Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABE5186.3                           53 END     1           1        1                Huntingtin interacting protein 2 [Xenopus tropicalis]
     2   2.0    0Xt7.1-THdA036g23.3.5                       29 END     1           1        3                LOC495280 protein [Xenopus laevis]
     3   2.0    0Xt7.1-CAAK1905.5                            4 END     3           4       75                Unknown (protein for MGC:82390) [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     4 200.0    0Xt7.1-IMAGE:8958143.5                       3 PI      76       4015     4305                (no blast hit)

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     5  97.0    0(repeat)                                    0 REP     83       2493     3024                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012154909 Xt7.1-CABH6898.5.5 - 64 ESTs
                                                                       .......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810......4820......4830......4840......4850......4860......4870......4880......4890......4900......4910......4920......4930......4940......4950......4960......4970......4980......4990......5000......5010......5020......5030......5040......5050......5060......5070......5080......5090......5100......5110......5120......5130......5140......5150......5160......5170......5180......5190......5200......5210......5220......5230......5240......5250......5260......5270......5280......5290......5300......5310......5320......5330......5340......5350......5360......5370......5380......5390......5400......5410......5420......5430......5440......5450......5460......5470......5480......5490......5500......5510......5520......5530......5540......5550......5560......5570......5580......5590......5600......5610......5620......5630......5640......5650......5660......5670......5680......5690......5700......5710......5720......5730......5740......5750......5760......5770......5780......5790......5800......5810......5820......5830......5840......5850......5860......5870......5880......5890......5900......5910......5920......5930......5940......5950......5960......5970......5980......5990......6000......6010......6020......6030......6040......6050......6060......6070......6080......6090......6100......6110......6120......6130......6140......6150......6160......6170......6180......6190......6200......6210......6220......6230......6240......6250......6260......6270......6280......6290......6300......6310......6320......6330......6340......6350......6360......6370......6380......6390......6400......6410......6420......6430......6440......6450......6460......6470......6480......6490......6500......6510......6520......6530......6540......6550......6560......6570......6580......6590......6600......6610......6620......6630......6640......6650......6660......6670......6680......6690......6700......6710......6720......6730......6740......6750......6760......6770......6780......6790......6800......6810......6820......6830......6840......6850......6860......6870......6880......6890......6900......6910......6920......6930......6940......6950......6960......6970......6980......6990......7000......7010......7020......7030......7040......7050......7060......7070......7080......7090......7100......7110......7120......7130......7140......7150......7160......7170......7180......7190......7200......7210......7220......7230......7240......7250......7260......7270......7280......7290......7300......7310......7320......7330......7340......7350......7360......7370......7380......7390......7400......7410......7420......7430......7440......7450......7460......7470......7480......7490......7500......7510......7520......7530......7540......7550......7560......7570......7580......7590......7600......7610......7620......7630......7640......7650......7660......7670......7680......7690
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABH6898.5.5                                      TAGAGACCTACGGGACAGCGGGTTGTGTTGAGACATTCCGGACTGTACCACCTGTAGCTGTGCTGTAGGGGCGGATCATGTCTGACTCAGGCCACAGCCAGCCCAATGTGTTTATCCCTGGGCGCAACAGAAGGCGACGCTGGATGGACCAAGGACCGCCGGGACACCTTAACCTCTCGGAACCTGGACGAGAGAAAGACCCCATGCTCCGGGACAGAGATCAGGATAGATGGGAGGGAAATGAAGAGGGCTATGGCTACACCATTCAGAAAACTCCTATCATCCTTGCAAAGCCAACCTCCGACAGGACAAAGGCGGCAACCCCAGCGGCACCTCCTCCTATGGAAAAACCCATTGTCCTGATGAAAGCCAGGGAAGATGGAAAACCAGCAGCCCCTGCAGAGGGTGCCACCGCACCCCCTCCCACTGCAGTAGCAAAGGTGGAGAAAGAGGGACAGCGACCCACCCAACCAGTATATCAAATACAGAACCGGGGCATGGGAGCCGCAGCAAGTGCCAGTGGCAATGTGGATCCTGTGGTTGGGCAGGCCAAGCTGCTGCCACCTCAGAAGATGAAACACAGCATCAAATTGGTGGATGAATACATGAACTGGTGTGACAGCGCTATTGAGTTCCTGCTGGACCAGACAGATGTCCTTGTGGTTGGCATCCTAGGATTGCAAGGCACAGGAAAGTCCACCCTGATGTCCCTGTTGTCAGCAAACTCTCCAGATGATGACCAAAGGTCTTACGTGTTTCGGATGCAGAGCCAGGAAGTGAGGGAAAGAGCTGGGAACCAGACTAGCGGCATTGACTTCTTCATTAGCCAGGAGAGGATCATCTTCCTCGATACCCAGCCAATTCTCAGTCCAGCGATACTGGATCATCTGATCAATAATGACCGAAAACTACCCCCAGAATACAATCTCCCCCACACCTATGTTGAGATGCAGTCTCTGCAGATCGCTGCCTTTTTGTTCACGGTTTGTCACGTTGTCATCGTTGTACAGGATTGGTTCACAGACTTCAATTTATACCGCTTCCTTCAGACAGCCGAAATGCTTAAGCCATCAACTCCCTCCCCCAGTCATGAGTCAAGTGGCTCTTCTGGCTCTGATGAAGGCATTGAGTATTATCCACATGTAGTTTTCGTGCAAAATAAAGCCAAGAGGGAGGATTACTGTCCCCGCACCTTAAAGCAGATGCACACAGTCATTGATAAACTCATGCTCCATTCACACCTGCGATACAAAGGCACTCTTTCCATGCTGGACTGCAACATCTTCCCAGGTCTGCCCTATGACTTTATCGAGTCAGAAGTTAACTTATTCTTGATCCCGACCATGGAGAGTGACGTGGATGAGACAATATCCAGGGCAGGCACCAGTGGAATCCCTCTCTTCTCCCTCCTGCCGGCATACAAAGGGCATCCCAGTTTTCATTCCCTGATCAGCAGACTGCGCAGCCAGATCATGTCCATGTCACGCCCTCAGCTCTCTCACACCATCCTGACCGAAAAGAACTGGTTCCACTATGCTGCCCGAATTTGGGATGGTGTAAAGAAGTCATCAGCACTTTCGGAGTACAGCAGGTTACTGGGCTAATGTTATACTCTGAAGAATGGCTGCAGTATCGAAATGGCCTGCTGCTGGTTAAGGAAAGACTGGCCCAGCTAAAGAGGCGCAGTATCAAGAAAGGATCGATTTCCTTGGCATTCATGTTGTCCTATGCGAGGTGATGGGATCAGGAACGATCCTGAAGGAGCAATTGTTCTTAGGCCCTTTGTGTTTTGGGAGACCATAAGGGTCCGTGTTTGAAATGGCACTGAGGAAACAAATAGTTGTTCCTATTTTGGAGAAGAGCTGTAGGGGTCCTTAACTTGTTTATCTAGCCTCATGGTGGACTACACCTTGCAACAAAGCCCTGTATCCCTAAAATGAAGTCAGAAGAAGAGAATGTGAATATTTAGCAGCACAGAGAAAGCGAAGGGGGAACGTGTGCGACTGTGAGCAGTGCAGTAAGTGTTGGGTGTGAAGCGTGTCAGACACTGCAGACAACAAGCACAGTGCAAGGAACCTCAATTAAAGTTGCTGTTACAGAAAGGATCAATGTTTTTGCTTTTGTCTATGGTGGCTGGATGTTCTGAAGACATTTATTCCATACATTGCACTCAGGTGAGGGAAGTTTTGTTTTCTGCAGTACTCCTAATAATGACCAGCTTGCTCGGACCAAAGCTCACTGAACCAAATCCTATCTTTACCAGCTGCCAGATCCCTTTCTGTGCAGTGTTTATATCATGTAGAAGTTGCAAGTCTCTCTCTGAAATAAGATACAGGGATATCTGCCTTTATGGCAGAGCAGAGAGTAGAACTTTACAATGTTCACTGGCTTATCTTTATTCCAGTCCTGTCTGTTGTTTACTCTTCTTATCACATTACCTTTCCATCTTGATACAATGCTAACAAAATGTTCCTTGTTTTTGAGTGGTACTGTTAAAGGGGAACTCCACTAAACAACATTTTGAATAATAATTTCAAACAACTTTGCAATACACATCATTTAAAAAATATGCAGCCTTTTCATGTAATAATATGGTTTGAAACAGTTCCCTAAGCCCCGCCCCCTGTTCTGGTGATCTGTCGGACTACTTTGTGACTCAAATAAACTGTAACAGTAGTCGACTTTCCTTAGCCTGCCTTCAGCCTGCATCCTCCCAATCCCACAATTCCCTGCACACGTGATGTCAATAAGGAAAGGAACATCATAGTGCAATGCATTGTGGGTTATGTAGTTCCTGCATGCTGTCTGTAAGCTGGGGAGAGGTTCTTCCCATTTGTAGCATCAGTGTTTTAGTCCCTCCTCCCCTGCCAGGGTTTCAAATGATGCAGAAAGAGAAGATCTGTTTTGCAGCTGGATTTCAGCATATACAAATGGTATTTATTCATAATTCTTGAACAGATTACAGAGATATGTATATTATGGGTTTCAGTGTTGTGTGGGGCTCTTTTGGTTCGGAAGCCAGATGGGCTTCCGACATAAAGTCCCAGTGGTTTGTGGATTATACTTTATTTTTTTGTATATAACAACTTTAACTTACAGCGGAATACTGGTCTTTCCACAACTTTATAAATAGCTTTCCAGCCTTGCGATAACAAAATAAGGTGTTTGGTCGAGTACTCATTATAAAAAAATGTGGCAGCTCCAAGGACAAATAATCACTGATATGTTTCTAATTCTATCCACTGTATGTGGGAGATTTATCAAGATTTGAAAAGTAAATCAACATTGGTAAATACCAAAAAAACTCAGTCTGTTCAAGAGTAGTGTTTTTCTAGTAGTTTGAGCATCTTGACCTTAGATAAATCAGTATATGAAAGCTATGCTGCAGTGTAAAATAGGACAATGACAAACTGAGCTACTTGTGGGCAACTACTTGGTTCAGCTACAACAAAGACAATACTGATTATTGTCTCTACGTGTGTTTTTAGCAGAGACCATTCTTAGTAATGTCTATGGCAGGGTTTTTTTTTTATTTGGCATTTTTGTAGCTGCACAAGTAGCACCCATGTGTCATAGACATAAAATGCAAATAAAATGGCTGACACACAGATATTCCTTATATAGCGTGTATTTTATTGCTTCTGTAAAGGTGTTTATATTGGCGCACTGAGTATAGACTCGTATATAAATTACAAGATTTTTTGCCATCTTGAAAAGTAAATGGATAATTTTGTTTTACTTGCATTGGAGATTATATCCTATCAGAACAGGGATTGATCAGAGATCTATATTGGGCAATGTATTGTCTGGAAACAAATAAGAACACAATGGTGTGACACCAACTTTCAGGTGCTTTTGATGTAGATAAAATGCATAAAGAGAACAGTCAGTAGGAACATGGTGGCTACAACTGAGCAAACCCAAGACCATATAAAAGCAATATTTACTACGCTAGTATCATAAGGTCCAACTGTCCAGATTGTATAAGGGCTCTGGCACAAGGGCAGATCAGTCGCCCGCGACAAATCTCCCCGCTCGCGGGCGACCAATCTCCCCGAATTGCCATCCCACCAGCGAAAATGCAACCCGCCGGTTGGACAGTACACCCCGCGCAGGCGACTCCGGCAAATCGGCGAAGCCGCCTCGTGAGGCATTCTCGATGATTTGCCGAAATCATGCCGCCGCGTGTGCCATCCCACCGGCAACCCACACCCCCACCGGTGGGACGGCAACCCGGGGAGACCAGCCGCCCGCGAACAGGGAGATCCGCCACGGGCGACCAATCTCTCCATGTGCCAGAGCCCTAGGGGCACCCATATTTCTTCAAATAGCTGCTGTTATCAATAAGCATGCCATATACATCAAAGAGAAACCCGGAAATATAATCACCGTGCCAGTGGCAAGCTGGTTATTCTACATTTGCACCATATACTCAGTTGCTCGGCATGTTAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTACACGAAAATGCATTTCCCCTAAGACCGGGTATTGCTTATTTAAACTCGCGGGGGGGTGGGTTTAGGGTCAGTCATGGTCAGTGATCTTCATATTTGTAATCCTAAATAAGCCCGTAAGGTGGACATCACTCTCGACGTCTGTCAGAATATTTACACATCACAAGTCGCAACCGGAACCGAAGGGAGCCGCAACCCAGATAAAAGCAAGATCGTAGCACTCGCCCCAAGCAGAGGCCATCCCACCGGCAACCCACACCCTCACCGGTGGGACGGCAACCCGGGGAGACCAGTCGCCCGCGAACAGGGAGACCCGCCACGGGCGACCAATCTCTCCATGTGCCAGAGCCCTAGGGGCACCCATATTTCTTCAAATAGCTGCTGTTATCAAGCAGATTAAAAGTCATTAAGTGATCACTGTGTCAATGGCAGCAAATGGATTCACCTAGTGCCAAAGGAGATCCACATTCTGCTGTGTTGGTGGTGCAATACATTGGGAACAATTGGAGGAACCCAGGAAAGTTCTTGAGATCTCTACAGGAGATTAAGTAAGAGTACTGAAGAGTTCCATAATAAGTGTGCTTATTGAAAGTCTAATTAGACTTCATGGGCAGTCCCACTTTGGAACCCCCATGCCAGAATCCTAATGATGAATGGTTTAACCCTCTCAATGCAGGCTTGGTTGACCAATCTATGGCACACATTGCCAATAAGCATGCCATATACATCAAAGAGAAACCCGGAAATATAATCACCGTGCCAGTGGCAAGCTGGTTATTCTACATTTGCACCATATACTCAGTTGCTCGGCATGTTAAGACTTGGTTTAGTGTTGTGTATGTAACTTTAATTGGCAGGTTTATCAACCCTATCTGGCACCAATGGAGATACAGGCACTGGTTTGGTGCAATTACCATCTGTGTACAAATGGAATGCAAATAAAGGTGAGAAGAAGGAAAAGAATAAGAGTTAAGTACGCTGATTCAAAGCAACTAGTGTGTTCCTAATTAGTTTTAACATCTAAAGACACATCACATACGGATACAACAGTCCAAGCGCCATTTTTGTAATGCACAGATAAAAACCACGACAAAAACCACTTTATTTTTTGGCACGTGCCTAGGTTTCCCTGAATCTGAGCTACACTTTGGTAGCATTTCAAACAAAGTGCCAGATCTCTTGCATCCCGCAGCCTGCAATTCAGCTGGGCCAACTGGCTCTACAAAACAGCATTATAAAAACCTAACCAGGGCAATAAAGGTCATTCAAAGTCAAACTGAAGAAGGATCCAATGCCAAGGGGGTACTTGAGCTTTGAGTGCAGTGGATTTTCACACTTTCAACCATATTGCAAAGTGTTCATTGAGTTGACTGTGCAGTAGAAGTGAAACCCAAGTATAAATGACTGTGGGCGTGGAGCCAAGTTTACTCATGTTGCCTTGAACCTATAGAACAGAACACCAAACATGCTTACCGCAATGGAATCCTGTGTACAGAGTCTAAAGTTTAGGCATGCTAGATGGTCTCGTAATGTACACAGTTTAAAGGGAGCACGCCTTGCCGTTACATGATGTTACAAGAGTTACATGATGTTTCCAAAGATGATGGAATATTTAGACATTTTACAAAATGATCCCACTGGCACCATGAGCAAAGATATAGTAAATACTCAGGGTTGCATTTCTACATTGGAAGAAACTACCTACAGAACTGATTGGTTTATTCCAGCCGATGACTGGAATTCTGATCAAAGACACATGTACACAGTAAGCTGTAATTAGAATAACATGAAGATACCAGGAGTCCGTGAAAGGGGTGACGGCAACATGCTATAGAATTGTTATAAGTGAGCGTTAGTTTCATTTATCATGGGGCTGCAGATTGCTATCGGTGTCACCTACAATGTTTATTTATTTTCCCGGTTGTTTC
