACAGAATTGGTAATGCCTTTGACATTAAGGTAACATAGGTACTTATATAAGGACACAGTCCTATTAATATAGGTAAGAAAGGTGAACAGATCTTTTTTTAAAGATATTTGGTTAAACCTTGTTAAAGCATTACTACAAAGAATCTTGTGCACAAATCTTTAGTTACGCAGCTATCAGCTCTAACATTCCCCTGCCTCTCATTTGCTGTAAAGGGTCAGCTTGGTTAGCACCCCCTAGGTGCTGGTATCTTGGTAGTAGTACCCTGCACGCTCCCAATGAATGCTATGCATGCTCTAGCATGAAGCTAGGATCTGCATCCGGTATAGGGGCTCCCCCCCATGCACACTCACACTCAGATGTTTACCTGCTCCTTCTCTGATAGCAGAGAATTTTGGAGCAATTTTCTGGGGGGGGACATTTGTAGTTAGATGAGGTTAGTTAAATGCTACTGAAACTTGACTTGGGAATAGAAATGTTTGCAATAGAACAGTTCTGTACCTCACTTGATTAATTTATTGACCTACTGGTTTCATTAAAGTTTTACTTAGAAAAGTT
  5  -1   2       bld Limb      out                      CBSU10307.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCAGCAGCATTCATAAAGCCACTATTTAGAACGAAAAGTATACCCTCTGTAACAGCTATCTCCAAAAATTGACCCTTGGTGTCAGATCAGTAAGAAGTCTTACAGAGGGCCATTACTGCGTACAGATAATGGTCTTCATTGCTTTATGGAAAGTCAGAAAAAGCTGGAAAACACATACATAGTCTTAAACCGTTTTAATTTCTAAACAATCTGCCTGATAGCTTCAGTCTAGGGAGTTTAGAAATGCTTTCTTTTTAACCTTTACAACAGAATTGGTAATGCCTTTGACATTAAGGTAACATAGGTATTTATATAAGGACACAGTCCTATTAATATAGGTAAGAAAGGTGAACAGATCTTTTTTTAAAGATATTTGGTTAAACCTTGTTAAAGCATTACTACAAAGAATCTTGTGCACAAATCTTTAGTTACGCAGCTATCAGCTCTAACATTCCCCTGCCTCTCATTTGCTGTAAAGGGTCAGCTTGGTTAGCACCCCCTAGGTGCTGGTATCTTGGTAGTAGTACCCTGCACGCTCCCAATGAATGCTATGCATGCTCTAGCATGAAGCTAGGATCTGCATCCGGTATAGGGGCTCCCCCCCATGCACACTCACACTCAGATGTTTACCTGCTCCTTCTCTGATAGCAGAGAATTTTGGAGCAATTTTCTGGGGGGGGACATTTGTAGTTAGATGAGGTTAGTTAAATGCTACTGAAACTTGACTTGGGAATAGAAATGTTTGCAATAGAACAGTTCTGTACCTCACTTGATTAATTTATTGACCTACTGGTTTCATTAAAGTTTTACTTAAAAAACGGA
  3   1   2       bld Te3  5g3  out                        CAAM8173.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTAGAACGAAAAGTATACCCTCTGTAACAGCTATCTCCAAAAATTGACCCTTGGTGTCAGATCAGTAAGAAGTCTTACAGAGGGCCATTACTGCGTACAGATAATGGTCTTCATTGCTTTATGGAAAGTCAGAAAAAGCTGGAAAACACATACATAGTCTTAAACCGTTTTAATTTCTAAACAATCTGCCTGATAGCTTCAGTCTAGGGAGTTTAGAAATGCTTTCTTTTTAACCTTTACAACAGAATTGGTAATGCCTTTGACATTAAGGTAACATAGGTATTTATATAAGGACACAGTCCTATTAATATAGGTAAGAAAGGTGAACAGATCTTTTTTTAAAGATATTTGGTTAAACCTTGTTAAAGCATTACTACAAAGAATCTTGTGCACAAATCTTTAGTTATGCAGCTATCAGCTCTAACATTCCCCTGCCTCTCATTTGCTGTAAAGGGTCAGCTTGGTTAGCACCCCCTAGGTGCTGGTATCTTGGTAGTAGTACCCTGCACGCTCCCAATGAATGCTATGCATGCTCTAGCATGAAGCTAGGATCTGCATCCGGTATAGGGGCTCCCCCCCATGCACACTCACACTCAGATGTTTACCTGCTCCTTCTCTGATAGCAGAGAATTTTGGAGCAATTTTCTGGGGGGGGACATTTGTAGTTAGATGAGGTTAGTTAAATGCTACTGAAACTTGACTTGGGAATAGAAATGTTTGCAATAGAACAGTTCTGTACCTCACTTGATTAATTTATTGACCTACTGGTTTCATTAAAGTTTTACTTAGAAAAGTT
  3   1   2       bld Te4       in                          CAAN469.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTAACAGCTATCTCCAAAAATTGACCCTTGGTGTCAGATCAGTAAGAAGTCTTACAGAGGGCCATTACTGCGTACAGATAATGGTCTTCATTGCTTTATGGAAAGTCAGAAAAAGCTGGAAAACACATACATAGTCTTAAACCGTTTTAATTTCTAAACAATCTGCCTGATAGCTTCAGTCTAGGGAGTTTAGAAATGCTTTCTTTTTAACCTTTACAACAGAATTGGTAATGCCTTTGACATTAAGGTAACATAGGTATTTATATAAGGACACAGTCCTATTAATATAGGTAAGAAAGGTGAACAGATCTTTTTTTAAAGATATTTGGTTAAACCTTGTTAAAGCATTACTACAAAGAATCTTGTGCACAAATCTTTAGTTATGCAGCTATCAGCTCTAACATTCCCCTGCCTCTCATTTGCTGTAAAGGGTCAGCTTGGTTAGCACCCCCTAGGTGCTGGTATCTTGGTAGTAGTACCCTGCACGCTCCCAATGAATGCTATGCATGCTCTAGCATGAAGCTAGGATCTGCATCCGGTATAGGGGCTCCCCCCCATGCACACTCACACTCAGATGTTTACCTGCTCCTTCTCTGATAGCAGAGAATTTTGGAGCAATTTTCTGGGGGGGGACATTTGTAGTTAGATGAGGTTAGTTAAATGCTACTGAAACTTGACTTGGGAATAGAAATGTTTGCAATAGAACAGTTCTGTACCTCACTTGATTAATTTATTGACCTACTGGTTTCATTAAAGTTTTACTTAG
  3   1   2       bld BrSp      in                     EC2BBA17CE12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAACAGCTATCTCCAAAAATTGACCCTTGGTGTCAGATCAGTAAGAAGTCTTACAGAGGGCCATTACTGCGTACAGATAATGGTCTTCATTGCTTTATGGAAAGTCAGAAAAAGCTGGAAAACACATACATAGTCTTAAACCGTTTTAATTTCTAAACAATCTGCCTGATAGCTTCAGTCTAGGGAGTTTAGAAATGCTTTCTTTTTAACCTTTACAACAGAATTGGTAATGCCTTTGACATTAAGGTAACATAGGTATTTATATAAGGACACAGTCCTATTAATATAGGTAAGAAAGGTGAACAGATCTTTTTTTAAAGATATTTGGTTAAACCTTGTTAAAGCATTACTACAAAGAATCTTGTGCACAAATCTTTAGTTACGCAGCTATCAGCTCTAACATTCCCCTGCCTCTCATTTGCTGTAAAGGGTCAGCTTGGTTAGCACCCCCTAGGTGCTGGTATCTTGGTAGTAGTACCCTGCACGCTCCCAATGAATGCTATGCATGCTCTAGCATGAAGCTAGGATCTGCATCCGGTATAGGGGCTCCCCCCCATGCACACTCACACTCAGATGTTTACCTGCTCCTTCTCTGATAGCAGAGAATTTTGGAGCAATTTTCTGGGGGGGGACATTTGTAGTTAGATGAGGTTAGTTAAATGCTACTGAAACTTGACTTGGGAATAGAAATGTTTGCAATAGAACAGTTCTGTACCTCACTTGATTAATTT
  3   1   2       bld Thy1      in                        CBST8519.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTGTCAGATCAGTAAGAAGTCTTACAGAGGGCCATTACTGCGTACAGATAATGGTCTTCATTGCTTTATGGAAAGTCAGAAAAAGCTGGAAAACACATACATAGTCTTAAACCGTTTTAATTTCTAAACAATCTGCCTGATAGCTTCAGTCTAGGGAGTTTAGAAATGCTTTCTTTTTAACCTTTACAACAGAATTGGTAATGCCTTTGACATTAAGGTAACATAGGTATTTATATAAGGACACAGTCCTATTAATATAGGTAAGAAAGGTGAACAGATCTTTTTTTAAAGATATTTGGTTAAACCTTGTTAAAGCATTACTACAAAGAATCTTGTGCACAAATCTTTAGTTACGCAGCTATCAGCTCTAACATTCCCCTGCCTCTCATTTGCTGTAAAGGGTCAGCTTGGTTAGCACCCCCTAGGTGCTGGTATCTTGGTAGTAGTACCCTGCACGCTCCCAATGAATGCTATGCATGCTCTAGCATGAAGCTAGGATCTGCATCCGGTATAGGGGCTCCCCCCCATGCACACTCACACTCAGATGTTTACCTGCTCCTTCTCTGATAGCAGAGAATTTTGGAGCAATTTTCTGGGGGGGGACATTTGTAGTTAGATGAGGTTAGTTAAATGCTACTGAAACTTGACTTGGGAATAGAAATGTTTGCAATAGAACAGTTCTGTACCTCACTTGATTAATTTATTGACCTACTGGTTTCATTAAAGTTTTACTTAG
  3   1   2       bld Te1       in                        CBWN12740.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTACAACAGAATTGGTAATGCCTTTGACATTAAGGTAACATAGGTATTTATATAAGGACACAGTCCTATTAATATAGGTAAGAAAGGTGAACAGATCTTTTTTTAAAGATATTTGGTTAAACCTTGTTAAAGCATTACTACAAAGAATCTTGTGCACAAATCTTTAGTTACGCAGCTATCAGCTCTAACATTCCCCTGCCTCTCATTTGCTGTAAAGGGTCAGCTTGGTTAGCACCCCCTAGGTGCTGGTATCTTGGTAGTAGTACCCTGCACGCTCCCAATGAATGCTATGCATGCTCTAGCATGAAGCTAGGATCTGCATCCGGTATAGGGGCTCCCCCCCATGCACACTCACACTCAGATGTTTACCTGCTCCTTCTCTGATAGCAGAGAATTTTGGAGCAATTTTCTGGGGGGGGACATTTGTAGTTAGATGAGGTTAGTTAAATGCTACTGAAACTTGACTTGGGAATAGAAATGTTTGCAATAGAACAGTTCTGTACCTCACTTGATTAATTTATTGACCTACTGGTTTCATTAAAGTTTTACTTAGAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)