                                                  Xt7.1-CHK-1008266136                                            CCTACGGGACAGCGGGTTGTGTTGAGACATTCCGGACTGTACCACCTGTAGCTGTGCTGTAGGGGCGGATCATGTCTGACTCAGGCCACAGCCAGCCCAATGTGTTTATCCCTGGGCGCAACAGAAGGCGACGCTGGATGGACCAAGGACCGCCGGGACACCTTAACCTCTCGGAACCTGGACGAGAGAAAGACCCCATGCTCCGGGACAGAGATCAGGATAGATGGGAGGGAAATGAAGAGGGCTATGGCTACACCATTCAGAAAACTCCTATCATCCTTGCAAAGCCAACCTCCGACAGGACAAAGGCGGCAACCCCAGCGGCACCTCCTCCTATGGAAAAACCCATTGTCCTGATGAAAGCCAGGGAAGATGGAAAACCAGCAGCCCCTGCAGAGGGTGCCACCGCACCCCCTCCCACTGCAGTAGCAAAGGTGGAGAAAGAGGGACAGCGACCCACCCAACCAGTATATCAAATACAGAACCGGGGCATGGGAGCCGCAGCAAGTGCCAGTGGCAATGTGGATCCTGTGGTTGGGCAGGCCAAGCTGCTGCCACCTCAGAAGATGAAACACAGCATCAAATTGGTGGATGAATACATGAACTGGTGTGACAGCGCTATTGAGTTCCTGCTGGACCAGACAGATGTCCTTGTGGTTGGCATCCTAGGATTGCAAGGCACAGGAAAGTCCACCCTGATGTCCCTGTTGTCAGCAAACTCTCCAGATGATGACCAAAGGTCTTACGTGTTTCGGATGCAGAGCCAGGAAGTGAGGGAAAGAGCTGGGAACCAGACTAGCGGCATTGACTTCTTCATTAGCCAGGAGAGGATCATCTTCCTCGATACCCAGCCAATTCTCAGTCCAGCGATACTGGATCATCTGATCAATAATGACCGAAAACTACCCCCAGAATACAATCTCCCCCACACCTATGTTGAGATGCAGTCTCTGCAGATCGCTGCCTTTTTGTTCACGGTTTGTCACGTTGTCATCGTTGTACAGGATTGGTTCACAGACTTCAATTTATACCGCTTCCTTCAGACAGCCGAAATGCTTAAGCCATCAACTCCCTCCCCCAGTCATGAGTCAAGTGGCTCTTCTGGCTCTGATGAAGGCATTGAGTATTATCCACATGTAGTTTTCGTGCAAAATAAAGCCAAGAGGGAGGATTACTGTCCCCGCACCTTAAAGCAGATGCACACAGTCATTGATAAACTCATGCTCCATTCACACCTGCGATACAAAGGCACTCTTTCCATGCTGGACTGCAACATCTTCCCAGGTCTGCCCTATGACTTTATCGAGTCAGAAGTTAACTTATTCTTGATCCCGACCATGGAGAGTGACGTGGATGAGACAATATCCAGGGCAGGCACCAGTGGAATCCCTCTCTTCTCCCTCCTGCCGGCATACAAAGGGCATCCCAGTTTTCATTCCCTGATCAGCAGACTGCGCAGCCAGATCATGTCCATGTCACGCCCTCAGCTCTCTCACACCATCCTGACCGAAAAGAACTGGTTCCACTATGCTGCCCGAATTTGGGATGGTGTAAAGAAGTCATCAGCACTTTCGGAGTACAGCAGGTTACTGGGCTAATGTTATACTCTGAAGAATGGCTGCAGTATCGAAATGGCCTGCTGCTGGTTAAGGAAAGACTGGCCCAGCTAAAGAGGCGCAGTATCAAGAAAGGATCGATTTCCTTGGCATTCATGTTGTCCTATGCGAGGTGATGGGATCAGGAACGATCCTGAAGGAGCAATTGTTCTTAGGCCCTTTGTGTTTTGGGAGACCATAAGGGTCCGTGTTTGAAATGGCACTGAGGAAACAAATAGTTGTTCCTATTTTGGAGAAGAGCTGTAGGGGTCCTTAACTTGTTTATCTAGCCTCATGGTGGACTACACCTTGCAACAAAGCCCTGTATCCCTAAAATGAAGTCAGAAGAAGAGAATGTGAATATTTAGCAGCACAGAGAAAGCGAAGGGGGAACGTGTGCGACTGTGAGCAGTGCAGTAAGTGTTGGGTGTGAAGCGTGTCAGACACTGCAGACAACAAGCACAGTGCAAGGAACCTCAATTAAAGTTGCTGTTACAGAAAGGATCAATGTTTTTGCTTTTGTCTATGGTGGCTGGATGTTCTGAAGACATTTATTCCATACATTGCACTCAGGTGAGGGAAGTTTTGTTTTCTGCAGTACTCCTAATAATGACCAGCTTGCTCGGACCAAAGCTCACTGAACCAAATCCTATCTTTACCAGCTGCCAGATCCCTTTCTGTGCAGTGTTTATATCATGTAGAAGTTGCAAGTCTCTCTCTGAAATAAGATACAGGGATATCTGCCTTTATGGCAGAGCAGAGAGTAGAACTTTACAATGTTCACTGGCTTATCTTTATTCCAGTCCTGTCTGTTGTTTACTCTTCTTATCACATTACCTTTCCATCTTGATACAATGCTAACAAAATGTTCCTTGTTTTTGAGTGGTACTGTTAAAGGGGAACTCCACTAAACAACATTTTGAATAATAATTTCAAACAACTTTGCAATACACATCATTTAAAAAATATGCAGCCTTTTCATGTAATAATATGGTTTGAAACAGTTCCCTAAGCCCCGCCCCCTGTTCTGGTGATCTGTCGGACTACTTTGTGACTCAAATAAACTGTAACAGTAGTCGACTTTCCTTAGCCTGCCTTCAGCCTGCATCCTCCCAATCCCACAATTCCCTGCACACGTGATGTCAATAAGGAAAGGAACATCATAGTGCAATGCATTGTGGGTTATGTAGTTCCTGCATGCTGTCTGTAAGCTGGGGAGAGGTTCTTCCCATTTGTAGCATCAGTGTTTTAGTCCCTCCTCCCCTGCCAGGGTTTCAAATGATGCAGAAAGAGAAGATCTGTTTTGCAGCTGGATTTCAGCATATACAAATGGTATTTATTCATAATTCTTGAACAGATTACAGAGATATGTATATTATGGGTTTCAGTGTTGTGTGGGGCTCTTTTGGTTCGGAAGCCAGATGGGCTTCCGACATAAAGTCCCAGTGGTTTGTGGATTATACTTTATTTTTTTGTATATAACAACTTTAACTTACAGCGGAATACTGGTCTTTCCACAACTTTATAAATAGCTTTCCAGCCTTGCGATAACAAAATAAGGTGTTTGGTCGAGTACTCATTATAAAAAAATGTGGCAGCTCCAAGGACAAATAATCACTGATATGTTTCTAATTCTATCCACTGTATGTGGGAGATTTATCAAGATTTGAAAAGTAAATCAACATTGGTAAATACCAAAAAAACTCAGTCTGTTCAAGAGTAGTGTTTTTCTAGTAGTTTGAGCATCTTGACCTTAGATAAATCAGTATATGAAAGCTATGCTGCAGTGTAAAATAGGACAATGACAAACTGAGCTACTTGTGGGCAACTACTTGGTTCAGCTACAACAAAGACAATACTGATTATTGTCTCTACGTGTGTTTTTAGCAGAGACCATTCTTAGTAATGTCTATGGCAGGGTTTTTTTTTTxxTTGGCATTTTxxxAGCTGCxxxAxxAGCACCxxxxxxTCATAGACATAAAATGCAAATAAAATGGCTGACACACAGATATTCCTTATATAGCGTGTATTTTATTGCTTCTGTAAAGGTGTTTATATTGGCGCACTGAGTATAGACTCGTATATAAATTACAAGATTTTTTGCCATCTTGAAAAGTAAATGGATAATTTTGTTTTACTTGCATTGGAGATTATATCCTATCAGAACAGGGATTGATCAGAGATCTATATTGGGCAATGTATTGTCTGGAAACAAATAAGAACACAATGGTGTGACACCAACTTTCAGGTGCTTTTGATGTAGATAAAATGCATAAAGAGAACAGTCAGTAGGAACATGGTGGCTACAACTGAGCAAACCCAAGACCATATAAAAGCAATATTTACTACGCTAGTATCATAAGGTCCAACTGTCCAGATTGTATAAGGGCTCTGGCACAAGGGCAGATCAGTCGCCCGCGACAAATCTCCCCGCTCGCGGGCGACCAATCTCCCCGAATTGCCATCCCACCAGCGAAAAxGCAAxCCGCCGGTTGGAxxGxACACCCCGCGGAGGCGACTCCGGCAAATCGGCGAAGCCGCCTCGTGAGGCATTCTCGATGATTTGCCGAAATCATGCCGCCGCGTGTGCCATCCCACCGGCAACCCACACCCCCACCGGTGGGACGGCAACCCGGGGAGACCAGCCGCCCGCGAACAGGGAGATCCGCCACGGGCGACCAATCTCTCCATGTGCCAGAGCCCTAGGGGCACCCATATTTCTTCAAATAGCTGCTGTTxxCAATAAGCATGCCATATACATCAAAGAGAAACCCGGAAATATAATCACCGTGCCAGTGGCAAGCTGGTTATTCTACATTTGCACCATATACTCAGTTGCTCGGCATGTTAAGACTTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACACGAAAATGCATTTCCCCTAAGACCGGGTATTGCTTATTTAAACTCGCGGGGGGGTGGGTTTAGGGTCAGTCATGGTCAGTGATCTTCATATTTGTAATCCTAAATAAGCCCGTAAGGTGGACATCACTCTCGACGTCTGTCAGAATATTTACACATCACAAGTCGCAACCGGAACCGAAGGGAGCCGCAACCCAGATAAAAGCAAGATCGTAGCACTCGCCCCAAGCxxxxGCCATCCCACCGGCAACCCACACCCTCACCGGTGGGACGGCAACCCGGGGAGACCAGTCGCCCGCGAACAGGGAGACCCGCCACGGGCGACCAATCTCTCCATGTGCCAGAGCCCTAGGGGCACCCATATTTCTTCAAATAGCTGCTGTTATCAAGCAGATTAAAAGTCATTAAGTGATCACTGTGTCAATGGCAGCAAATGGATTCACCTAGTGCCAAAGGAGATCCACATTCTGCTGTGTTGGTGGTGCAATACATTGGGAACAATTGGAGGAACCCAGGAAAGTTCTTGAGATCTCTACAGGAGATTAAGTAAGAGTACTGAAGAGTTCCATAATAAGTGTGCTTATTGAAAGTCTAATTAGACTTCATGGGCAGTCCCACTTTGGAACCCCCATGCCAGAATCCTAATGATGAATGGTTTAACCCTCTCAATGCAGGCTTGGTTGACCAATCTATGGCACACATTGCCAATAAGCATGCCATATACATCAAAGAGAAACCCGGAAATATAATCACCGTGCCAGTGGCAAGCTGGTTATTCTACATTTGCACCATATACTCAGTTGCTCGGCATGTTAAGACTTGGTTTAGTGTTGTGTATGTAACTTTAATTGGCAGGTTTATCAACCCTATCTGGCACCAATGGAGATACAGGCACTGGTTTGGTGCAATTACCATCTGTGTACAAATGGAATGCAAATAAAGGTGAGAAGAAGGAAAAGAATAAGAGTTAAGTACGCTGATTCAAAGCAACTAGTGTGTTCCTAATTAGTTTTAACATCTAAAGACACATCACATACGGATACAACAGTCCAAGCGCCATTTTTGTAATGCACAGATAAAAACCACGACAAAAACCACTTTATTTTTTGGCACGTGCCTAGGTTTCCCTGAATCTGAGCTACACTTTGGTAGCATTTCAAACAAAGTGCCAGATCTCTTGCATCCCGCAGCCTGCAATTCAGCTGGGCCAACTGGCTCTACAAAACAGCATTATAAAAACCTAACCAGGGCAATAAAGGTCATTCAAAGTCAAACTGAAGAAGGATCCAATGCCAAGGGGGTACTTGAGCTTTGAGTGCAGTGGATTTTCACACTTTCAACCATATTGCAAAGTGTTCATTGAGTTGACTGTGCAGTAGAAGTGAAACCCAAGTATAAATGACTGTGGGCGTGGAGCCAAGTTTACTCATGTTGCCTTGAACCTATAGAACAGAACACCAAACATGCTTACCGCAATGGAATCCTGTGTACAGAGTCTAAAGTTTAGGCATGCTAGATGGTCTCGTAATGTACACAGTTTAAAGGGAGCACGCCTTGCCGTTACATGATGTTACAAGAGTTACATGATGTTTCCAAAGATGATGGAATATTTAGACATTTTACAAAATGATCCCACTGGCACCATGAGCAAAGATATAGTAAATACTCAGGGTTGCATTTCTACATTGGAAGAAACTACCTACAGAACTGATTGGTTTATTCCAGCCGATGACTGGAATTCTGATCAAAGACACATGTACACAGTAAGCTGTAATTAGAATAACATGAAGATACCAGGAGTCCGTGAAAGGGGTGACGGCAACATGCTATAGAATTGTTATAAGTGAGCGTTAGTTTCATTTATCATGGGGCTGCAGATTGCTATCGGTGTCACCTACAATGTTTATTTATTTTCCCGGTTGTTTCCATTCT
                                                      consensus depths                                           2     2     3     3     3     3     3     4     3     4     3     4     4     4     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     7     6     7     6     7     6     7     6     7     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     9     7     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     8     8     8     8     8     8     8     8     8     8     8     6     6     6     6     6     6     6     6     5     6     5     6     5     7     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     4     6     6     6     6     6     6     6     6     6     5     5     6     6     6     6     6     6     5     5     4     4     4     4     4     4     8     8     9     9    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    11    11    11    11    11    11    11    11    11    11    11    12    12    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    10    11     9    11     9    11    11    13    12    13    11    13    11    13    12    13    11    13     8    11     4     8     5     7     4     5     5     6     5     6     6     7     4     6     6     7     6     7     6     7     7     7     6     6     6     6     7     7     7     7     7     7     6     6     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     7     5     6     5     6     5     6     5     6     5     6     5     6     4     6     3     5     3     5     3     4     3     4     3     4     2     4     2     4     2     4     2     4     2     4     2     3     2     3     2     3     2     3     2     4     2     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     5     6     5     9     9    10     9    10     9    10     9    10    10    11    10    11     9    10     9    10    10    11    10    11    11    12    12    12    13    13    13    14    14    15    14    15    14    15    13    14    14    14    14    15    15    15    14    15    12    15    14    14    12    12    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     3     9     3     9     3     8     3     8     3     7     3     8     3     7     3     5     7     8     7     8     7     8     7     7     7     7     7     8     9     9     8     8     8     8     7     8     6     7     6     7     7     7     6     7     7     7     7     7     6     7     6     7     7     7     7     7     6     7     6     7     6     7     6     7     7     7     7     7     6     7     7     7     7     7     7     7     5     7     4     7     4     7     4     7     2     7     3     7     4     7     4     7     2     7     2     7     3     7     3     7     2     6     2     6     2     6     2     6     2     5     2     5     2     5     2     5     2     5     2     5     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     1     3     1     3     1     3     1     3     1     3     1     1     1     1     1     1     1     1     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     4     2     4     3     5     3     5     3     5     3     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     2     4     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     5     6    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    13    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    13    13    12    12    11    11    11    11    11    11    11    11    11    11    11    11     9    11     8    10     8    10     8    10     8    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6     8     6     8     6     8     6     8     6     8     6     7     6     7     6     7     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     3     3     2     2
  5   1   2       e>2                                 Xt7.1-CABH6898.5                                      TAGAGACCTACGGGACAGCGGGTTGTGTTGAGACATTCCGGACTGTACCACCTGTAGCTGTGCTGTAGGGGCGGATCATGTCTGACTCAGGCCACAGCCAGCCCAATGTGTTTATCCCTGGGCGCAACAGAAGGCGACGCTGGATGGACCAAGGACCGCCGGGACACCTTAACCTCTCGGAACCTGGACGAGAGAAAGACCCCATGCTCCGGGACAGAGATCAGGATAGATGGGAGGGAAATGAAGAGGGCTATGGCTACACCATTCAGAAAACTCCTATCATCCTTGCAAAGCCAACCTCCGACAGGACAAAGGCGGCAACCCCAGCGGCACCTCCTCCTATGGAAAAACCCATTGTCCTGATGAAAGCCAGGGAAGATGGAAAACCAGCAGCCCCTGCAGAGGGTGCCACCGCACCCCCTCCCACTGCAGTAGCAAAGGTGGAGAAAGAGGGACAGCGACCCACCCAACCAGTATATCAAATACAGAACCGGGGCATGGGAGCCGCAGCAAGTGCCAGTGGCAATGTGGATCCTGTGGTTGGGCAGGCCAAGCTGCTGCCACCTCAGAAGATGAAACACAGCATCAAATTGGTGGATGAATACATGAACTGGTGTGACAGCGCTATTGAGTTCCTGCTGGACCAGACAGATGTCCTTGTGGTTGGCATCCTAGGATTGCAAGGCACAGGAAAGTCCACCCTGATGTCCCTGTTGTCAGCAAACTCTCCAGATGATGACCAAAGGTCTTACGTGTTTCGGATGCAGAGCCAGGAAGTGAGGGAAAGAGCTGGGAACCAGACTAGCGGCATTGACTTCTTCATTAGCCAGGAGAGGATCATCTTCCTCGATACCCAGCCAATTCTCAGTCCAGCGATACTGGATCATCTGATCAATAATGACCGAAAACTACCCCCAGAATACAATCTCCCCCACACCTATGTTGAGATGCAGTCTCTGCAGATCGCTGCCTTTTTGTTCACGGTTTGTCACGTTGTCATCGTTGTACAGGATTGGTTCACAGACTTCAATTTATACCGCTTCCTTCAGACAGCCGAAATGCTTAAGCCATCAACTCCCTCCCCCAGTCATGAGTCAAGTGGCTCTTCTGGCTCTGATGAAGGCATTGAGTATTATCCACATGTAGTTTTCGTGCAAAATAAAGCCAAGAGGGAGGATTACTGTCCCCGCACCTTAAAGCAGATGCACACAGTCATTGATAAACTCATGCTCCATTCACACCTGCGATACAAAGGCACTCTTTCCATGCTGGACTGCAACATCTTCCCAGGTCTGCCCTATGACTTTATCGAGTCAGAAGTTAACTTATTCTTGATCCCGACCATGGAGAGTGACGTGGATGAGACAATATCCAGGGCAGGCACCAGTGGAATCCCTCTCTTCTCCCTCCTGCCGGCATACAAAGGGCATCCCAGTTTTCATTCCCTGATCAGCAGACTGCGCAGCCAGATCATGTCCATGTCACGCCCTCAGCTCTCTCACACCATCCTGACCGAAAAGAACTGGTTCCACTATGCTGCCCGAATTTGGGATGGTGTAAAGAAGTCATCAGCACTTTCGGAGTACAGCAGGTTACTGGGCTAATGTTATACTCTGAAGAATGGCTGCAGTATCGAAATGGCCTGCTGCTGGTTAAGGAAAGACTGGCCCAGCTAAAGAGGCGCAGTATCAAGAAAGGATCGATTTCCTTGGCATTCATGTTGTCCTATGCGAGGTGATGGGATCAGGAACGATCCTGAAGGAGCAATTGTTCTTAGGCCCTTTGTGTTTTGGGAGACCATAAGGGTCCGTGTTTGAAATGGCACTGAGGAAACAAATAGTTGTTCCTATTTTGGAGAAGAGCTGTAGGGGTCCTTAACTTGTTTATCTAGCCTCATGGTGGACTACACCTTGCAACAAAGCCCTGTATCCCTAAAATGAAGTCAGAAGAAGAGAATGTGAATATTTAGCAGCACAGAGAAAGCGAAGGGGGAACGTGTGCGACTGTGAGCAGTGCAGTAAGTGTTGGGTGTGAAGCGTGTCAGACACTGCAGACAACAAGCACAGTGCAAGGAACCTCAATTAAAGTTGCTGTTACAGAAAGGATCAATGTTTTTGCTTTTGTCTATGGTGGCTGGATGTTCTGAAGACATTTATTCCATACATTGCACTCAGGTGAGGGAAGTTTTGTTTTCTGCAGTACTCCTAATAATGACCAGCTTGCTCGGACCAAAGCTCACTGAACCAAATCCTATCTTTACCAGCTGCCAGATCCCTTTCTGTGCAGTGTTTATATCATGTAGAAGTTGCAAGTCTCTCTCTGAAATAAGATACAGGGATATCTGCCTTTATGGCAGAGCAGAGAGTAGAACTTTACAATGTTCACTGGCTTATCTTTATTCCAGTCCTGTCTGTTGTTTACTCTTCTTATCACATTACCTTTCCATCTTGATACAATGCTAACAAAATGTTCCTTGTTTTTGAGTGGTACTGTTAAAGGGGAACTCCACTAAACAACATTTTGAATAATAATTTCAAACAACTTTGCAATACACATCATTTAAAAAATATGCAGCCTTTTCATGTAATAATATGGTTTGAAACAGTTCCCTAAGCCCCGCCCCCTGTTCTGGTGATCTGTCGGACTACTTTGTGACTCAAATAAACTGTAACAGTAGTCGACTTTCCTTAGCCTGCCTTCAGCCTGCATCCTCCCAATCCCACAATTCCCTGCACACGTGATGTCAATAAGGAAAGGAACATCATAGTGCAATGCATTGTGGGTTATGTAGTTCCTGCATGCTGTCTGTAAGCTGGGGAGAGGTTCTTCCCATTTGTAGCATCAGTGTTTTAGTCCCTCCTCCCCTGCCAGGGTTTCAAATGATGCAGAAAGAGAAGATCTGTTTTGCAGCTGGATTTCAGCATATACAAATGGTATTTATTCATAATTCTTGAACAGATTACAGAGATATGTATATTATGGGTTTCAGTGTTGTGTGGGGCTCTTTTGGTTCGGAAGCCAGATGGGCTTCCGACATAAAGTCCCAGTGGTTTGTGGATTATACTTTATTTTTTTGTATATAACAACTTTAACTTACAGCGGAATACTGGTCTTTCCACAACTTTATAAATAGCTTTCCAGCCTTGCGATAACAAAATAAGGTGTTTGGTCGAGTACTCATTATAAAAAAATGTGGCAGCTCCAAGGACAAATAATCACTGATATGTTTCTAATTCTATCCACTGTATGTGGGAGATTTATCAAGATTTGAAAAGTAAATCAACATTGGTAAATACCAAAAAAACTCAGTCTGTTCAAGAGTAGTGTTTTTCTAGTAGTTTGAGCATCTTGACCTTAGATAAATCAGTATATGAAAGCTATGCTGCAGTGTAAAATAGGACAATGACAAACTGAGCTACTTGTGGGCAACTACTTGGTTCAGCTACAACAAAGACAATACTGATTATTGTCTCTACGTGTGTTTTTAGCAGAGACCATTCTTAGTAATGTCTATGGCAGGGTTTTTTTTTTATTTGGCATTTTTGTAGCTGCACAAGTAGCACCCATGTGTCATAGACATAAAATGCAAATAAAATGGCTGACACACAGATATTCCTTATATAGCGTGTATTTTATTGCTTCTGTAAAGGTGTTTATATTGGCGCACTGAGTATAGACTCGTATATAAATTACAAGATTTTTTGCCATCTTGAAAAGTAAATGGATAATTTTGTTTTACTTGCATTGGAGATTATATCCTATCAGAACAGGGATTGATCAGAGATCTATATTGGGCAATGTATTGTCTGGAAACAAATAAGAACACAATGGTGTGACACCAACTTTCAGGTGCTTTTGATGTAGATAAAATGCATAAAGAGAACAGTCAGTAGGAACATGGTGGCTACAACTGAGCAAACCCAAGACCATATAAAAGCAATATTTACTACGCTAGTATCATAAGGTCCAACTGTCCAGATTGTATAAGGGCTCTGGCACAAGGGCAGATCAGTCGCCCGCGACAAATCTCCCCGCTCGCGGGCGACCAATCTCCCCGAATTGCCATCCCACCAGCGAAAATGCAACCCGCCGGTTGGACAGTACACCCCGCGCAGGCGACTCCGGCAAATCGGCGAAGCCGCCTCGTGAGGCATTCTCGATGATTTGCCGAAATCATGCCGCCGCGTGTGCCATCCCACCGGCAACCCACACCCCCACCGGTGGGACGGCAACCCGGGGAGACCAGCCGCCCGCGAACAGGGAGATCCGCCACGGGCGACCAATCTCTCCATGTGCCAGAGCCCTAGGGGCACCCATATTTCTTCAAATAGCTGCTGTTATCAA
  5  -1   2       e>2                                Xt7.1-CABH12024.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGGACGGCAACCCGGGGAGACCAGTCGCCCGCGAACAGGGAGACCCGCCACGGGCGACCAATCTCTCCATGTGCCAGAGCCCTAGGGGCACCCATATTTCTTCAAATAGCTGCTGTTATCAAGCAGATTAAAAGTCATTAAGTGATCACTGTGTCAATGGCAGCAAATGGATTCACCTAGTGCCAAAGGAGATCCACATTCTGCTGTGTTGGTGGTGCAATACATTGGGAACAATTGGAGGAACCCAGGAAAGTTCTTGAGATCTCTACAGGAGATTAAGTAAGAGTACTGAAGAGTTCCATAATAAGTGTGCTTATTGAAAGTCTAATTAGACTTCATGGGCAGTCCCACTTTGGAACCCCCATGCCAGAATCCTAATGATGAATGGTTTAACCCTCTCAATGCAGGCTTGGTTGACCAATCTATGGCACACATTGCCAATAAGCATGCCATATACATCAAAGAGAAACCCGGAAATATAATCACCGTGCCAGTGGCAAGCTGGTTATTCTACATTTGCACCATATACTCAGTTGCTCGGCATGTTAAGACTTGGTTTAGTGTTGTGTATGTAACTTTAATTGGCAGGTTTATCAACCCTATCTGGCACCAATGGAGATACAGGCACTGGTTTGGTGCAATTACCATCTGTGTACAAATGGAATGCAAATAAAGGTGAGAAGAAGGAAAAGAATAAGAGTTAAGTACGCTGATTCAAAGCAACTAGTGTGTTCCTAATTAGTTTTAACATCTAAAGACACATCACATACGGATACAACAGTCCAAGCGCCATTTTTGTAATGCACAGATAAAAACCACGACAAAAACCACTTTATTTTTTGGCACGTGCCTAGGTTTCCCTGAATCTGAGCTACACTTTGGTAGCATTTCAAACAAAGTGCCAGATCTCTTGCATCCCGCAGCCTGCAATTCAGCTGGGCCAACTGGCTCTACAAAACAGCATTATAAAAACCTAACCAGGGCAATAAAGGTCATTCAAAGTCAAACTGAAGAAGGATCCAATGCCAAGGGGGTACTTGAGCTTTGAGTGCAGTGGATTTTCACACTTTCAACCATATTGCAAAGTGTTCATTGAGTTGACTGTGCAGTAGAAGTGAAACCCAAGTATAAATGACTGTGGGCGTGGAGCCAAGTTTACTCATGTTGCCTTGAACCTATAGAACAGAACACCAAACATGCTTACCGCAATGGAATCCTGTGTACAGAGTCTAAAGTTTAGGCATGCTAGATGGTCTCGTAATGTACACAGTTTAAAGGGAGCACGCCTTGCCGTTACATGATGTTACAAGAGTTACATGATGTTTCCAAAGATGATGGAATATTTAGACATTTTACAAAATGATCCCACTGGCACCATGAGCAAAGATATAGTAAATACTCAGGGTTGCATTTCTACATTGGAAGAAACTACCTACAGAACTGATTGGTTTATTCCAGCCGATGACTGGAATTCTGATCAAAGACACATGTACACAGTAAGCTGTAATTAGAATAACATGAAGATACCAGGAGTCCGTGAAAGGGGTGACGGCAACATGCTATAGAATTGTTATAAGTGAGCGTTAGTTTCATTTATCATGGGGCTGCAGATTGCTATCGGTGTCACCTACAATGTTTATTTATTTTCCCGGTTGTTTCCATTCTAT
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ------G-----
                                               BLH ATG      77    1023                                      
                                               BLH MIN      77     169                                      
                                               BLH MPR      38     169                                      
                                               BLH OVR      77     167                                      
                                               CDS MIN      77       1                                      
                                               EST CLI       0       1                                      
                                               ORF LNG      77      38                                      
                                                                                                                                                                                      PROTEIN --- Dm ---- 4e-012     NP_996330.1 CG3857-PA [Drosophila melanogaster] --------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Ce ==== 3e-017     NP_497058.1 gluconokinase like (43.8 kD) (2P34) [Caenorhabditis elegans] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN <<< Xt <<<< 5e-018     AAI28630.1 Unknown (protein for MGC:146035) [Xenopus tropicalis] <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED < ?? <<<< 5e-018     NP_001090704.1 hypothetical protein LOC100036684 [Xenopus tropicalis] <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
                                                                                                                                                  PREDICTED - Sp ---- 1e-090     XP_780386.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                           PREDICTED - Hs ---- 0          NP_061981.1 hypothetical protein FLJ12886 [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PREDICTED = Dr ==== 0          XP_686457.1 PREDICTED: similar to gluconokinase like (43.8 kD) (2P34) isoform 1 [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PREDICTED = Mm ==== 0          NP_082323.1 RIKEN cDNA 1500002O20 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN === Xl ==== 0          AAI23226.1 MGC154467 protein [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PREDICTED = ?? ==== 0          NP_001090489.1 hypothetical protein LOC779402 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABH6898.5.5                                                                                                       TAG---------ATG---------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------------------------------------------------------------------------------------------------------------TAA---------------------------------ATG---------------------------------TAA---------------------------------------------------ATG------------------------------------------------------------------------------------TGA------------------------------------------------TAG---------------------------ATG---------------------------------------TGA---------------ATGTGA---------------------------------------------TGA---------TAA---------------------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------TGA------------------------------------------TAATAA------------------------------------------------------------ATG---TGA------------------------------------------------------------------------------------------------------------------------------------------TGA------TAA---------------------ATG------------------------ATG------------------------------------------------------------------------------ATGATG---------------------------------------------ATG------------------TGA---------------ATG------ATG---------------------------------------------------------------------------------------------------TAA------TAA---------------------------------------------------------TAA------------------------------------------------------------TAA---------------TAA------------------------------------------TAA------------------------------------------------------TAGTAG---------------------TAA---------TGA---------------------TAG---------------------------------------------------------------------------------------TAG------------------ATG---ATG------------------------------TAG---------TAG------------------------------TAA------TGA------------------------------------------TAA---------------------------------------------------------------TGA------------TAA---------------------------------------------------------------------ATG---------------------------ATG---TGA---------------------------------ATG------------------TAG------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------TGA------------ATG------------------------------------------------------------------------------------------------------------------------------TAG---------------------TAG------------------ATG------------------------------TAA------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------TAA------------------TAA------------------------------ATG------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------TGA---------TAG---------------------------------------------ATGATG------------------ATG------------------------------------------ATG------------------------------TAA------------------------------------------------------------ATG------------------------ATGTAA---TAA------------------------------------------------------------------------------------------------------------------------TAA------TGA---------------------------------------TAA---------------------------------------------ATG------TAA---------------------------------------TAG------------------------------------------------------------------------------------------------------------------------TAA---------TAA---------------------------------ATG------------------------------------------------------------------------------------TAG---TGA------------------------------------------------------------TAG---------------ATG---------ATG---------------------------------------------------------------------------------------TGA---------------ATGATG---------ATGATG---------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG------------------TAG------ATG------------------------------------ATG---TAG------------TGA------------------ATG
                                                                   ORF                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   2       e>2                                 Xt7.1-CABH6898.5                                      TAGAGACCTACGGGACAGCGGGTTGTGTTGAGACATTCCGGACTGTACCACCTGTAGCTGTGCTGTAGGGGCGGATCATGTCTGACTCAGGCCACAGCCAGCCCAATGTGTTTATCCCTGGGCGCAACAGAAGGCGACGCTGGATGGACCAAGGACCGCCGGGACACCTTAACCTCTCGGAACCTGGACGAGAGAAAGACCCCATGCTCCGGGACAGAGATCAGGATAGATGGGAGGGAAATGAAGAGGGCTATGGCTACACCATTCAGAAAACTCCTATCATCCTTGCAAAGCCAACCTCCGACAGGACAAAGGCGGCAACCCCAGCGGCACCTCCTCCTATGGAAAAACCCATTGTCCTGATGAAAGCCAGGGAAGATGGAAAACCAGCAGCCCCTGCAGAGGGTGCCACCGCACCCCCTCCCACTGCAGTAGCAAAGGTGGAGAAAGAGGGACAGCGACCCACCCAACCAGTATATCAAATACAGAACCGGGGCATGGGAGCCGCAGCAAGTGCCAGTGGCAATGTGGATCCTGTGGTTGGGCAGGCCAAGCTGCTGCCACCTCAGAAGATGAAACACAGCATCAAATTGGTGGATGAATACATGAACTGGTGTGACAGCGCTATTGAGTTCCTGCTGGACCAGACAGATGTCCTTGTGGTTGGCATCCTAGGATTGCAAGGCACAGGAAAGTCCACCCTGATGTCCCTGTTGTCAGCAAACTCTCCAGATGATGACCAAAGGTCTTACGTGTTTCGGATGCAGAGCCAGGAAGTGAGGGAAAGAGCTGGGAACCAGACTAGCGGCATTGACTTCTTCATTAGCCAGGAGAGGATCATCTTCCTCGATACCCAGCCAATTCTCAGTCCAGCGATACTGGATCATCTGATCAATAATGACCGAAAACTACCCCCAGAATACAATCTCCCCCACACCTATGTTGAGATGCAGTCTCTGCAGATCGCTGCCTTTTTGTTCACGGTTTGTCACGTTGTCATCGTTGTACAGGATTGGTTCACAGACTTCAATTTATACCGCTTCCTTCAGACAGCCGAAATGCTTAAGCCATCAACTCCCTCCCCCAGTCATGAGTCAAGTGGCTCTTCTGGCTCTGATGAAGGCATTGAGTATTATCCACATGTAGTTTTCGTGCAAAATAAAGCCAAGAGGGAGGATTACTGTCCCCGCACCTTAAAGCAGATGCACACAGTCATTGATAAACTCATGCTCCATTCACACCTGCGATACAAAGGCACTCTTTCCATGCTGGACTGCAACATCTTCCCAGGTCTGCCCTATGACTTTATCGAGTCAGAAGTTAACTTATTCTTGATCCCGACCATGGAGAGTGACGTGGATGAGACAATATCCAGGGCAGGCACCAGTGGAATCCCTCTCTTCTCCCTCCTGCCGGCATACAAAGGGCATCCCAGTTTTCATTCCCTGATCAGCAGACTGCGCAGCCAGATCATGTCCATGTCACGCCCTCAGCTCTCTCACACCATCCTGACCGAAAAGAACTGGTTCCACTATGCTGCCCGAATTTGGGATGGTGTAAAGAAGTCATCAGCACTTTCGGAGTACAGCAGGTTACTGGGCTAATGTTATACTCTGAAGAATGGCTGCAGTATCGAAATGGCCTGCTGCTGGTTAAGGAAAGACTGGCCCAGCTAAAGAGGCGCAGTATCAAGAAAGGATCGATTTCCTTGGCATTCATGTTGTCCTATGCGAGGTGATGGGATCAGGAACGATCCTGAAGGAGCAATTGTTCTTAGGCCCTTTGTGTTTTGGGAGACCATAAGGGTCCGTGTTTGAAATGGCACTGAGGAAACAAATAGTTGTTCCTATTTTGGAGAAGAGCTGTAGGGGTCCTTAACTTGTTTATCTAGCCTCATGGTGGACTACACCTTGCAACAAAGCCCTGTATCCCTAAAATGAAGTCAGAAGAAGAGAATGTGAATATTTAGCAGCACAGAGAAAGCGAAGGGGGAACGTGTGCGACTGTGAGCAGTGCAGTAAGTGTTGGGTGTGAAGCGTGTCAGACACTGCAGACAACAAGCACAGTGCAAGGAACCTCAATTAAAGTTGCTGTTACAGAAAGGATCAATGTTTTTGCTTTTGTCTATGGTGGCTGGATGTTCTGAAGACATTTATTCCATACATTGCACTCAGGTGAGGGAAGTTTTGTTTTCTGCAGTACTCCTAATAATGACCAGCTTGCTCGGACCAAAGCTCACTGAACCAAATCCTATCTTTACCAGCTGCCAGATCCCTTTCTGTGCAGTGTTTATATCATGTAGAAGTTGCAAGTCTCTCTCTGAAATAAGATACAGGGATATCTGCCTTTATGGCAGAGCAGAGAGTAGAACTTTACAATGTTCACTGGCTTATCTTTATTCCAGTCCTGTCTGTTGTTTACTCTTCTTATCACATTACCTTTCCATCTTGATACAATGCTAACAAAATGTTCCTTGTTTTTGAGTGGTACTGTTAAAGGGGAACTCCACTAAACAACATTTTGAATAATAATTTCAAACAACTTTGCAATACACATCATTTAAAAAATATGCAGCCTTTTCATGTAATAATATGGTTTGAAACAGTTCCCTAAGCCCCGCCCCCTGTTCTGGTGATCTGTCGGACTACTTTGTGACTCAAATAAACTGTAACAGTAGTCGACTTTCCTTAGCCTGCCTTCAGCCTGCATCCTCCCAATCCCACAATTCCCTGCACACGTGATGTCAATAAGGAAAGGAACATCATAGTGCAATGCATTGTGGGTTATGTAGTTCCTGCATGCTGTCTGTAAGCTGGGGAGAGGTTCTTCCCATTTGTAGCATCAGTGTTTTAGTCCCTCCTCCCCTGCCAGGGTTTCAAATGATGCAGAAAGAGAAGATCTGTTTTGCAGCTGGATTTCAGCATATACAAATGGTATTTATTCATAATTCTTGAACAGATTACAGAGATATGTATATTATGGGTTTCAGTGTTGTGTGGGGCTCTTTTGGTTCGGAAGCCAGATGGGCTTCCGACATAAAGTCCCAGTGGTTTGTGGATTATACTTTATTTTTTTGTATATAACAACTTTAACTTACAGCGGAATACTGGTCTTTCCACAACTTTATAAATAGCTTTCCAGCCTTGCGATAACAAAATAAGGTGTTTGGTCGAGTACTCATTATAAAAAAATGTGGCAGCTCCAAGGACAAATAATCACTGATATGTTTCTAATTCTATCCACTGTATGTGGGAGATTTATCAAGATTTGAAAAGTAAATCAACATTGGTAAATACCAAAAAAACTCAGTCTGTTCAAGAGTAGTGTTTTTCTAGTAGTTTGAGCATCTTGACCTTAGATAAATCAGTATATGAAAGCTATGCTGCAGTGTAAAATAGGACAATGACAAACTGAGCTACTTGTGGGCAACTACTTGGTTCAGCTACAACAAAGACAATACTGATTATTGTCTCTACGTGTGTTTTTAGCAGAGACCATTCTTAGTAATGTCTATGGCAGGGTTTTTTTTTTATTTGGCATTTTTGTAGCTGCACAAGTAGCACCCATGTGTCATAGACATAAAATGCAAATAAAATGGCTGACACACAGATATTCCTTATATAGCGTGTATTTTATTGCTTCTGTAAAGGTGTTTATATTGGCGCACTGAGTATAGACTCGTATATAAATTACAAGATTTTTTGCCATCTTGAAAAGTAAATGGATAATTTTGTTTTACTTGCATTGGAGATTATATCCTATCAGAACAGGGATTGATCAGAGATCTATATTGGGCAATGTATTGTCTGGAAACAAATAAGAACACAATGGTGTGACACCAACTTTCAGGTGCTTTTGATGTAGATAAAATGCATAAAGAGAACAGTCAGTAGGAACATGGTGGCTACAACTGAGCAAACCCAAGACCATATAAAAGCAATATTTACTACGCTAGTATCATAAGGTCCAACTGTCCAGATTGTATAAGGGCTCTGGCACAAGGGCAGATCAGTCGCCCGCGACAAATCTCCCCGCTCGCGGGCGACCAATCTCCCCGAATTGCCATCCCACCAGCGAAAATGCAACCCGCCGGTTGGACAGTACACCCCGCGCAGGCGACTCCGGCAAATCGGCGAAGCCGCCTCGTGAGGCATTCTCGATGATTTGCCGAAATCATGCCGCCGCGTGTGCCATCCCACCGGCAACCCACACCCCCACCGGTGGGACGGCAACCCGGGGAGACCAGCCGCCCGCGAACAGGGAGATCCGCCACGGGCGACCAATCTCTCCATGTGCCAGAGCCCTAGGGGCACCCATATTTCTTCAAATAGCTGCTGTTATCAA
                                                  Xt7.1-CHK-1008225855                                            CCTACGGGACAGCGGGTTGTGTTGAGACATTCCGGACTGTACCACCTGTAGCTGTGCTGTAGGGGCGGATCATGTCTGACTCAGGCCACAGCCAGCCCAATGTGTTTATCCCTGGGCGCAACAGAAGGCGACGCTGGATGGACCAAGGACCGCCGGGACACCTTAACCTCTCGGAACCTGGACGAGAGAAAGACCCCATGCTCCGGGACAGAGATCAGGATAGATGGGAGGGAAATGAAGAGGGCTATGGCTACACCATTCAGAAAACTCCTATCATCCTTGCAAAGCCAACCTCCGACAGGACAAAGGCGGCAACCCCAGCGGCACCTCCTCCTATGGAAAAACCCATTGTCCTGATGAAAGCCAGGGAAGATGGAAAACCAGCAGCCCCTGCAGAGGGTGCCACCGCACCCCCTCCCACTGCAGTAGCAAAGGTGGAGAAAGAGGGACAGCGACCCACCCAACCAGTATATCAAATACAGAACCGGGGCATGGGAGCCGCAGCAAGTGCCAGTGGCAATGTGGATCCTGTGGTTGGGCAGGCCAAGCTGCTGCCACCTCAGAAGATGAAACACAGCATCAAATTGGTGGATGAATACATGAACTGGTGTGACAGCGCTATTGAGTTCCTGCTGGACCAGACAGATGTCCTTGTGGTTGGCATCCTAGGATTGCAAGGCACAGGAAAGTCCACCCTGATGTCCCTGTTGTCAGCAAACTCTCCAGATGATGACCAAAGGTCTTACGTGTTTCGGATGCAGAGCCAGGAAGTGAGGGAAAGAGCTGGGAACCAGACTAGCGGCATTGACTTCTTCATTAGCCAGGAGAGGATCATCTTCCTCGATACCCAGCCAATTCTCAGTCCAGCGATACTGGATCATCTGATCAATAATGACCGAAAACTACCCCCAGAATACAATCTCCCCCACACCTATGTTGAGATGCAGTCTCTGCAGATCGCTGCCTTTTTGTTCACGGTTTGTCACGTTGTCATCGTTGTACAGGATTGGTTCACAGACTTCAATTTATACCGCTTCCTTCAGACAGCCGAAATGCTTAAGCCATCAACTCCCTCCCCCAGTCATGAGTCAAGTGGCTCTTCTGGCTCTGATGAAGGCATTGAGTATTATCCACATGTAGTTTTCGTGCAAAATAAAGCCAAGAGGGAGGATTACTGTCCCCGCACCTTAAAGCAGATGCACACAGTCATTGATAAACTCATGCTCCATTCACACCTGCGATACAAAGGCACTCTTTCCATGCTGGACTGCAACATCTTCCCAGGTCTGCCCTATGACTTTATCGAGTCAGAAGTTAACTTATTCTTGATCCCGACCATGGAGAGTGACGTGGATGAGACAATATCCAGGGCAGGCACCAGTGGAATCCCTCTCTTCTCCCTCCTGCCGGCATACAAAGGGCATCCCAGTTTTCATTCCCTGATCAGCAGACTGCGCAGCCAGATCATGTCCATGTCACGCCCTCAGCTCTCTCACACCATCCTGACCGAAAAGAACTGGTTCCACTATGCTGCCCGAATTTGGGATGGTGTAAAGAAGTCATCAGCACTTTCGGAGTACAGCAGGTTACTGGGCTAATGTTATACTCTGAAGAATGGCTGCAGTATCGAAATGGCCTGCTGCTGGTTAAGGAAAGACTGGCCCAGCTAAAGAGGCGCAGTATCAAGAAAGGATCGATTTCCTTGGCATTCATGTTGTCCTATGCGAGGTGATGGGATCAGGAACGATCCTGAAGGAGCAATTGTTCTTAGGCCCTTTGTGTTTTGGGAGACCATAAGGGTCCGTGTTTGAAATGGCACTGAGGAAACAAATAGTTGTTCCTATTTTGGAGAAGAGCTGTAGGGGTCCTTAACTTGTTTATCTAGCCTCATGGTGGACTACACCTTGCAACAAAGCCCTGTATCCCTAAAATGAAGTCAGAAGAAGAGAATGTGAATATTTAGCAGCACAGAGAAAGCGAAGGGGGAACGTGTGCGACTGTGAGCAGTGCAGTAAGTGTTGGGTGTGAAGCGTGTCAGACACTGCAGACAACAAGCACAGTGCAAGGAACCTCAATTAAAGTTGCTGTTACAGAAAGGATCAATGTTTTTGCTTTTGTCTATGGTGGCTGGATGTTCTGAAGACATTTATTCCATACATTGCACTCAGGTGAGGGAAGTTTTGTTTTCTGCAGTACTCCTAATAATGACCAGCTTGCTCGGACCAAAGCTCACTGAACCAAATCCTATCTTTACCAGCTGCCAGATCCCTTTCTGTGCAGTGTTTATATCATGTAGAAGTTGCAAGTCTCTCTCTGAAATAAGATACAGGGATATCTGCCTTTATGGCAGAGCAGAGAGTAGAACTTTACAATGTTCACTGGCTTATCTTTATTCCAGTCCTGTCTGTTGTTTACTCTTCTTATCACATTACCTTTCCATCTTGATACAATGCTAACAAAATGTTCCTTGTTTTTGAGTGGTACTGTTAAAGGGGAACTCCACTAAACAACATTTTGAATAATAATTTCAAACAACTTTGCAATACACATCATTTAAAAAATATGCAGCCTTTTCATGTAATAATATGGTTTGAAACAGTTCCCTAAGCCCCGCCCCCTGTTCTGGTGATCTGTCGGACTACTTTGTGACTCAAATAAACTGTAACAGTAGTCGACTTTCCTTAGCCTGCCTTCAGCCTGCATCCTCCCAATCCCACAATTCCCTGCACACGTGATGTCAATAAGGAAAGGAACATCATAGTGCAATGCATTGTGGGTTATGTAGTTCCTGCATGCTGTCTGTAAGCTGGGGAGAGGTTCTTCCCATTTGTAGCATCAGTGTTTTAGTCCCTCCTCCCCTGCCAGGGTTTCAAATGATGCAGAAAGAGAAGATCTGTTTTGCAGCTGGATTTCAGCATATACAAATGGTATTTATTCATAATTCTTGAACAGATTACAGAGATATGTATATTATGGGTTTCAGTGTTGTGTGGGGCTCTTTTGGTTCGGAAGCCAGATGGGCTTCCGACATAAAGTCCCAGTGGTTTGTGGATTATACTTTATTTTTTTGTATATAACAACTTTAACTTACAGCGGAATACTGGTCTTTCCACAACTTTATAAATAGCTTTCCAGCCTTGCGATAACAAAATAAGGTGTTTGGTCGAGTACTCATTATAAAAAAATGTGGCAGCTCCAAGGACAAATAATCACTGATATGTTTCTAATTCTATCCACTGTATGTGGGAGATTTATCAAGATTTGAAAAGTAAATCAACATTGGTAAATACCAAAAAAACTCAGTCTGTTCAAGAGTAGTGTTTTTCTAGTAGTTTGAGCATCTTGACCTTAGATAAATCAGTATATGAAAGCTATGCTGCAGTGTAAAATAGGACAATGACAAACTGAGCTACTTGTGGGCAACTACTTGGTTCAGCTACAACAAAGACAATACTGATTATTGTCTCTACGTGTGTTTTTAGCAGAGACCATTCTTAGTAATGTCTATGGCAGGGTTTTTTTTTTxxTTGGCATTTTxxxAGCTGCxxxAxxAGCACCxxxxxxTCATAGACATAAAATGCAAATAAAATGGCTGACACACAGATATTCCTTATATAGCGTGTATTTTATTGCTTCTGTAAAGGTGTTTATATTGGCGCACTGAGTATAGACTCGTATATAAATTACAAGATTTTTTGCCATCTTGAAAAGTAAATGGATAATTTTGTTTTACTTGCATTGGAGATTATATCCTATCAGAACAGGGATTGATCAGAGATCTATATTGGGCAATGTATTGTCTGGAAACAAATAAGAACACAATGGTGTGACACCAACTTTCAGGTGCTTTTGATGTAGATAAAATGCATAAAGAGAACAGTCAGTAGGAACATGGTGGCTACAACTGAGCAAACCCAAGACCATATAAAAGCAATATTTACTACGCTAGTATCATAAGGTCCAACTGTCCAGATTGTATAAGGGCTCTGGCACAAGGGCAGATCAGTCGCCCGCGACAAATCTCCCCGCTCGCGGGCGACCAATCTCCCCGAATTGCCATCCCACCAGCGAAAAxGCAAxCCGCCGGTTGGAxxGxACACCCCGCGGAGGCGACTCCGGCAAATCGGCGAAGCCGCCTCGTGAGGCATTCTCGATGATTTGCCGAAATCATGCCGCCGCGTGTGCCATCCCACCGGCAACCCACACCCCCACCGGTGGGACGGCAACCCGGGGAGACCAGCCGCCCGCGAACAGGGAGATCCGCCACGGGCGACCAATCTCTCCATGTGCCAGAGCCCTAGGGGCACCCATATTTCTTCAAATAGCTGCTGT
  5   1   2       bld Tbd0 5x                            IMAGE:6976782 CTGCCGTGTGGGTTAGCTGCCGGTGCTGAGGTACCGATAGAGACCTACGGGACAGCGGGTTGTGTTGAGACATTCCGGACTGTACCACCTGTAGCTGTGCTGTAGGGGCGGATCATGTCTGACTCATGCCACAGCCAGCCCAATGTGTTTATCCCTGGGCGCAACAGAAGGCGACGCTGGATGGACCAAGGACCGCCGGGACACCTTAACCTCTCGGAACCTGGACGAGAGAAAGACCCCATGCTCCGGGACAGACATCACGATAGATGGGAGGGAAATGAACGAGGGCTATGGCTACACCATTCCGAAAAACTCCCTTTCATCCTTTGGAAAACCAATCTTTCGACATGGGAAAAAGGGGGGAAACCCCCAAGGGGAAACTTCCTTTTTTATGGGAAAAAACCCCATTGGCCCCCGAATAAAAACCCCCGGGGAAAAAAGGGGAAAAATTTTTTTTGCCCCCCCTTTAAAAAAGGGTTTCCCCCCCCGGGAGAAAACCCCCCTCTTTAAAGTTGGTGGTGGGGTTAATCACTTTAAGAGGGGGGGGGGGGGGAAAAAAAAAATAAGGGGGGGGGGGTTTTTGTTGGTCTCCTCCGCNCCCCTCTTATTTTTGTCTGAGNATACCTAAGGTGTATTTCTATTAGAANCTATGTCATAAGAATTAACACAGCAGCTAGCTTGNCCCCGCTCANNTNCAATATTAATATTAATATCTTATCCCACTATTTCCTCCCCTTCACACTTGCGTACTGTTGCGCCCCATCAATCCACCTGTGGGTTCTGCGGAAGATAAAGGTGTAGAGGTTTTACTCATGCTTAGTCACAACTAGTAGACTTTCTCAGCACCGCTCCTCGTCTGTCCAG
  5   1   2   10  bld Ovi1 5g3  in                        CABI11580.5p .....................................TAGAGACCTACGGGACAGCGGGTTGTGTTGAGACATTCCGGACTGTACCACCTGTAGCTGTGCTGTAGGGGCGGATCATGTCTGACTCAGGCCACAGCCAGCCCAATGTGTTTATCCCTGGGCGCAACAGAAGGCGACGCTGGATGGACCAAGGACCGCCGGGACACCTTAACCTCTCGGAACCTGGACGAGAGAAAGACCCCATGCTCCGGGACAGAGATCAGGATAGATGGGAGGGAAATGAAGAGGGCTATGGCTACACCATTCAGAAAACTCCTATCATCCTTGCAAAGCCAACCTCCGACAGGACAAAGGCGGCAACCCCAGCGGCACCTCCTCCTATGGAAAAACCCATTGTCCTGATGAAAGCCAGGGAAGATGGAAAACCAGCAGCCCCTGCAGAGGGTGCCACCGCACCCCCTCCCACTGCAGTAGCAAAGGTGGAGAAAGAGGGACAGCGACCCACCCAACCAGTATATCAAATACAGAACCGGGGCATGGGAGCCGCAGCAAGTGCCAGTGGCAATGTGGATCCTGTGGTTGGGCAGGCCAAGCTGCTGCCACCTCAGAAGATGAAACACAGCATCAAATTGGTGGATGAATACATGAACTGGTGTGACAGCGCTATTGAGTTCCTGCTGGACCAGACAGATGTCCTTGTGGTTGGCATCCTAGGATTGCAAGGCACAGGAAAGTCCACCCTGATGTCCCTGTTGTCAGCAAACTCTCCAGATGATGACCAAAGGTCTTACGTGTTTCGGATGCAGAGCCAGGAAGTGAGGGAAAGAGCTGGGAACCAGACTAGCGGCATTGACTTCTTCATTAGCCAGGAGAGGATCATCTTCCTCGATACCCAGCCAATTCTCAGTCCAGCGATACTGGATCATCTG
  5   1   2   10  bld Hrt1 PIPE in                         CAAQ3953.5p ...............................................CGGGACAGCGGGTTGTGTTGAGACATTCCGGACTGTACCACCTGTAGCTGTGCTGTAGGGGCGGATCATGTCTGACTCAGGCCACAGCCAGCCCAATGTGTTTATCCCTGGGCGCAACAGAAGGCGACGCTGGATGGACCAAGGACCGCCGGGACACCTTAACCTCTCGGAACCTGGACGAGAGAAAGACCCCATGCTCCGGGACAGAGATCAGGATAGATGGGAGGGAAATGAAGAGGGCTATGGCTACACCATTCAGAAAACTCCTATCATCCTTGCAAAGCCAACCTCCGACAGGACAAAGGCGGCAACCCCAGCGGCACCTCCTCCTATGGAAAAACCCATTGTCCTGATGAAAGCCAGGGAAGATGGAAAACCAGCAGCCCCTGCAGAGGGTGCCACCGCACCCCCTCCCACTGCAGTAGCAAAGGTGGAGAAAGAGGGACAGCGACCCACCCAACCAGTATATCAAATACAGAACCGGGGCATGGGAGCCGCAGCAAGTGCCAGTGGCAATGTGGATCCTGTGGTTGGGCAGGCCAAGCTGCTGCCACCTCAGAAGATGAAACACAGCATCAAATTGGTGGATGAATACATGAACTGGTGTGACAGCGCTATTGAGTTCCTGCTGGACCAGACAGATGTCCTTGTGGTTGGCATCCTAGGATTGCAAGGCACAGGAAAGTCCACCCTGATGTCCCTGTTGTCAGCAAACTCTCCAGATGATGACCAAAGGTCTTACGTGTTTCGGATGCAGAGCCAGGAAGTGAGGGAAAGAGCTGGGAACCAGACTAGCGGCATTGACTTCTTCATTAGCCAGGAGAGGATCATCTTCCTCGATACCCAGCCAATTCTCAGTCCAGCGATACTGGATCATCTGATC
  5   1   2       bld TpA  5g3  in                   TTpA012d15.p1kSP6                                                                          ATGAGACCTGCCGTGTGGGTTAGCTGCCGTTGCTGAGGATCATGTCTGACTCAGGCCACAGCCAGCCCAATGTGTTTATCCCTGGGCGCAACAGAAGGCGACGCTGGATGGACCAAGGACCGCCGGGACACCTTAACCTCTCGGAACCTGGACGAGAGAAAGACCCCATGCTCCGGGACAGAGATCAGGATAGATGGGAGGGAAATGAAGAGGGCTATGGCTACACCATTCAGAAAACTCCTATCATCCTTGCAAAGCCAACCTCCGACAGGACAAAGGCGGCAACCCCAGCGGCACCTCCTCCTATGGAAAAACCCATTGTCCTGATGAAAGCCAGGGAAGATGGAAAACCAGCAGCCCCTGCAGAGGGTGCCACCGCACCCCCTCCCACTGCAGTAGCAAAGGTGGAGAAAGAGGGACAGCGACCCACCCAACCAGTATATCAAATACAGAACCGGGGCATGGGAGCCGCAGCAAGTGCCAGTGGCAATGTGGATCCTGTGGTTGGGCAGGCCAAGCTGCTGCCACCTCAGAAGATGAAACACAGCATCAAATTGGTGGATGAATACATGAACTGGTGTGACAGCGCTATTGAGTTCCTGCTGGACCAGACAGATGTCCTTGTGGTTGGCATCCTAGGATTGCAAGGCACAGGAAAGTCCACCCTGATGTCCCTGTTGTCAGCAAACTCTCCAGATGATGACCAAAGGTCTTACGTGTTTCGGATGCAGAGCCAGGAAGTGAGGGAAAGAGCTGGGAACCAGACTAGCGGCATTGACTTCTTCATTAGCCAGGAGAGGATCATCTTCCTCGATACCCAGCCAATTCTCAGTCCAGCGATACTGGATCATCTGATCAATAATGACCGAAAACTACCCCCAGAATACAATCTCCCCCACACCTATGTTGAGATGCAGTCTCTGCAGATCGCTGCCTTTTTG
  5   1   2       bld Neu0      in                       IMAGE:6992364                                                                                                                    GTCTGACTCAGGCCACAGCCAGCCCAATGTGTTTATCCCNTGGGCGCAACAGAAGGCGACGCTGGATGGACCAAGGACCGCCGGGACACCTTAACCTCTCGGAACCTGGACGAGAGAAAGACCCCATGCTCCGGGACAGAGATCAGGATAGATGGGAGGGAAATGAAGAGGGCTATGGCTACACCATTCAGAAAACTCCTATCATCCTTGCAAAGCCAACCTCCGACAGGACAAAGGCGGCAACCCCAGCGGCACCTCCTCCTATGGAAAAACCCATTGTCCTGATGAAAGCCAGGGAAGATGGAAAACCAGCAGCCCCTGCAGAGGGTGCCACCGCACCCCCTCCCACTGCAGTAGCAAAGGTGGAGAAAGAGGGACAGCGACCCACCCAACCAGTATATCAAATACAGAACCGGGGCATGGGAGCCGCAGCAAGTGCCAGTGGCAATGTGGATCCTGTGGTTGGGCAGGCCAAGCTGCTGCCACCTCAGAAGATGAAACACAGCATCAAATTGGTGGATGAATACATGAACTGGTGTGACAGCGCTATTGAGTTCCTGCTGGACCAGACAGATGTCCTTGTGGTTGGCATCCTAGGATTGCAAGGCACAGGAAAGTCCACCCTGATGTCCCTGTTGTCAGCAAACTCTCCAGATGATGACCAAAGGTCTTACGTGTTTCGGATGCAGAGCCAGGAAGTGAGGGAAAGAGCTGGGAACCAGACTAGCGGCATTGACTTCTTCATTAGCCAGGAGAGGATCATCTTCCTCGATACCCAGCCAATTCTCAGTCCAGCGATACTGGATCATCTGATCAATAATGACCGAAAACTACCCCCAGAATACAATCTCCCCCACACCTATGNTTGAGATGCAGTCTCTGCAGATCGCTGCCTTTTTGTCAGGTTTGTCACGTT
  5   1   2       bld Ova1      in                         CABE1066.5p                                                                                                                                                                                                                                                                                                                               GTCCATCGATTCGCAACCTCCGACAGGACAAAGGCGGCAACCCCAGCGGCACCTCCTCCTATGGAAAAACCCATTGTCCTGATGAAAGCCAGGGAAGATGGAAAACCAGCAGCCCCTGCAGAGGGTGCCACCGCACCCCCTCCCACTGCAGTAGCAAAGGTGGAGAAAGAGGGACAGCGACCCACCCAACCAGTATATCAAATACAGAACCGGGGCATGGGAGCCGCAGCAAGTGCCAGTGGCAATGTGGATCCTGTGGTTGGGCAGGCCAAGCTGCTGCCACCTCAGAAGATGAAACACAGCATCAAATTGGTGGATGAATACATGAACTGGTGTGACAGCGCTATTGAGTTCCTGCTGGACCAGACAGATGTCCTTGTGGTTGGCATCCTAGGATTGCAAGGCACAGGAAAGTCCACCCTGATGTCCCTGTTGTCAGCAAACTCTCCAGATGATGACCAAAGGTCTTACGTGTTTCGGATGCAGAGCCAGGAAGTGAGGGAAAGAGCTGGGAACCAGACTAGCGGCATTGACTTCTTCATTAGCCAGGAGAGGATCATCTTCCTCGATACCCAGCCAATTCTCAGTCCAGCGATACTGGATCATCTGATCAATAATGACCGAAAACTACCCCCAGAATACAATCTCCCCCACACCTATGTTGAGATGCAGTCTCTGCAGATCGCTGCCTTTTTGTTCACGGTTTGTCACGTTGTCATCGTTGTACAGGATTGGTTCACAGACTTCAATTTATACCGCTTCCTTCAGACAGCCGAAATGCTTAAGCCATCAACTCCCTCCCCCAGTCATGAGTCAAGTGGCTCTTCTGGCTCTGATGAAGGCATTGAGTATTATCCACATGTA
  5   1   2       bld Te4       in                         CAAN1956.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGAGGGACAGCGACCCACCCAACCAGTATATCAAATACAGAACCGGGGCATGGGAGCCGCAGCAAGTGCCAGTGGCAATGTGGATCCTGTGGTTGGGCAGGCCAAGCTGCTGCCACCTCAGAAGATGAAACACAGCATCAAATTGGTGGATGAATACATGAACTGGTGTGACAGCGCTATTGAGTTCCTGCTGGACCAGACAGATGTCCTTGTGGTTGGCATCCTAGGATTGCAAGGCACAGGAAAGTCCACCCTGATGTCCCTGTTGTCAGCAAACTCTCCAGATGATGACCAAAGGTCTTACGTGTTTCGGATGCAGAGCCAGGAAGTGAGGGAAAGAGCTGGGAACCAGACTAGCGGCATTGACTTCTTCATTAGCCAGGAGAGGATCATCTTCCTCGATACCCAGCCAATTCTCAGTCCAGCGATACTGGATCATCTGATCAATAATGACCGAAAACTACCCCCAGAATACAATCTCCCCCACACCTATGTTGAGATGCAGTCTCTGCAGATCGCTGCCTTTTTGTTCACGGTTTGTCACGTTGTCATCGTTGTACAGGATTGGTTCACAGACTTCAATTTATACCGCTTCCTTCAGACAGCCGAAATGCTTAAGCCATCAACTCCCTCCCCCAGTCATGAGTCAAGTGGCTCTTCTGGCTCTGATGAAGGCATTGAGTATTATCCACATGTAGTTTTCGTGCAAAATAAAGCCAAGAGGGAGGATTACTGTCCCCGCACCTTANAGCAGATGCACACAGTCATTGATAAACTCATGCTCCATTCACACCTGCGATACAAGGGCACTCTTTCCATGCTGGACTGCAACATCTTCCCAGGTCTGCCCTATGACTTTATCGAGTC
  5   1   2       bld Spl1      out                        CABK9492.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCAAGTGCCAGTGGCAATGTGGATCCTGTGGTTGGGCAGGCCAAGCTGCTGCCACCTCAGAAGATGAAACACAGCATCAAATTGGTGGATGAATACATGAACTGGTGTGACAGCGCTATTGAGTTCCTGCTGGACCAGACAGATGTCCTTGTGGTTGGCATCCTAGGATTGCAAGGCACAGGAAAGTCCACCCTGATGTCCCTGTTGTCAGCAAACTCTCCAGATGATGACCAAAGGTCTTACGTGTTTCGGATGCAGAGCCAGGAAGTGAGGGAAAGAGCTGGGAACCAGACTAGCGGCATTGACTTCTTCATTAGCCAGGAGAGGATCATCTTCCTCGATACCCAGCCAATTCTCAGTCCAGCGATACTGGATCATCTGATCAATAATGACCGAAAACTACCCCCAGAATACAATCTCCCCCACACCTATGTTGAGATGCAGTCTCTGCAGATCGCTGCCTTTTTGTTCACGGTTTGTCACGTTGTCATCGTTGTACAGGATTGGTTCACAGACTTCAATTTATACCGCTTCCTTCAGACAGCCGAAATGCTTAAGCCATCAACTCCCTCCCCCAGTCATGAGTCAAGTGGCTCTTCTGGCTCTGATGAAGGCATTGAGTATTATCCACATGTAGTTTTCGTGCAAAATAAAGCCAAGAGGGAGGATTACTGTCCCCGCACCTTANAGCAGATGCACACAGTCATTGATAAACTCATGCTCCATTCACACCTGCGATACANAGGCACTCTTTCCATGCTGGACTGCAACATCTTCCCAGGTCTGCCCTATGACTTTATCGAGTCAGAAGTTAACTTATTCTTGATCCCGACCATGGAGAGTGACG
  5   1   2       bld Tail      in                         CBSW3228.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCATCCTAGGATTGCAAGGCACAGGGAAAGTCCACCCTGATGTCCCTGTTGTCAGCAAACTCTCCAGATGATGACCAAAGGTCTTACGTGTTTCGGATGCAGAGCCAGGAAGTGAGGGAAAGAGCTGGGAACCAGACTAGCGGCATTGACTTCTTCATTAGCCAGGAGAGGATCATCTTCCTCGATACCCAGCCAATTCTCAGTCCAGCGATACTGGATCATCTGATCAATAATGACCGAAAACTACCCCCAGAATACAATCTCCCCCACACCTATGTTGAGATGCAGTCTCTGCAGATCGCTGCCTTTTTGTTCACGGTTTGTCACGTTGTCATCGTTGTACAGGATTGGTTCACAGACTTCAATTTATACCGCTTCCTTCAGACAGCCGAAATGCTTAAGCCATCAACTCCCTCCCCCAGTCATGAGTCAAGTGGCTCTTCTGGCTCTGATGAAGGCATTGAGTATTATCCACATGTAGTTTTCGTGCAAAATAAAGCCAAGAGGGAGGATTACTGTCCCCGCACCTTAAAGCAGATGCACACAGTCATTGATAAACTCATGCTCCATTCACACCTGCGATACAAAGGCACTCTTTCCATGCTGGACTGCAACATCTTCCCAGGTCTGCCCTATGACTTTATCGAGTCAGAAGTTAACTTATTCTTGATCCCGACCATGGAGAGTGACGTGGATGAGACAA
  3  -1   2       bld Mus1      in                         CABH6898.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGGCGAGAGGTTTTTGTTCACGGTTTGTCACGTTGTCATCGTTGTACAGGATTGGTTCACAGACTTCAATTTATACCGCTTCCTTCAGACAGCCGAAATGCTTAAGCCATCAACTCCCTCCCCCAGTCATGAGTCAAGTGGCTCTTCTGGCTCTGATGAAGGCATTGAGTATTATCCACATGTAGTTTTCGTGCAAAATAAAGCCAAGAGGGAGGATTACTGTCCCCGCACCTTAAAGCAGATGCACACAGTCATTGATAAACTCATGCTCCATTCACACCTGCGATACAAAGGCACTCTTTCCATGCTGGACTGCAACATCTTCCCAGGTCTGCCCTATGACTTTATCGAGTCAGAAGTTAACTTATTCTTGATCCCGACCATGGAGAGTGACGTGGATGAGACAATATCCAGGGCAGGCACCAGTGGAATCCCTCTCTTCTCCCTCCTGCCGGCATACAAAGGGCATCCCAGTTTTCATTCCCTGATCAGCAGACTGCGCAGCCAGATCATGTCCATGTCACGCCCTCAGCTCTCTCACACCATCCTGACCGAAAAGAACTGGTTCCACTATGCTGCCCGAATTTGGGATGGTGTAAAGAAGTCATCAGCACTTTCGGAGTACAGCAGGTTACTGGGCTAATGTTATACTCTGAAGAATGGCTGCAGTATCGAAATGGCCTGCTGCTGGTTAAGGAAAGACTGGCCCAGCTAAAGAGGCGCAGTATCAAGAAAGGATCGATTTCCTTGGCATTCATGTTGTCCTATGCGAGGTGATGGGATCAGGAACGATCCTGAAGGAGCAATTGTTCTTAGGCCCTTTGTGTTTTGGGAGACCATAA
  5   1   2       bld Gas7      in                         XZG25132.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGACGCGTGGGTGGCTCTTCTGGCTCTGATGAAGGCATTGAGTATTATCCACATGTAGTTTTCGTGCAAAATAAAGCCAAGAGGGAGGATTACTGTCCCCGCACCTTAAAGCAGATGCACACAGTCATTGATAAACTCATGCTCCATTCACACCTGCGATACAAAGGCATTCTTTCCATGCTGGACTGCAACATCTTCCCAGGTCTGCCCTATGACTTTATCGAGTCAGAAGTTAACTTATTCTTGATCCCGACCATGGAGAGTGACGTGGATGAGACAATATCCAGGGCAGGCACCAGTGGAATCCCTCTCTTCTCCCTCCTGCCGGCATACAAAGGGCATCCCAGTTTTCATTCCCTGATCAGCAGACTGCGCAGCCAGATCATGTCCATGTCACGCCCTCAGCTCTCTCACACCATCCTGACCGAAAAGAACTGGTTCCACTATGCTGCCCGAATTTGGGATGGTGTAAAGAAGTCATCAGCACTTTCGGAGTACAGCAGGTTACTGGGCTAATGTTATACTCTGAAGAATGGCTGCAGTATCGAAATGGCCTGCTGCTGGTTAAGGAAAGACTGGCCCAGCTAAAGAGGCGCAGTATCAAGAAAGGATCGATTTCCTTGGCATTCATGTTGTCCTATGCGAGGTGATGGGATCAGGAACGATCCTGAAGGAGCAATTGTTCTTAGGCCCTTTGTGTTTTGGGAGACCATA
  5  -1   2      seed Mus1      in                         CABH6898.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCATGCTCCATTCACACCTGCGATACAAAGGCACTCTTTCCATGCTGGACTGCAACATCTTCCCAGGTCTGCCCTATGACTTTATCGAGTCAGAAGTTAACTTATTCTTGATCCCGACCATGGAGAGTGACGTGGATGAGACAATATCCAGGGCAGGCACCAGTGGAATCCCTCTCTTCTCCCTCCTGCCGGCATACAAAGGGCATCCCAGTTTTCATTCCCTGATCAGCAGACTGCGCAGCCAGATCATGTCCATGTCACGCCCTCAGCTCTCTCACACCATCCTGACCGAAAAGAACTGGTTCCACTATGCTGCCCGAATTTGGGATGGTGTAAAGAAGTCATCAGCACTTTCGGAGTACAGCAGGTTACTGGGCTAATGTTATACTCTGAAGAATGGCTGCAGTATCGAAATGGCCTGCTGCTGGTTAAGGAAAGACTGGCCCAGCTAAAGAGGCGCAGTATCAAGAAAGGATCGATTTCCTTGGCATTCATGTTGTCCTATGCGAGGTGATGGGATCAGGAACGATCCTGAAGGAGCAATTGTTCTTAGGCCCTTTGTGTTTTGGGAGACCATAAGGGTCCGTGTTTGAAATGGCACTGAGGAAACAAATAGTTGTTCCTATTTTGGAGAAGAGCTGTAGGGGTCCTTAACTTGTTTATCTAGCCTCATGGTGGACTACACCTTGCAACAAAGCCCTGTATCCCTAAAATGAAGTCAGAAGAAGAGAATGTGAATATTTAGCAGCACAGAGAAAGCGAAGGGGGAACGTGTGCGACTGTGAGCAGTGCAGTAAGTGTTGGGTGTGAAGCGTGTCAGACACTGCAGACAACAAGCACAGTGCAAGGAACCTCAATTAAAG
  3   1   2       bld HdA       out                  THdA007l16.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTCAGAAGTTAACTTATTCTTGATCCCGACCATGGAGAGTGACGTGGATGAGACAATATCCAGGGCAGGCACCAGTGGAATCCCTCTCTTCTCCCTCCTGCCGGCATACAAAGGGCATCCCAGTTTTCATTCCCTGATCAGCAGACTGCGCAGCCAGATCATGTCCATGTCACGCCCTCAGCTCTCTCACACCATCCTGACCGAAAAGAACTGGTTCCACTATGCTGCCCGAATTTGGGATGGTGTAAAGAAGTCATCAGCACTTTCGGAGTACAGCAGGTTACTGGGCTAATGTTATACTCTGAAGAATGGCTGCAGTATCGAAATGGCCTGCTGCTGGTTAAGGAAAGACTGGCCCAGCTAAAGAGGCGCAGTATCAAGAAAGGATCGATTTCCTTGGCATTCATGTTGTCCTATGCGAGGTGATGGGATCAGGAACGATCCTGAAGGAGCAATTGTTCTTAGGCCCTTTGTGTTTTGGGAGACCATAAGGGTCCGTGTTTGAAATGGCACTGAGGAAACAAATAGTTGTTCCTATTTTGGAGAAGAGCTGTAGGGGTCCTTAACTTGTTTATCTAGCCTCATGGTGGACTACACCTTGCAACAAAGCCCTGTATCCCTAAAATGAAGTCAGAAGAAGAGAATGTGAATATTTAGCAGCACAGAGAAAGCGAAGGGGGAAAGTATGAAAATAGAACAGTACAGTAAAGTATTGGGTGTAAAGCGTGTAGACAATGCAGAAAAACAGCAACAGTGCAAAGGAAACCTCAAATTAAAAGTTGCTGTTACAGAAAAAAAAAAAAAAAAAAGCGCC
  5   1   2       bld Ovi1      in                        CABI10080.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCTCTTCTCCCTCCTGCCGGCATACAAAGGGCATCCCAGTTTTCATTCCCTGATCAGCAGACTGCGCAGCCAGATCATGTCCATGTCACGCCCTCAGCTCTCTCACACCATCCTGACCGAAAAGAACTGGTTCCACTATGCTGCCCGAATTTGGGATGGTGTAAAGAAGTCATCAGCACTTTCGGAGTACAGCAGGTTACTGGGCTAATGTTATACTCTGAAGAATGGCTGCAGTATCGAAATGGCCTGCTGCTGGTTAAGGAAAGACTGGCCCAGCTAAAGAGGCGCAGTATCAAGAAAGGATCGATTTCCTTGGCATTCATGTTGCCCTATGCGAGGTGATGGGATCAGGAACGATCCTGAAGGAGCAATTGTTCTTAGGCCCTTTGTGTTTTGGGAGACCATAAGGGTCCGTGTTTGAAATGGCACTGAGGAAACAAATAGTTGTTCCTATTTTGGAGAAGAGCTGTAGGGGTCCTTAACTTGTTTATCTAGCCTCATGGTGGACTACACCTTGCAACAAAGCCCTGTATCCCTAAAATGAAGTCAGAAGAAGAGAATGTCAATATTTAGCAGCACAGAGAAAGCGAAGGGGGAACGTGTGCGACTGTGAGCAGTGCAGTAAGTGTTGGGTGTGAAGCGTGTCAGACACTGCAGACAACAAGCACAGTGCAAGGAACCTCAATTAAAGTTGCTGTTACAG
  3   1   2       bld Ova1      in                         CABE1066.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCTCCTGCCGGCATACAAAGGGCATCCCAGTTTTCATTCCCTGATCAGCAGACTGCGCAGCCAGATCATGTCCATGTCACGCCCTCAGCTCTCTCACACCATCCTGACCGAAAAGAACTGGTTCCACTATGCTGCCCGAATTTGGGATGGTGTAAAGAAGTCATCAGCACTTTCGGAGTACAGCAGGTTACTGGGCTAATGTTATACTCTGAAGAATGGCTGCAGTATCGAAATGGCCTGCTGCTGGTTAAGGAAAGACTGGCCCAGCTAAAGAGGCGCAGTATCAAGAAAGGATCGATTTCCTTGGCATTCATGTTGTCCTATGCGAGGTGATGGGATCAGGAACGATCCTGAAGGAGCAATTGTTCTTAGGCCCTTTGTGTTTTGGGAGACCATAAGGGTCCGTGTTTGAAATGGCACTGAGGAAACAAATAGTTGTTCCTATTTTGGAGAAGAGCTGTAGGGGTCCTTAACTTGTTTATCTAGCCTCATGGTGGACTACACCTTGCAACAAAGCCCTGTATCCCTAAAATGAAGTCAGAAGAAGAGAATGTGAATATTTAGCAGCACAGAGAAAGCGAAGGGGGAACGTGTGCGACTGTGAGCAGTGCAGTAAGTGTTGGGTGTGAAGCGTGTCAGACACTGCAGACAACAAGCACAGTGCAAGGAACCTCAATTAAAGTTGCTGTTACAGAAAGG
  3   1   2       bld Ovi1      in                        CABI10080.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCTCCTGCCGGCATACAAAGGGCATCCCAGTTTTCATTCCCTGATCAGCAGACTGCGCAGCCAGATCATGTCCATGTCACGCCCTCAGCTCTCTCACACCATCCTGACCGAAAAGAACTGGTTCCACTATGCTGCCCGAATTTGGGATGGTGTAAAGAAGTCATCAGCACTTTCGGAGTACAGCAGGTTACTGGGCTAATGTTATACTCTGAAGAATGGCTGCAGTATCGAAATGGCCTGCTGCTGGTTAAGGAAAGACTGGCCCAGCTAAAGAGGCGCAGTATCAAGAAAGGATCGATTTCCTTGGCATTCATGTTGCCCTATGCGAGGTGATGGGATCAGGAACGATCCTGAAGGAGCAATTGTTCTTAGGCCCTTTGTGTTTTGGGAGACCATAAGGGTCCGTGTTTGAAATGGCACTGAGGAAACAAATAGTTGTTCCTATTTTGGAGAAGAGCTGTAGGGGTCCTTAACTTGTTTATCTAGCCTCATGGTGGACTACACCTTGCAACAAAGCCCTGTATCCCTAAAATGAAGTCAGAAGAAGAGAATGTCAATATTTAGCAGCACAGAGAAAGCGAAGGGGGAACGTGTGCGACTGTGAGCAGTGCAGTAAGTGTTGGGTGTGAAGCGTGTCAGACACTGCAGACAACAAGCACAGTGCAAGGAACCTCAATTAAAGTTGCTGTACAGAAAAAAACCTCTCGCCCT
  3   1   2       bld Ovi1 5g3  in                        CABI11580.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCTCCTGCCGGCATACAAAGGGCATCCCAGTTTTCATTCCCTGATCAGCAGACTGCGCAGCCAGATCATGTCCATGTCACGCCCTCAGCTCTCTCACACCATCCTGACCGAAAAGAACTGGTTCCACTATGCTGCCCGAATTTGGGATGGTGTAAAGAAGTCATCAGCACTTTCGGAGTACAGCAGGTTACTGGGCTAATGTTATACTCTGAAGAATGGCTGCAGTATCGAAATGGCCTGCTGCTGGTTAAGGAAAGACTGGCCCAGCTAAAGAGGCGCAGTATCAAGAAAGGATCGATTTCCTTGGCATTCATGTTGCCCTATGCGAGGTGATGGGATCAGGAACGATCCTGAAGGAGCAATTGTTCTTAGGCCCTTTGTGTTTTGGGAGACCATAAGGGTCCGTGTTTGAAATGGCACTGAGGAAACAAATAGTTGTTCCTATTTTGGAGAAGAGCTGTAGGGGTCCTTAACTTGTTTATCTAGCCTCATGGTGGACTACACCTTGCAACAAAGCCCTGTATCCCTAAAATGAAGTCAGAAGAAGAGAATGTCAATATTTAGCAGCACAGAGAAAGCGAAGGGGGAACGTGTGCGACTGTGAGCAGTGCAGTAAGTGTTGGGTGTGAAGCGTGTCAGACACTGCAGACAACAAGCACAGTGCAAGGAACCTCAATTAAAGTTGCTGTTACAGAAAGG
  3   1   2       bld TpA  5g3  in                    TTpA012d15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCCTGCCGGCATACAAAGGGCATCCCAGTTTTCATTCCCTGATCAGCAGACTGCGCAGCCAGATCATGTCCATGTCACGCCCTCAGCTCTCTCACACCATCCTGACCGAAAAGAACTGGTTCCACTATGCTGCCCGAATTTGGGATGGTGTAAAGAAGTCATCAGCACTTTCGGAGTACAGCAGGTTACTGGGCTAATGTTATACTCTGAAGAATGGCTGCAGTATCGAAATGGCCTGCTGCTGGTTAAGGAAAGACTGGCCCAGCTAAAGAGGCGCAGTATCAAGAAAGGATCGATTTCCTTGGCATTCATGTTGTCCTATGCGAGGTGATGGGATCAGGAACGATCCTGAAGGAGCAATTGTTCTTAGGCCCTTTGTGTTTTGGGAGACCATAAGGGTCCGTGTTTGAAATGGCACTGAGGAAACAAATAGTTGTTCCTATTTTGGAGAAGAGCTGTAGGGGTCCTTAACTTGTTTATCTAGCCTCATGGTGGACTACACCTTGCAACAAAGCCCTGTATCCCTAAAATGAAGTCAGAAGAAGAGAATGTGAATATTTAGCAGCACAGAGAAAGCGAAGGGGGAACGTGTGCGACTGTGAGCAGTGCAGTAAGTGTTGGGTGTGAAGCGTGTCAGACACTGCAGACAACAAGCACAGTGCAAGGAACCTCAATTAAAGTTGCTGTTACAGAAAGGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tail      in                         CBSW3228.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATACAAAGGGCATCCCAGTTTTCATTCCCTGATCAGCAGACTGCGCAGCCAGATCATGTCCATGTCACGCCCTCAGCTCTCTCACACCATCCTGACCGAAAAGAACTGGTTCCACTATGCTGCCCGAATTTGGGATGGTGTAAAGAAGTCATCAGCACTTTCGGAGTACAGCAGGTTACTGGGCTAATGTTATACTCTGAAGAATGGCTGCAGTATCGAAATGGCCTGCTGCTGGTTAAGGAAAGACTGGCCCAGCTAAAGAGGCGCAGTATCAAGAAAGGATCGATTTCCTTGGCATTCATGTTGTCCTATGCGAGGTGATGGGATCAGGAACGATCCTGAAGGAGCAATTGTTCTTAGGCCCTTTGTGTTTTGGGAGACCATAAGGGTCCGTGTTTGAAATGGCACTGAGGAAACAAATAGTTGTTCCTATTTTGGAGAAGAGCTGTAGGGGTCCTTAACTTGTTTATCTAGCCTCATGGTGGACTACACCTTGCAACAAAGCCCTGTATCCCTAAAATGAAGTCAGAAGAAGAGAATGTGAATATTTAGCAGCACAGAGAAAGCGAAGGGGGAACGTGTGCGACTGTGAGCAGTGCAGTAAGTGTTGGGTGTGAAGCGTGTCAGACACTGCAGACAACAAGCACAGTGCAAGGAACCTCAATTAAAGTTGCTGTTACAGAAAAAAAAAAAAAAA
  3   1   2       bld Te4       in                         CAAN1956.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACAAAGGGCATCCCAGTTTTCATTCCCTGATCAGCAGACTGCGCAGCCAGATCATGTCCATGTCACGCCCTCAGCTTTTTCACACCATCCTGACCGAAAAGAACTGGTTCCACTATGCTGCCCGAATTTGGGATGGTGTAAAGAAGTCATCAGCACTTTCGGAGTACAGCAGGTTACTGGGCTAATGTTATACTTTGAAGAATGGCTGCAGTATCGAAATGGCCTGCTGCTGGTTAAGGAAAGACTGGCCCAGCTAAAGAGGGGCAGTATCAAGAAAGGATCGATTTCCTTGGCATTCATGTTGCCCTTTGGGAGGTGATGGGATCAGGAACGATCCTGAAGGAGCAATTGTTTTTAGGCCCTTTGTGTTTTGGGAGACCATAAGGGTCCGTGTTTGAAATGGCACTGAGGAAACAAATAGTTGTTCCTTTTTTGGAGAAGAGCTGTAGGGGTCCTTAACTTGTTTATCTAGCCTCATGGTGGACTACCCCTTGCAACAAAGCCCTGTATCCCTAAAATGAAGTCAGAAGAAGGGAATGTCAATATTTAGCAGCCCAGAGAAAGCGAAGGGGGAACGTGTGCGACTGTGAGCAGTGCAGTAAGTGTTGGGTGTGAAGCGTGTCAGACACTGCAGACAACAAGCACAGTGCAAGGAACCTCAATTAAAGTTGCTGTTCCGG
  5   1   2       bld Tad5                                 XZT48481.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTTGTGTTTTGGGAGACCATAAGGGTCCGTGTTTGAAATGGCACTGAGGAAACAAATAGTTGTTCCTATTTTGGAGAAGAGCTGTAGGGGTCCTTAACTTGTTTATCTAGCCTCATGGTGGACTACACCTTGCAACAAAGCCCTGTATCCCTAAAATGAAGTCAGAAGAAGAGAATGTGAATATTTAGCAGCACAGAGAAAGCGAAGGGGGAACGTGTGCGACTGTGAGCAGTGCAGTAAGTGTTGGGTGTGAAGCGTGTCAGACACTGCAGACAACAAGCACAGTGCAAGGAACCTCAATTAAAGTTGCTGTTACAGAAAGGATCAATGTTTTTGCTTTTGTCTATGGTGGCTGGATGTTCTGAAGACATTTATTCCATACATTGCACTCAGGTGAGGGAAGTTTTGTTTTCTGCAGTACTCCTAATAATGACCAGCTTGCTCGGACCAAAGCTCACTGAACCAAATCCTATCTTTACCAGCTGCCAGATCCCTTTCTGTGCAGTGTTTATATCATGTAGAAGTTGCAAGTCTCTCTCTGAAATAAGATACAGGGATATCTGCCTTTATGGCAGAGCAGAGAGTAGAACTTTACAATGTTCACTGGCTTATCTTTATTCCAGTCCTGTCTGTTGTTTACTCTTCTTATCACATTACCTTTTCCATCTTGATACAATGCTAACAAAATGTTC
  5   1   2       bld Gas                            TGas144i06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCACAGAGAAAAGCGAAGGGGGAACGTGTGCGACTGTGAGCAGTGCAGTAAGTGTTGGGTGTGAAGCGTGTCAGACACTTGCAGACAACAAGCACAGTGCAAGGAACCTCAATTAAAGTTGCTGTTACAGAAAGGATCAATGTTTTTGCTTTTGTCTATGGTGGCTGGATGTTCTGAAGAACATTTATTCCATACATTGCACTCAGGTGAGGGAAGTTTTGTTTTCTGCAGTACTCCTAATAATGACCAGCTTGCTCGGACCAAAGCTCACTGAACCAAATCCTATCTTTACCAGCTGCCAGATCCCTTTCTGTGCAGTGTTTATATCATGTAGAAGTTGCAAGTCTCTCTCTGAAATAAGATACAGGGATATCTGCCTTTATGGCAGAGCAGAGAGTAGAACTTTACAATGTTCACTGGCTTATCTTTATTCCAGTCCTGTCTGTTGTTTACTCTTCTTATCACATTACCTTTCCATCTTGATACAATGCTAACAAAATGTTCCTTGTTTTTGAGTGGTACTGTTAAAGGGGAACTCCACTAAACAACATTTTGAATAATAATTTCAAACAACTTTGCAATACACATCATTT
  5   1   2       bld Neu       in                   TNeu081i10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTGCAGTAAGTGTTGGGTGTGAAGCGTGTCAGACACTGCAGACAACAAGCACAGTGCAAGGAACCTCAATTAAAGTTGCTGTTACAGAAAGGATCAATGTTTTTGCTTTTGTCTATGGTGGCTGGATGTTCTGAAGACATTTATTCCATACATTGCACTCAAGTGAGGGAAGTTTTGTTTTCTGCAGTACTCCTAATGATGACCAGCTTGCTCGGACCAAAGCTCACTGAACCAAATCCTATCTTTACCAGCTGCCAGATCCCTTTCTGTGCAGTGTTTATATCATGTAGAAGTTGCAAGTCTCTCTCTGAAATAAGATACAGGGATATCTGCCTTTATGGCAGAGCAGAGAGTAGAACTTTACAATGTGCACTGGCTTATCTTTATTCCAGTCCTGTCTGTTGTGTACTCTTCTTATCACATTACCTTTCCATCTTGATACAATGCTAACAAAATGTTCCTTGTTTTTGAGTGGTACTGTTAAAGGGGAACTCCACTAAACAACATTGTGAATAATAATTTCAAACAACTTGCGATACACATCATTTAAAAAATATGCAGCCTTTTCAT
  5   1   2       bld BrSp      ?                     EC0CBA005BA06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCAGTAAGTGTTGGGTGTGAAGCGTGTCAGACACTGCAGACAACAAGCACAGTGCAAGGAACCTCAATTAAAGTTGCTGTTACAGAAAGGATCAATGTTTTTGCTTTTGTCTATGGTGGCTGGATGTTCTGAAGACATTTATTCCATACATTGCACTCAGGTGAGGACAGTTTTGTTTTCTGCAGTACTCCTAATAATGACCAGCTTGCTCGGACCAAAGCTCACTGAACCAAATCCTATCTTTACCAGCTGCCAGATCCCTTTCTGTGCAGTGTTTATATCATGTAGAAGTTGCAAGTCTCTCTCTGAAATAAGATACAGGGATATCTGCCTTTATGGCAGAGCAGAGAGTAGAACTTTACAATGTTCACTGGCTTATCTTTATTCCAGTCCTGTCTGTTGTTTACTCTTCTTATCACATTACCTTTCCATCTTGATACAATGCTAACAAAATGTTCGTTGTTTTTGAGTGGTACTGTTAAAGGGGAACTCCACCAAACAACATTTTGAATAATAatttcaaacaactttgcaatacacatcatttaaaaaatatgcagccttttcaTGTAATAATATGGTTTGAAACAGTTCCCTAAGCCCCACCCTGTTCTGCTGATTTGTCGGATGACTTTGTGACTCAAATAAACTGTAACAGTAGTCGACTTTCCTT
  5   1   2       bld Ski1      in                         CABJ7361.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCAATTAAAGTTGCTGTTACAGAAAGGATCAATGTTTTTGCTTTTGTCTATGGTGGCTGGATGTTCTGAAGACATTTATTCCATACATTGCACTCAGGTGAGGGAAGTTTTGTTTTCTGCAGTACTCCTAATAATGACCAGCTTGCTCGGACCAAAGCTCACTGAACCAAATCCTATCTTTACCAGCTGCCAGATCCCTTTCTGTGCAGTGTTTATATCATGTAGAAGTTGCAAGTCTCTCTCTGAAATAAGATACAGGGATATCTGCCTTTATGGCAGAGCAGAGAGTAGAACTTTACAATGTTCACTGGCTTATCTTTATTCCAGTCCTGTCTGTTGTTTACTCTTCTTATCACATTACCTTTCCATCTTGATACAATGCTAACAAAATGTTCCTTGTTTTTGAGTGGTACTGTTAAAGGGGAACTCCACTAAACAACATTTTGAATAATAatttcaaacaactttgcaatacacatcatttaaaaaatatgcagccttttcatgtaataatatggtttgaaacagttccctaagccccgccccctgttctggtgatctgtcggactactttgtgactcaaataaactgtaacagtagtcgactttccttagcctgccttcagcctgcatcctcccaatcccacaattccctgcacacgtgatgtcaataaggaaaggaacatcatagtgcaatgcattgtgggttatgtagttcctgcatgctgtctgtaagctggggagaggttcttcccatttgtagcatcagtgttttagtccctcctcccctgccagggtttcaaatgatgcagaaagagaagatctgttttgcagctggatttcagcatatacaaatggtatttattcataattcttgaacagattacagagatatgtataTTATGG
  5   1   0       chi Tbd1      in                        CBXT12844.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCCTTTTTTTTTGCTTTTGTCGATGGTGACTGGATGTTCTGAAGACATTTATTTTATACATTGCACTCAGGTGAGGGCAGTTTTGTTTTCTGCAGTACTCCTAATAATGACCAGCTTGCTCGGACCAAATCTCACTGAACCAAACCCTATCTTTACCAGCTGCCAGATCCCTTTCTGTGCAGTGTTTATATCATGCAGCAGTTGCAAGTCTCTTTCTGACATAGCGACATCTGCTTTTATGGCAGAGCAGAGAGTAGACTAAAAGTTGGGTCCTTTTGAATGTTACAATGTTCACTGGCTAATCTTTATTCCAGTCCTGCCTGTTGTTTACTCTTTTCATCCCATTACCTTTCCATCTTGATACAATGCTAACAAAATGTTCATTGTTGCCGAGGAAGGGCTGAGTGTTACTGTTAAAGTAACCCCAAACACAGCATTTTGAATAATAATTTAAAGCAACTTTGCAATACACATCATTTAAAAAATATGCAGCCTTTTCATGTAATGATATGGTTTGGAACAGTTCCCTAAGCCCCGCCCCCTGTTCTGCTGATCTGGCTGGCGACTTTGAGACTCAAAATGTAACAGTAGTAGACTTTCCTTAGCCTGCCTTCAGCCTGCATCCTCCCAATCCCACAATTTCCTGCACATGTAATGTCAGTAAGGAACATCACAGTGCAATGCATTGTGGGTTATGCAGTTCCTGCATGCTGTCTGTAAGCTGTGGAG
  3   1   2       bld Neu0      in                       IMAGE:6992364                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCGGGNANNNNCCTGGTCATACCACCCTATAGATTTTGGTAATTCACCTCGGGGAGTTGTTCCAGATCTATATGACAGCTGCTCGGACCAAAGCTCACTGAACCAAATTCTTTCTTTACCAGCTGCCAGATCCCTTTCTGTGCAGTGTTTATATCATGTAGAAGTTGCAAGTCTCTCTCTGAAATAAGATACAGGGATATCTGCCTNTATGGCAGAGCAGAGAGTAGAACTTTACAATGTTCACTGGCTTATCTTTATTCCAGTCCTGTCTGTTGTTTACTCTTCTTATCACATTACCTTTCCATCTTGATACAATGCTAACAAAATGTTCCTTGTTTTTGAGTGGTACTGTTAAAGGGGAACTCCACTAAACAACATTTTGAATAATAatttcaaacaactttgcaatacacatcatttaaaaaatatgcagccttttcatgtaataatatggtttgaaacagttccctaagccccgccccctgttctggtgatctgtcggactactttgtgactcaaataaactgtaacagtagtcgactttccttagcctgccttcagcctgcatcctcccaatcccacaattccctgcacacgtgatgtcaataaggaaaggaacatcatagtgcaatgcattgtgggttatgtagttcctgcatgctgtctgtaagctggggagaggttcttcccatttgtagcatcagtgttttagtccctcctcccctgccagggtttcaaatgatgcagaaagagaagatctgttttgcagctggatttcagcatatacaaatggtatttattcataattcttgaacagattacagagatatgtatattatgggtttcagtgttgtgtggggctctttTGGTTCGGAAGCCAGATGGGCTTCCGACATAAAGTCCCAGTGGTTTGTGGATTATACTTTATTTTTTTGTATATAACAACTTTAACTTACAGCGGAATACTGTCTTTCCAC
  3   1   2       bld Tbd1      in                        CBXT12844.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTAACAAAATGTTCATTGTTGCCGAGGAAGGGCTGAGTGTTACTGTTAAAGTAACCCCAAACACAGCATTTTGAATAATAATTTAAAGCAACTTTGCAATACACATCATTTAAAAAATATGCAGCCTTTTCATGTAATGATATGGTTTGGAACAGTTCCCTAAGCCCCGCCCCCTGTTCTGCTGATCTGGCTGGCGACTTTGAGACTCAAAATGTAACAGTAGTAGACTTTCCTTAGCCTGCCTTCAGCCTGCATCCTCCCAATCCCACAATTTCCTGCACATGTAATGTCAGTAAGGAACATCACAGTGCAATGCATTGTGGGTTATGCAGTTCCTGCATGCTGTCTGTAAGCTGTGGAGAAGTTGTTACAATTTGTAACATCAACGTTTCAGTCCCTCCTCCCCCGCCAGGATTTTAAATGATGCAGAAAGAGTAGAACTGTTTTGCAGTTGGATTTCAGCATATACAAATGGTATTTATTCATACTTATTGAAGGAACAAATTACAGAGATATGTATATTATGGGTTTCAGGGTTGTGTGGGGCTCTTTTGGTTCGGAAGCCAGCATTCCCCTTTAATGGGACATAAAGTCCCAGTGGTTTGTGGATTATACTTTATTTTTTTGTATATAACAACTTTAACTTACAGCGGAATACTGGTCTTTACACAACTTTATAAATAGCTTTCCAGCATTGCGATAACAAAATTAAATGTTTGGTCGAAAAAAAAAAAAAAA
  3   1   2       bld Ski1      in                         CABJ7361.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         caattccctgcacacgtgatgtcataaggaaaggaacatcatagtgcaatgcattgtgggttatgtagttcctgcatgctgtctgtaagctggggagaggttcttcccatttgtagcatcagtgttttagtccctcctcccctgccagggtttcaaatgatgcagaaagagaagatctgttttgcagctggatttcagcatatacaaatggtatttattcataattcttgaacagattacagagatatgtatattatgggtttcagtgttgtgtggggctctttTGGTTCGGAAGCCAGATGGGCTTCCGACATAAAGTCCCAGTGGTTTGTGGATTATACTTTATTTTTTTGTATATAACAACTTTAACTTACAGCGGAATACTGGTCTTTCCACAACTTTATAAATAGCTTTCCAGCCTTGCGATAACAAAATAAGGTGTTTGGTCGAGTACTCATTATAAAAAAATGTGGCAGCTCCAAGGACAAATAATCACTGATATGTTTCTAATTCTATCCACTGTATGTGGGAGATTTATCAAGATTTGAAAAGTAAATCAACATTGGTAAATACCAAAAAAACTCAGTCTGTTCAAGAGTAGTGTTTTTCTAGTAGTTTGAGCATCTTGACCTTAGATAAATCAGTATATGAAAGCTATGCTGCAGTGTAAAATAGGACAATGACAAACTGAGCTACTTGTGGGCAACTACTTGGTTCAGCTACAACAAAGACAATACTGATTATTGTCTCTACGTGTGTTTTTAGCAGAGACCATTCTTAGTAATGTCTATGGCAGGGTTTTTTTTTTATTTGGCATTTTGTAGCTGCGACAAGTAGCACCATGTGTCATAGACATAAAATGCAAATAAAATGGCTGACACAC
  3   1   2       bld Hrt1 PIPE in                         CAAQ3953.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        tgtctgtaagctggggagaggttcttcccatttgtagcatcagtgttttagtccctcctcccctgccagggtttcaaatgatgcagaaagagaagatctgttttgcagctggatttcagcatatacaaatggtatttattcataattcttgaacagattacagagatatgtatattatgggtttcagtgttgtgtggggctctttTGGTTCGGAAGCCAGATGGGCTTCCGACATAAAGTCCCAGTGGTTTGTGGATTATACTTTATTTTTTTGTATATAACAACTTTAACTTACAGCGGAATACTGGTCTTTCCACAACTTTATAAATAGCTTTCCAGCCTTGCGATAACAAAATAAGGTGTTTGGTCGAGGACTCATTATAAAAAAATGTGGCAGCTCCAAGGACAAATAATCACTGATATGTTTCTAATTCTATCCACTGTATGTGGGAGATTTATCAAGATTTGAAAAGTAAATCAACATTGGTAAATACCAAAAAAACTCAGTCTGTTCAAGAGTAGTGTTTTTCTAGTAGTTTGAGCATCTTGACCTTAGATAAATCAGTATATGAAAGCTATGCTGCAGTGTAAAATAGGACAATGACAAACTGAGCTACTTGTGGGCAACTACTTGGTTCAGCTACAACAAAGACAATACTGATTATTGTCTCTACGTGTGTTTTTAGCAGAGACCATTCTTAGTAATGTCTATGGCAGGGTTTTTTTTTTTATTTGGCATTTTGTAGCTGCGACAAGTAGCACCATGTGTCATAGACATAAAATGCAAATAAAATGGCTGACACACAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu081i10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      tgatgcagaaagagaagatctgttttgcagctggatttcagcatatacaaatggtatttattcataattcttgaacagattacagagatatgtatattatgggtttcagtgttgtgtggggctctttTGGTTCGGAAGCCAGATGGGCTTCCGACATAAAGTCCCAGTGGTTTGTGGATTATACTTTATTTTTTTGTATATAACAACTTTAACTTACAGCGGAATACTGGTCTTTCCACAACTTTATAAATAGCTTTCCAGCCTTGCGATAACAAAATAAGGTGTTTGGTCGAGTACTCATTATAAAAAAATGTGGCAGCTCCAAGGACAAATAATCACTGATATGTTTCTAATTCTATCCACTGTATGTGGGAGATTTATCAAGATTTGAAAAGTAAATCAACATTGGTAAATACCAAAAAAACTCAGTCTGTTCAAGAGTAGTGTTTTTCTAGTAGTTTGAGCATCTTGCCCTTAGATAAATCAGTATATGAAAGCTATGCTGCAGTGTAAAATAGGACAATGACAAACTGAGCTACTTGTGGGCAACTACTTGGTTCAGCTACAACAAAGACAATACTGATTATTGTCTCTACGTGTGTTTTTAGCAGAGACCATTCTTAGTAATGTCTATGGCAGGGTTTTTTTTTTATTTGGCATTTTGTAGCTGCGACAAGTAGCACCATGTGTCATAGACATAAAATGCAAATAAAATGGCTGACACACAGAAAAAACAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Sto1      in                         CABG4119.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTTTTTTTTTTTTTTTctgttttgcagctggatttcagcatatacaaatggtatttattcataattcttgaacagattacagagatatgtatattatgggtttcagtgttgtgtggggctctttTGGTTCGGAAGCCAGATGGGCTTCCGACATAAAGTCCCAGTGGTTTGTGGATTATACTTTATTTTTTTGTATATAACAACTTTAACTTACAGCGGAATACTGGTCTTTCCACAACTTTATAAATAGCTTTCCAGCCTTGCGATAACAAAATAAGGTGTTTGGTCGAGTACTCATTATAAAAAAATGTGGCGAGCTC
  3  -1   2       bld Hrt1      in                         CAAQ6055.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTTTTgttttgcagctggatttcagcatatacaaatggtatttattcataattcttgaacagattacagagatatgtatattatgggtttcagtgttgtgtggggctctttTGGTTCGGAAGCCAGATGGGCTTCCGACATAAAGTCCCAGTGGTTTGTGGATTATACTTTATTTTTTTGTATATAACAACTTTAACTTACAGCGGAATACTGGTCTTTCCACAACTTTATAAATAGCTTTCCAGCCTTGCGATAACAAAATAAGGTGTTTGGTCGAGGACTCATTATAAAAAAATGTGGCAGCTCCAAGGACAAATAATCACTGATATGTTTCTAATTCTATCCACTGTATGTGGGAGATTTATCAAGATTTGAAAAGTAAATCAACATTGGTAAATACCAAAAAAACTCAGTCTGTTCAAGAGTAGTGTTTTTCTAGTAGTTTGAG
  5  -1   2       bld Hrt1      in                         CAAQ6055.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTTTTgttttgcagctggatttcagcatatacaaatggtatttattcataattcttgaacagattacagagatatgtatattatgggtttcagtgttgtgtggggctctttTGGTTCGGAAGCCAGATGGGCTTCCGACATAAAGTCCCAGTGGTTTGTGGATTATACTTTATTTTTTTGTATATAACAACTTTAACTTACAGCGGAATACTGGTCTTTCCACAACTTTATAAATAGCTTTCCAGCCTTGCGATAACAAAATAAGGTGTTTGGTCGAGGACTCATTATAAAAAAATGTGGCAGCTCCAAGGACAAATAATCACTGATATGTTTCTAATTCTATCCACTGTATGTGGGAGATTTATCAAGATTTGAAAAGTAAATCAACATTGGTAAATACCAAAAAAACTCAGTCTGTTCAAGAGTAGTGTTTTTCTAGTAGTTTGAG
  3  -1   2       bld Sto1      in                         CABG4119.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ctgttttgcagctggatttcagcatatacaaatggtatttattcataattcttgaacagattacagagatatgtatattatgggtttcagtgttgtgtggggctctttTGGTTCGGAAGCCAGATGGGCTTCCGACATAAAGTCCCAGTGGTTTGTGGATTATACTTTATTTTTTTGTATATAACAACTTTAACTTACAGCGGAATACTGGTCTTTCCACAACTTTATAAATAGCTTTCCAGCCTTGCGATAACAAAATAAGGTGTTTGGTCGAGTACTCATTATAAAAAAATGTGGCAGCTC
  3   1   2       bld Gas7      in                         XZG25132.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TgaacagattacagagatatgtatattatgggtttcagtgttgtgtggggctctttTGGTTCGGAAGCCAGATGGGCTTCCGACATAAAGTCCCAGTGGTTTGTGGATTATACTTTATTTTTTTGTATATAACAACTTTAACTTACAGCGGAATACTGGTCTTTCCACAACTTTATAAATAGCTTTCCAGCCTTGCGATAACAAAATAAGGTGTTTGGTCGAGTACTCATTATAAAAAAATGTGGCAGCTCCAAGGACAAATAATCACTGATATGTTTCTAATTCTATCCACTGTATGTGGGAGATTTATCAAGATTTGAAAAGTAAATCAACATTGGTAAATACCAAAAAAACTCAGTCTGTTCAAGAGTAGTGTTTTTCTAGTAGTTTGAGCATCTTGACCTTAGATAAATCAGTATATGAAAGCTATGCTGCAGTGTAAAATAGGACAATGACAAACTGAGCTACTTGTGGGCAACTACTTGGTTCAGCTACAACAAAGACAATACTGATTATTGTCTCTACGTGTGTTTTTAGCAGAGACCATTCTTAGTAATGTCTATGGCAGGGTTTTTTTTTTTTATTTGGCATTTTGTAGCTGCGACAAGTAGCACCATGTGTCATAGACATAAAATGCAAATAAAATGGCTGACACACAGATATTCCTTAAAAAAAAAAAAAAAGAACAAAAAAATAAAAAAAAAAAATAAAGAAGAGTT
  5   1   2       bld Spl2      out                       CBSS3872.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGGCTCTTTTGGTTCGGAAGCCAGATGGGCTTCCGACATAAAGTCCCAGTGGTTTGTGGATTATACTTTATTTTTTTGTATATAACAACTTTAACTTACAGCGGAATACTGGTCTTTCCACAACTTTATAAATAGCTTTCCAGCCTTGCGATAACAAAATAAGGTGTTTGGTCGAGTACTCATTATAAAAAAATGTGGCAGCTCCAAGGACAAATAATCACTGATATGTTTCTAATTCTATCCACTGTATGTGGGAGATTTATCAAGATTTGAAAAGTAAATCAACATTGGTAAATACCAAAAAAACTCAGTCTGTTCAAGAGTAGTGTTTTTCTAGTAGTTTGAGCATCTTGACCTTAGATAAATCAGTATATGAAAGCTATGCTGCAGTGTAAAATAGGACAATGACAAACTGAGCTACTTGTGGGCAACTACTTGGTTCAGCTACAACAAAGACAATACTGATTATTGTCTCTACGTGTGTTTTTAGCAGAGACCATTCTTAGTAATGTCTATGGCAGGGTTTTTTTTTTATTTGGCATTTTGTAGCTGCGACAAGTAGCACCATGTGTCATAGACATAAAATGCAAATAAAATGGCTGACACACAAAAAAAAAAAAAAAGCATCAAAAANCAAAAAAAAAAAAAAAAAAANNNAA
  5   1   2       bld BrSp                             EC2BBA21CE03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGGGCTTCCGACATAAAGTCCCAGTGGTTTGTGGATTATACTTTATTTTTTTGTATATAACAACTTTAACTTACAGCGGAATACTGGTCTTTCCACAACTTTATAAATAGCTTTCCAGCCTTGCGATAACAAAATAAGGTGTTTGGTCGAGTACTCATTATAAAAAAATGTGGCAGCTCCAATGACA
  3  -1   2       bld Te1       in                         CBWN7008.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTTTTTTTTTTTTGTGGATTATACTTTATTTTTTTGTATATAACAACTTTAACTTACAGCGGAATACTGGTCTTTGCACAACTTTATAAATAGCTTTTCAGCCTTGCGATAACAAAATAAGATGTTTGGTCAAGTACTCGTAATAAAAAAATGTGGCAGCTCCAAGGACAAATAATCACTGATATGTTTCTAATTCTATCCACTGTATGTGGGAGATTTATCAAGATTTGAAAAGTAAATCAACATTGGTAAATACCAAAAAAACTCAGTCTGTTCAAGAGTAGTGTTTTTCTAGTAGTTTGAGCATCTTGACCTTAGATAAATCAGTATATGAAAGCTATGCTGCAGTGTAAAATAGGACAATGACAAACTGAGCTACTTGTGGGCAACTACTTGGTTCAGCTACAACAAAGACAATACTGATTATTGTCTCTACGTGTGTTTTTAGCAGAGACCATTCTTAGTAATGTCTATGGCAGGGTTTTTTTTTTTATTTGGCATTTTGTAGCTGCGACAAGTAGCACCATGTGTCATAGACATAAAATGCAAATAAAATGGCTGACACACAGATATTCCTTATATAGCGTGTATTTTATTGCTTCTGTAAAGGTGTTTATATTGGCGCACTGAGTATAGACTCGTATATAAATTACAAGATTTTTTGCCATCTTGAAAAGTAAATGGATAATTTTGTTTTACGTGCATTGG
  3   1   2       bld Gas7      in                         XZG63842.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCACGCGTCCGATTTTTTTGTATATAACAACTTTAACTTACAGCGGAATACTGGTCTTTCCACAACTTTATAAATAGCTTTCCAGCCTTGCGATAACAAAATAAGGTGTTTGGTCGAGTACTCATTATAAAAAAATGTGGCAGCTCCAAGGACAAATAATCACTGATATGTTTCTAATTCTATCCACTGTATGTGGGAGATTTATCAAGATTTGAAAAGTAAATCAACATTGGTAAATACCAAAAAAACTCAGTCTGTTCAAGAGTAGTGTTTTTCTAGTAGTTTGAGCATCTTGACCTTAGATAAATCAGTATATGAAAGCTATGCTGCAGTGTAAAATAGGACAATGACAAACTGAGCTACTTGTGGGCAACTACTTGGTTCAGCTACAACAAAGACAATACTGATTATTGTCTCTACGTGTGTTTTTAGCAGAGACCATTCTTAGTAATGTCTATGGCAGGGTTTTTTTTAAAAAAAAAAACCAAAAAAAAAAATGAAAAAT
  5   1   2       bld Gas7      in                         XZG63842.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTTTTTTGTATATAACAACTTTAACTTACACGCGGAATACTGGGTCTTTCCACAACTTTATAAATAGCTTTCCAGCCTTGCGATAACAAAATAAGGTGTTTGGTCGAGTACTCATTATAAAAAAATGTGGCAGCTCCAAGGACAAATAATCACTGATATGTTTCTAATTCTATCCACTGTATGTGGGAGATTTATCAAGATTTGAAAAGTAAATCAACATTGGTAAATACCAAAAAAACTCAGTCTGTTCAAGAGTAGTGTTTTTCTAGTAGTTTGAGCATCTTGACCTTAGATAAATCAGTATATGAAAGCTATGCTGCAGTGTAAAATAGGACAATGACAAACTGAGCTACTTGTGGGCAACTACTTGGTTCAGCTACAACAAAGACAATACTGATTATTGTCTCTACGTGTGTTTTTAGCAGAGACCATTCTTAGTAATGTCTATGGCAGGGTTTTTTTTaaaaaaaaaaaacaaaaaaaaaaatgaaaaataaaagaaaaaaaaaaaaaaaGG
  5  -1   2       bld Limb                                CBSU4604.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTTATAAATAGCTTTTCAGCCTTGCGATAACAAAATAAGATGTTTGGTCAAGTACTCGTAATAAAAAAATGTGGCAGCTCCAAGGACAAATAATCAGTGATATGTTTCTAATTCTATCCACTGTATGTGGGAGATTTATCAAGATTTGAAAAGTAAATCAACATTGGTAAATACCAAAAAAACTCAGTGTGTTCAAGAGTAGTGTTTTTGTAGTAGTTTGAGCATCTTGACCTTAGATAAATCTGTATATGAAAGCTATGGTGCAGTGTAAAATAGGACAATGACAAACTGAGCTACTTGTGGGCAACTACTTGGTTCAGCTACAACAAAGACAATACTGATTATTGTCTCTACGTGTGTTTTTAGCAGAGACCATTCTTAGTAATGTGTATGGCAGGGTTTTTTTTTTTATTAGGCATTTTGTAGCTGCGACAAGTAGCGCCATGTGTCATAGACATAAAATGCAAATAAAATGGCTGACACACAGATATTCCTTATATAGCGTGTATTTTATTGCTTCTGTAAAGGTGTTTATATTGGCGCACTGAGTATAGTCTCGTATATAAATTCCAAGATTTTTTGCCATCT
  5  -1   2       add Bone                               CBTC11061.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTTTTTTTTTTTTTTTTTTTTTTNTTTTCCNTATATAGCGTGTATTTTATTGCTTCTGTAAAGGTGTTTATATTGGCGCACTGAGTATAGACTCGTATATAAATTACAAGATTTTTTGCCATCTTGAAAAGTAAATGGATAATTTTGTTTTACGTGCATTGGAGATTATATCCTATCAGAACAGGGATTGATCAGAGATCTATATTGGGCAATGTATTGTCTGGAAACAAATAAGAACACAATGGTGTGACACCAACTTTCAGGTGCTTTTGATGTAGACAAAATGCATATAGAGAACAGTCAATAGGAACATGGTGGCTACAACTGAGCAAACCCAAGGCCCTCTAAAAGCAATATTGACTACGCTAGTATCATAAGGTCCAACTGTCCAGATTGTATAAGGGCATCCATATTTCTTCAAATAGCTGCTGTTATCAAGCAGATTAAAAGTCATTAAGTGATCACTGTGTCAATGGCAGCAAATGGATTCACCTAGTGCCAAAGGAGATCCACATTCTGCTGTGTTGGTGGTGCAATAAATTGGGAACTATTGGAGGAACCCAGGAAAGTTCTTGAGATCTCTACAGGAGATTAAG
  3  -1   2       bld Fat1      in                        CABC10650.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTTATATAGCGTGTATTTTATTGCTTCTGTAAAGGTGTTTATATTGGCGCACTGAGTATAGACTCGTATATAAATTACAAGATTTTTTGCCATCTTGAAAAGTAAATGGATAATTTTGTTTTACTTGCATTGGAGATTATATCCTATCAGAACAGGGATTGATCAGAGATCTATATTGGGCAATGTATTGTCTGGAAACAAATAAGAACACAATGGTGTGACACCAACTTTCAGGTGCTTTTGATGTAGATAAAATGCATAAAGAGAACAGTCAGTAGGAACATGGTGGCTACAACTGAGCAAACCCAAGACCATATAAAAGCAATATTTACTACGCTAGTATCATAAGGTCCAACTGTCCAGATTGTATAAGGGGCACCCATATTTCTTCAAATAGCTGCTGTTATCAAGCAGATTAAAAGTCATTAAGTGATCACTGTGTCAATGGCAGCAAATGGATTCACCTAGTGCCAAAGGAGATCCACATTCTGCTGTGTTGGTGGTGCAATACATTGGGAACAATTGGAGGAACCCAGGAAAGTTCTTGAGATCTCTACAGGAGATTAAGTAAGAGTACGGAAGAGTTCCATAATAAGTGTGCTTATTGAAAGTCTAATTAGACTTCATGGGCAGTCCCACTTTGGAACCCCCATGCCAGAATCCTAATGATGAATGGTTTAACCCTCTCAATGCAGGCTTGGTTGACCAATCTATGGCACACATTGCCAATAAGCATGCCATATACATCAAAGAGAAACCCGGAAATATAATCACCGTGCCAGTGGCAAGCTGGTTATTCTACATTTGCACCATATACTCAGTTGCTCGGCATGTTAAGACTTG
  3  -1   2       bld Met5      in                          CACX776.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTTATATAGCGTGTATTTTATTGCTTCTGTAAAGGTGTTTATATTGGCGCACTGAGTATAGACTCGTATATAAATTACAAGATTTTTTGCCATCTTGAAAAGTAAATGGATAATTTTGTTTTACTTGCATTGGAGATTATATCCTATCAGAACAGGGATTGATCAGAGATCTATATTGGGCAATGTATTGTCTGGAAACAAATAAGAACACAATGGTGTGACACCAACTTTCAGGTGCTTTTGATGTAGATAAAATGCATAAAGAGAACAGTCAGTAGGAACATGGTGGCTACAACTGAGCAAACCCAAGACCATATAAAAGCAATATTTACTACGCTAGTATCATAAGGTCCAACTGTCCAGATTGTAtaagggctctggcacaagggcagatcagtcgcccgcgacaaatctccctgctcgcgggcgaccaatctccccgaattgccatcccaccagcgaaaatgcaagccgccggtgggacggcacaccccgcgcaggcgactccggcaaatcggcgaagttgcctcgtgaggcattctcgatgatttgctgaaatcatgccgccgcgtgtgccatcccaccggcaacccacacccccaccggtgggacggcaacccggggagaccagtcgcccgcgaacagggagacccgccacgggcgaccaatctctccatgtgccagagccctAGGGGCACCCATATTTCTTCAAATAGCTGCTGTTATCAAGCAGA
  3  -1   2       bld Met2      in                          CUNH395.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTTATCTAGCGTGTATTTTATTGCTTCTGTAAAGGTGTTTATATTGGCGCACTGAGTATAGACTCGTATATAAATTACAAGATTTTTTGCCATCTTGAAAAGTAAATGGATAATTTTGTTTTACTTGCATTGGAGATTATATCCTATCAGAACAGGGATTGATCAGAGATCTATATTGGGCAATGTATTGTCTGGAAACAAATAAGAACACAATGGTGTGACACCAACTTTCAGGTGCTTTTGATGTAGATAAAATGCATAAAGAGAACAGTCAGTAGGAACATGGTGGCTACAACTGAGCAAACCCAAGACCATATAAAAGCAATATTTACTACGCTAGTATCATAAGGTCCAACTGTCCAGATTGTAtaagggctctggcacaagggcagatcagtcgcccgcgacaaatctccccgctcgcgggcgaccaacctccccgaattgccatcccaccagcgaaaacgcaagtcgccggtgggatggcacaccccgcggaggcgactccggcaaatcggcgaagccgcctcgtgaggcattctcgatgatttgccgaaatcatgccgccgcgtgtgccatcccaccggcaacccacacccccaccggtgggacggcaacccggggagaccagccgcccgcgaacagggagatccgccacgggcgaccaatctctccatgtgccagagccctAGGGGCACCCATATTTCTTCAAATAGCTGCTGTTATCAAGCAGATTAAAAGTCATTAAGTGATCACTGTGTCAATGGCAGCAAATGGATTCACCTAGTGCCAAAGG
  3  -1   2       add Brn3      out                        CAAK2433.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAGCGGGGATTTTATTGCTTCTGTAAAGGGGTTTATATTGGCGCACTGAGTATAGACTCGTATATAAATTACAAGATTTTTTGCCATCTTGAAAAGTAAATGGATAATTTTGTTTTACTTGCATTGGAGATTATATCCTATCAAAACAGGGATTGATCAAAGATCTATATTGGGCAATGTATTGTCTGGAAACAAATAAAAACACAATGGGGGGACACCAACTTTCAGGGGCTTTTGATGTAGATAAAATGCATAAAGAGAACAGTCAGTAGGAACATGGGGGCTACAACTGAGCAAACCCAAGACCATATAAAAGCAATATTTACTACGCTAGTATCATAAGGTCCAACTGTCCAGATTGTAtaagggctctggcacaagggcagattagtcgcccgcgacaaatctccctgttcgcgggngactaatctccctgaattgccatcccaccagcgaaaacgcaagccgccggggggatggcccaccccgcgcaggcgaCCTCGGAAAATGGG
  3  -1   2       add Te5       in                         CAAO8353.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAAAAATTACAAAATTTTTGGCCACCTGGAAAAGAAAAGGGAAAATTTGGTTTTACTGGCATGGGAAATAAAACCCAACCAAAACGGGGATTGACCAAAAATCTATTTGGGGCAAGGTATTGCCGGGAAACAAAAAAAAACACAAGGGGGGGACCCCAACTTTCAGGGGCTTTTGAGGAAAAAAAAAGGCAAAAAGAAAACAGCCAGAAGGAACAGGGGGGCTACAACGGAGCAAACCCAAGACCATATAAAAGCAATTTTTCCTACCCTAGTATCAAAAGGCCCAACTGCCCAAATTGAAAAAGGGCCCGGGCACCCAAATTTCTTCAAAAAGCGGCGGTTACCAAGCAAATTAAAAGCCATTAAGGGACCCCGGGGCCAAGGGCAGCAAAGGGATTCCCCTAGGGCCAAAGGAAACCCACATTCGGCGGGGTGGGGGGGGCAAAACATGGGAAACAATGGGAGGAACCCAGGAAAGTTCTTGAAATCCCTCCGGGAAATTAAGTAAAAGTCCTGAAAAGTCCCATAAAAAGGGGGCTTATTGAAAGTCTAATTAAACTTCAGGGGC
  3  -1   2       bld AbdN      in                       IMAGE:6998535                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAATTACAAGATTTTTTGCCATCTTGAAAAGTAAATGGATAATTTTGTTTTACTTGCATTGGAGATTATATCCTATCAGAACAGGGATTGATCAGAGATCTATATTGGGCAATGTATTGTCTGGAAACAAATAAGAACACAATGGTGTGACACCAACTTTCAGGTGCTTTTGATGTAGATAAAATGCATAAAGAGAACAGTCAGTAGGAACATGGTGGCTACAACTGAGCAAACCCAAGACCATATAAAAGCAATATTTACTACGCTAGTATCATAAGGTCCAACTGTCCAGATTGTAtaagggctctggcacaanggcagatcagtcgcccgcgacaaatctccctgcccgcgggcgaccaatctccccgaattgccatcccaccagcgaaaatgcaacccgccggttggacagtacactctgcACATGATATATAAGCAAAGTGGGTAAGGTGTCTAATATAGTGGTTACACGTGACTGATGCCATTCAGTGGCACCTGGTGTAATCGCAACGACAATTATATCAGTCAGCTTGTCGAATGATATCCGCGAGATAGATAATTTCCCCCCATGTAGCACTATCATCAACGAACGTTGCTTAATCGTCATAATTTATTAATCAAATAATTAGTTTGTCTAACAATAGTTCGTACACTCCACTATCAACAACTTAAATTATGAAAACTTTATACATCATCGTAGCTCACAATAGTATATTCCTTTC
  5  -1   2       e>2                                Xt7.1-CABH12024.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGGACGGCAACCCGGGGAGACCAGTCGCCCGCGAACAGGGAGACCCGCCACGGGCGACCAATCTCTCCATGTGCCAGAGCCCTAGGGGCACCCATATTTCTTCAAATAGCTGCTGTTATCAAGCAGATTAAAAGTCATTAAGTGATCACTGTGTCAATGGCAGCAAATGGATTCACCTAGTGCCAAAGGAGATCCACATTCTGCTGTGTTGGTGGTGCAATACATTGGGAACAATTGGAGGAACCCAGGAAAGTTCTTGAGATCTCTACAGGAGATTAAGTAAGAGTACTGAAGAGTTCCATAATAAGTGTGCTTATTGAAAGTCTAATTAGACTTCATGGGCAGTCCCACTTTGGAACCCCCATGCCAGAATCCTAATGATGAATGGTTTAACCCTCTCAATGCAGGCTTGGTTGACCAATCTATGGCACACATTGCCAATAAGCATGCCATATACATCAAAGAGAAACCCGGAAATATAATCACCGTGCCAGTGGCAAGCTGGTTATTCTACATTTGCACCATATACTCAGTTGCTCGGCATGTTAAGACTTGGTTTAGTGTTGTGTATGTAACTTTAATTGGCAGGTTTATCAACCCTATCTGGCACCAATGGAGATACAGGCACTGGTTTGGTGCAATTACCATCTGTGTACAAATGGAATGCAAATAAAGGTGAGAAGAAGGAAAAGAATAAGAGTTAAGTACGCTGATTCAAAGCAACTAGTGTGTTCCTAATTAGTTTTAACATCTAAAGACACATCACATACGGATACAACAGTCCAAGCGCCATTTTTGTAATGCACAGATAAAAACCACGACAAAAACCACTTTATTTTTTGGCACGTGCCTAGGTTTCCCTGAATCTGAGCTACACTTTGGTAGCATTTCAAACAAAGTGCCAGATCTCTTGCATCCCGCAGCCTGCAATTCAGCTGGGCCAACTGGCTCTACAAAACAGCATTATAAAAACCTAACCAGGGCAATAAAGGTCATTCAAAGTCAAACTGAAGAAGGATCCAATGCCAAGGGGGTACTTGAGCTTTGAGTGCAGTGGATTTTCACACTTTCAACCATATTGCAAAGTGTTCATTGAGTTGACTGTGCAGTAGAAGTGAAACCCAAGTATAAATGACTGTGGGCGTGGAGCCAAGTTTACTCATGTTGCCTTGAACCTATAGAACAGAACACCAAACATGCTTACCGCAATGGAATCCTGTGTACAGAGTCTAAAGTTTAGGCATGCTAGATGGTCTCGTAATGTACACAGTTTAAAGGGAGCACGCCTTGCCGTTACATGATGTTACAAGAGTTACATGATGTTTCCAAAGATGATGGAATATTTAGACATTTTACAAAATGATCCCACTGGCACCATGAGCAAAGATATAGTAAATACTCAGGGTTGCATTTCTACATTGGAAGAAACTACCTACAGAACTGATTGGTTTATTCCAGCCGATGACTGGAATTCTGATCAAAGACACATGTACACAGTAAGCTGTAATTAGAATAACATGAAGATACCAGGAGTCCGTGAAAGGGGTGACGGCAACATGCTATAGAATTGTTATAAGTGAGCGTTAGTTTCATTTATCATGGGGCTGCAGATTGCTATCGGTGTCACCTACAATGTTTATTTATTTTCCCGGTTGTTTCCATTCTAT
                                                  Xt7.1-CHK-1008232615                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACCGGTGGGACGGCAACCCGGGGAGACCAGTCGCCCGCGAACAGGGAGACCCGCCACGGGCGACCAATCTCTCCATGTGCCAGAGCCCTAGGGGCACCCATATTTCTTCAAATAGCTGCTGTTATCAAGCAGATTAAAAGTCATTAAGTGATCACTGTGTCAATGGCAGCAAATGGATTCACCTAGTGCCAAAGGAGATCCACATTCTGCTGTGTTGGTGGTGCAATACATTGGGAACAATTGGAGGAACCCAGGAAAGTTCTTGAGATCTCTACAGGAGATTAAGTAAGAGTACTGAAGAGTTCCATAATAAGTGTGCTTATTGAAAGTCTAATTAGACTTCATGGGCAGTCCCACTTTGGAACCCCCATGCCAGAATCCTAATGATGAATGGTTTAACCCTCTCAATGCAGGCTTGGTTGACCAATCTATGGCACACATTGCCAATAAGCATGCCATATACATCAAAGAGAAACCCGGAAATATAATCACCGTGCCAGTGGCAAGCTGGTTATTCTACATTTGCACCATATACTCAGTTGCTCGGCATGTTAAGACTTGGTTTAGTGTTGTGTATGTAACTTTAATTGGCAGGTTTATCAACCCTATCTGGCACCAATGGAGATACAGGCACTGGTTTGGTGCAATTACCATCTGTGTACAAATGGAATGCAAATAAAGGTGAGAAGAAGGAAAAGAATAAGAGTTAAGTACGCTGATTCAAAGCAACTAGTGTGTTCCTAATTAGTTTTAACATCTAAAGACACATCACATACGGATACAACAGTCCAAGCGCCATTTTTGTAATGCACAGATAAAAACCACGACAAAAACCACTTTATTTTTTGGCACGTGCCTAGGTTTCCCTGAATCTGAGCTACACTTTGGTAGCATTTCAAACAAAGTGCCAGATCTCTTGCATCCCGCAGCCTGCAATTCAGCTGGGCCAACTGGCTCTACAAAACAGCATTATAAAAACCTAACCAGGGCAATAAAGGTCATTCAAAGTCAAACTGAAGAAGGATCCAATGCCAAGGGGGTACTTGAGCTTTGAGTGCAGTGGATTTTCACACTTTCAACCATATTGCAAAGTGTTCATTGAGTTGACTGTGCAGTAGAAGTGAAACCCAAGTATAAATGACTGTGGGCGTGGAGCCAAGTTTACTCATGTTGCCTTGAACCTATAGAACAGAACACCAAACATGCTTACCGCAATGGAATCCTGTGTACAGAGTCTAAAGTTTAGGCATGCTAGATGGTCTCGTAATGTACACAGTTTAAAGGGAGCACGCCTTGCCGTTACATGATGTTACAAGAGTTACATGATGTTTCCAAAGATGATGGAATATTTAGACATTTTACAAAATGATCCCACTGGCACCATGAGCAAAGATATAGTAAATACTCAGGGTTGCATTTCTACATTGGAAGAAACTACCTACAGAACTGATTGGTTTATTCCAGCCGATGACTGGAATTCTGATCAAAGACACATGTACACAGTAAGCTGTAATTAGAATAACATGAAGATACCAGGAGTCCGTGAAAGGGGTGACGGCAACATGCTATAGAATTGTTATAAGTGAGCGTTAGTTTCATTTATCATGGGGCTGCAGATTGCTATCGGTGTCACCTACAATGTTTATTTATTTTCCCGGTTGTTTCCA
  5  -1   2       bld AbdN      in                       IMAGE:6998535                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTATACTACACGAAAATGCATTTCCCCTAAGACCGGGTATTGCTTATTTAAACTCGCGGGGGGGTGGGTTTAGGGTCAGTCATGGTCAGTGATCTTCATATTTGTAATCCTAAATAAGCCCGTAAGGTGGACATCACTCTCGACGTCTGTCAGAATATTTACACATCACAAGTCGCAACCGGAACCGAAGGGAGCCGCAACCCAGATAAAAGCAAGATCGTAGCACTCGCCCCAAGCAGAGGNCCAAAGACNGGCAACCCACACCCTCACCGGTGGGACggcaacccggggagaccagtcgcccgcgaacagggagacccgccacgggcgaccaatctctccatgtgccagagccctAGGGGCACCCATATTTCTTCAAATAGCTGCTGTTATCAAGCAGATTAAAAGTCATTAAGTGATCACTGTGTCAATGGCAGCAAATGGATTCACCTAGTGCCAAAGGAGATCCACATTCTGCTGTGTTGGTGGTGCAATACATTGGGAACAATTGGAGGAACCCAGGAAAGTTCTTGAGATCTCTACAGGAGATTAAGTAAGAGTACTGAAGAGTTCCATAATAAGTGTGCTTATTGAAAGTCTAATTAGACTTCATGGGCAGTCCCACTTTGGAACCCCCATGCCAGAATCCTAATGATGAATGGTTTAACCCTCTCAATGCAGGCTTGGTTGACCAATCTATGGCACACATTGCCAATAAGCATGCCATATACATCAAAG
  5  -1   2       bld Met2      in                          CUNH395.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAACTGTCCAGATTGTAtaagggctctggcacaagggcagatcagtcgcccgcgacaaatctccccgctcgcgggcgaccaacctccccgaattgccatcccaccagcgaaaacgcaagtcgccggtgggatggcacaccccgcgcaggcgactccggcaaatcggcgaagccgcctcgtgaggcattctcgatgatttgccgaaatcatgccgccgcgtgtgccatcccaccggcaacccacacccccaccggtgggacggcaacccggggagaccagccgcccgcgaacagggagatccgccacgggcgaccaatctctccatgtgccagagccctAGGGGCACCCATATTTCTTCAAATAGCTGCTGTTATCAAGCAGATTAAAAGTCATTAAGTGATCACTGTGTCAATGGCAGCAAATGGATTCACCTAGTGCCAAAGGAGATCCACATTCTGCTGTGTTGGTGGTGCAATACATTGGGAACAATTGGAGGAACCCAGGAAAGTTCTTGAGATCTCTACAGGAGATTAAGTAAGAGTACTGAAGAGTTCCATAATAAGTGTGCTTATTGAAAGTCTAATTAGACTTCATGGGCAGTCCCACTTTGGAACCCCCATGCCAGAATCCTAATGATGAATGGTTTAACCCTCTCAATGCAGGCTTGGTTGACCAATCTATGGCACACATTGCCAATAAGCATGCCATATACATCAAAGAGAAACCCGGAAATATAATCACCGTGCCAGTGGCAAGCTGGTTATTCTACATTTGCACCATATACTCAGTTGCTCGGCCGGACGCGTGGTCGACCCGGAATCCGACCG
  5  -1   2       bld AbdN                               IMAGE:7021692                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAGAGTTACCTGAAAGAGTTTCCATAAAATAGGTGGTGGTTATTGAAAAGTTTAATTTAGACTTTCATGGGCCAGTCCCCATTTTGGAACCCCCCATCCCAGATTCCTAATGATGAATGTTTTTACCCTCTCAATGCAGGCTTGGTTGACCAATCTATGGCACACATTGCCAATAAGCATGCCATATACATCAAAGAGAAACCCCGGAAATATAATCACCGTGCCAGTGGCAAGCTGGTTATTCTACATNTGCACCATATACTCAGTTGCTCGGCATGTTAAGACTTGGTTTAGTGTTGTGTATGTACTTTAATTGGCAGGTTTATCAACCCTATCTGGCACCAATGGAGATACAGGCACTGGTTTGGTGCAATTACCATCTGTGTACAAATGGAATGCAAATAAAGGTGAGAAGAAGGAAAAGAATAAGAGTTAAGTACGCTGATTCAAAGCAACTAGTGTGTTCCTAATTAGTTTTAACATCTAAAGACACATCACATACGGATACAACAGTCCAAGCGCCATTTTTGTAATGCACAGATAAAAACCACGACAAAAACCACTTTATTTTTTGGCACGTGCCTAGGTTTCCCTGAATCTGAGCTACACTTTGGTAGCATTTCAAACAAAGTGCCAGATCTCTTGCATCCCGCAGCCTGCAATTCAGCTGGGCCAACTGGCTCTACAAAACAGCATTATAAAAACCTAACCAGGGCAATAAAGGTCATTCAAAGTCAAACTGAAGAAGGATCCAATGCCAAGGGGGTACTTGAGCTTTGAGTGCAGTGGATTTTCACACTTTCAACCATATTGCAAAGTGTTCATTGAGTTGACTGTGCAGTAGAAGTGAAACCCAAGTATAAATGACTGTGGGCGTGGAGCCAAGTTTACTCATGTTGCCTTGAACCTATAGAACAGAACACCAAACATGCTTACCGCAATGGAATCCTGTGTACAGAGTCTAA
  5  -1   2       bld Fat1      in                        CABC10650.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATTAGTAAAGAGTACGGAAGAGTTCCATAATAAGTGTGCTTATTGAAAGTCTAATTAGACTTCATGGGCAGTCCCACTTGGAACCCCCATGCCAGAATCCTAATGATGAATGGTTTAACCCTCTCAATGCAGGCTTGGTTGACCAATCTATGGCACACATTGCCAATAAGCATGCCATATACATCAAAGAGAAACCCGGAAATATAATCACCGTGCCAGTGGCAAGCTGGTTATTCTACATTTGCACCATATACTCAGTTGCTCGGCATGTTAAGACTTGGTTTAGTGTTGTGTATGTAACTTTAATTGGCAGGTTTATCAACCCTATCTGGCACCAATGGAGATACAGGCACTGGTTTGGTGCAATTACCATCTGTGTACAAATGGAATGCAAATAAAGGTGAGAAGAAGGAAAAGAATAAGAGTTAAGTACGCTGATTCAAAGCAACTAGTGTGTTCCTAATTAGTTTTAACATCTAAAGACACATCACATACGGATACAACAGTCCAAGCGCCATTTTTGTAATGCACAGATAAAAACCACGACAAAAACCACTTTATTTTTTGGCACGTGCCTAGGTTTCCCTGAATCTGAGCTACACTTTGGTAGCATTTCAAACAAAGTGCCAGATCTCTTGCATCCCGCAGCCTGCAATTCAGCTGGGCCAACTGGCTCTACAAAACAGCATTATAAAAACCTAACCAGGGCAATAAAGGTCATTCAAAGTCAAACTGAAGAAGGATCCAATGCCAAGGGGGTACTTGAGCTTTGAGTGCAGTGGATTTTCACACTTTCAACCATATTGCAAAGTGTTCATTGAGTTGACTGTGCAGTAGAAGTGAAACCCAAGTATAAATGACTGTGGGCGTGGAGCCAAG
  5  -1   2       bld Met5      in                          CACX776.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATAATAAGTGTGCTTATGNAAAGTCTAATTAGACTTCATGGGCAGTCCCACTTTGGAACCCCCATGCCAGAATCCTAATGATGAATGGTTTAACCCTCTCAATGCAGGCTTGGTTGACCAATCTATGGCACACATTGCCAATAAGCATGCCATATACATCAAAGAGAAACCCGGAAATATAATCACCGTGCCAGTGGCAAGCTGGTTATTCTACATTTGCACCATATACTCAGTTGCTCGGCATGTTAAGACTTGGTTTAGTGTTGTGTATGTAACTTTAATTGGCAGGTTTATCAACCCTATCTGGCACCAATGGAGATACAGGCACTGGTTTGGTGCAATTACCATCTGTGTACAAATGGAATGCAAATAAAGGTGAGAAGAAGGAAAAGAATAAGAGTTAAGTACGCTGATTCAAAGCAACTAGTGTGTTCCTAATTAGTTTTAACATCTAAAGACACATCACATACGGATACAACAGTCCAAGCGCCATTTTTGTAATGCACAGATAAAAACCACGACAAAAACCACTTTATTTTTTGGCACGTGCCTAGGTTTCCCTGAATCTGAGCTACACTTTGGTAGCATTTCAAACAAAGTGCCAGATCTCTTGCATCCCGCAGCCTGCAATTCAGCTGGGCCAACTGGCTCTACAAAACAGCATTATAAAAACCTAACCAGGGCAATAAAGGTCATTCAAAGTCAAACTGAAGAAGGATCCAATGCCAAGGGGGTACTTGAGCTTTGAGTGCAGTGGATTTTCACACTTTCAACCATATTGCAAAGTGTTCATTGAGTTGACTGTGCAGTAGAAGTGAAACCCAAGTATAAAT
  5  -1   2       add Te1       in                         CBWN7008.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTAATTAGTTTTAACATCTAAAGACACATCACATACGGATACAACAGTCCAAGCGCCATTTTTGTAATGCACAGATAAAAACCACGACAAAAACCACTTTATTTTTTGGCACGTGCCTAGGTTTCCCTGAATCTGAGCTACACTTTGGTAGCATTTCAAACAAAGTGCCAGATCTCTTGCATCCCACAGCCTACAATTCAGCTGGGCCAACTGGCTCTACGAAACAGCATTATAAAAACCTAACCAGGGCAATAAAGGTCATTCAAAGTCAAACTGAAGAAGGATCCAATCCCAACGGGGTACTTGAGCTTTGAATGCAGTGGATTTTCACACTTTCAACCATATTACAAAGTGTTCATTGAGTTGACTGTGCAGCAGAAGTGAAACCCAAGTATAAATGACCATGGGCGTGGAGCCAGGTTTACTCATGTTGCCTTGAACCTAAAGAGCAGCACTCGAAACATGCTTACCGCAATGGATCATGTGTACAGAGTCTAAAGTTTAGGCATGCTAGATGGTCTCGTAATGTACACAGTTTAAAGGGAGCACGCCTTGCCATTTCAAAAGAGTTACATGATGTTTCCAACGATGATGGAATATTTAGACATTTTACAAAATGATCCCACTGGCACCATGAGCAAAGATATAGTAAATACTCAGGGTTGCATTTCTACATTGGAAGAAACTACCTACAGAACTGATTGGTTTATTCCAGCGCGATGACTGGAATTCTGAT
  3  -1   2       add Bone      out                       CBTC4680.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTAATGCACAGATAAAAACCACGACAAAAACCACTTTATTTTTTGGCACGTGCCTAGGTTTCCCTGAATCTGAGCTACACTTTGGTAGCATTTCAAACAAAGTGCCAGATCTCTTGCATCCCACAGCCTACAATTCAGCTGGGCCAACTGGCTCTACGAAACAGCATTATAAAAACCTAACCAGGGCAATAAAGGTCATTCAAAGTCAAACTGAAGAAGGATCCAATCCCAACGGGGTACTTGAGCTTTGAATGCAGTGGATTTTCACACTTTCAACCATATTACAAAGTGTTCATTGAGTTGACTGTGCAGCAGAAGTGAAACCCAAGTATAAATGACCATGGGCGTGGAGCCAGGTTTACTCATGTTGCCTTGAACCTAAAGAGCAGCACTCGAAACATGCTTACCGCAATGGATCATGTGTACAGAGTCTAAAGTTTAGGCATGCTAGATGGTCTCGTAATGTACACAGTTTAAAGGGAGCACGCCTTGCCATTTCAAAAGAGTTACATGATGTTTCCAACGATGATGGAATATTTAGACATTTTACAAAATGATCCCACTGGCACCATGAGCAAAGATATAGTAAATACTCAGGGTTGCATTTCTACATTGGAAGAAACTACCTACAGAACTGATTGGTTTATTCCAGCCGATGACTGGAATTCTGATCAAAGACACACGTACACAGTAAGCTGTAATTAGAAT
  5  -1   2       bld Mus1      in                         CABH7046.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTTTTTTTTTTTTTTTACGACAAAAACCACTTTATTTTTTGGCACGTGCCTAGGTTTCCCTGAATCTGAGCTACACTTTGGTAGCATTTCAAACAAAGTGCCAGATCTCTTGCATCCCGCAGCCTGCAATTCAGCTGGGCCAACTGGCTCTACAAAACAGCATTATAAAAACCTAACCAGGGCAATAAAGGTCATTCAAAGTCAAACTGAAGAAGGATCCAATGCCAAGGGGGTACTTGAGCTTTGAGTGCAGTGGATTTTCACACTTTCAACCATATTGCAAAGTGTTCATTGAGTTGACTGTGCAGTAGAAGTGAAACCCAAGTATAAATGACTGTGGGCGTGGAGCCAAGTTTACTCATGTTGCCTTGAACCTATAGAACAGAACACCAAACATGCTTACCGCAATGGAATCCTGTGTACAGAGTCTAAAGTTTAGGCATGCTAGATGGTCTCGTAATGTACACAGTTTAAAGGGACACGCCTTGCCGTTACATGATGTTACAAGAGTTACATGATGTTTCCAAAGATGATGGAATATTTAGACATTTTACAAAATGATCCCACTGGCACCATGAGCAAAGATATAGTAAATACTCAGGGTTG
  3  -1   2       bld Hrt1      in                         CAAQ6898.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAAAAACCACGACAAAAACCACTTTATTTTTTGGCACGTGCCTAGGTTTCCCTGAATCTGAGCTACACTTTGGTAGCATTTCAAACAAAGTGCCAGATCTCTTGCATCCCGCAGCCTGCAATTCAGCTGGGCCAACTGGCTCTACAAAACAGCATTATAAAAACCTAACCAGGGCAATAAAGGTCATTCAAAGTCAAACTGAAGAAGGATCCAATGCCAAGGGGGTACTTGAGCTTTGAGTGCAGTGGATTTTCACACTTTCAACCATATTGCAAAGTGTTCATTGAGTTGACTGTGCAGTAGAAGTGAAACCCAAGTATAAATGACTGTGGGCGTGGAGCCAAGTTTACTCATGTTGCCTTGAACCTATAGAACAGAACACCAAACATGCTTACCGCAATGGAATCCTGTGTACAGAGTCTAAAGTTTAGGCATGCTAGATGGTCTCGTAATGTACACAGTTTAAAGGGAGCACGCCTTGCCGTTACATGATGTTACAAGAGTTACATGATGTTTCCAAAGATGATGGAATATTTAGACATTTTACAAAATGATCCCACTGGCACCATGAGCAAAGATATAGTAAATACTCAGGGTTGCATTTCTACATTGGAAGAAACTACCTACAGAACTGATTGGTTTATTCCAGCCGATGACTGGAATTCTGATCANAGACACATGTACACAGTAAGCTGTAATTAGAATAACATGAAGATACCAGGAGTCCGTGAAAGGGGTGACGGCAACATGCTATAGAAATTGTATAAGTGAGCGTTAGTTTCATTTATCATGGGGCTGCAGATTGCTATCGNTGTCACCTA
  3  -1   2       bld Mus1                                CABH12024.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTCACGACAAAAACCACTTTATTTTTTGGCACGTGCCTAGGTTTCCCTGAATCTGAGCTACACTTTGGTAGCATTTCAAACAAAGTGCCAGATCTCTTGCATCCCGCAGCCTGCAATTCAGCTGGGCCAACTGGCTCTACAAAACAGCATTATAAAAACCTAACCAGGGCAATAAAGGTCATTCAAAGTCAAACTGAAGAAGGATCCAATGCCAAGGGGGTACTTGAGCTTTGAGTGCAGTGGATTTTCACACTTTCAACCATATTGCAAAGTGTTCATTGAGTTGACTGTGCAGTAGAAGTGAAACCCAAGTATAAATGACTGTGGGCGTGGAGCCAAGTTTACTCATGTTGCCTTGAACCTATAGAACAGAACACCAAACATGCTTACCGCAATGGAATCCTGTGTACAGAGTCTAAAGTTTAGGCATGCTAGATGGTCTCGTAATGTACACAGTTTAAAGGGAGCACGCCTTGCCGTTACATGATGTTACAAGAGTTACATGATGTTTCCAAAGATGATGGAATATTTAGACATTTTACAAAATGATCCCACTGGCACCATGAGCAAAGATATAGTAAATACTCAGGGTTGCATTTCTACATTGGAAGAAACTACCTACAGAACTGATTGGTTTATTCCAGCCGATGACTGGAATTCTGATCAAAGACACATGTACACAGTAAGCTGTAATTAGAATAACATGAAGATACCAGGAGTCCGTGAAAGGGGTGACGGCAACATGCTATAGAATTGTTATAAGTGAGCGTTAGTTTCATTTATCATGGGGCTGCAGATTGCTATCGGTGTCACCTACAATGTTTATTTATTTTCCCGGTTGTTTCCATTCTAT
  3  -1   2       bld Brn4      out                       CAAL23617.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACGACAAAGACCACTTTATTTTTTGGCACGTGCCTAGGTTTCCCTGAATCTGAGCTACACTTTGGTAGCATTTCAAACAAAGTGCCAGATCTCTTGTATCCCGCAGCCTGCAATTCAGCTGGGCCAACTGGCTCTACAAAACAGCATTATAAAAACCTAACCAGGGCAATAAAGGTCATTCAAAGTCAAACTGAAGAAGGATCCAATGCCAAGGGGGTACTTGAGCTTTGAGTGCAGTGGATTTTCACACTTTCAACCATATTGCAAAGTGTTCATTGAGTTGACTGTGCAGTAAAAGTGAAACCCAAGTATAAATGACTGTGGGCGTGGAGCCAAGTTTACTCATGTTGCCTTGAACCTATAGAACAGAACACCAAACATGCTTACCGCAATGGAATCCTGTGTACAGAGTCTAAAGTTTAGGCATGCTAAATGGTCTCGTAATGTACACAGTTTAAAGGGAGCACGCCTTGCCGTTACATGATGTTACAAGAGTTACATGATGTTTCCAAAGATGATGGAATATTTAGACATTTTACAAAATGATCCCACTGGCACCATGAGCAAAGATATAGTAAATACTCAGGGTTGCATTTCTACATTGGAAGAAACTACCTACAGAACTGATTGGTTTATTCCAGCCGATGACTGGAATTCTGATCAAAGACACATGTACACAGTAAGCTGT
  3  -1   2      seed Hrt1      out                        CAAQ2797.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACGACAAAAACCACTTTATTTTTTGGCACGTGCCTAGGTTTCCCTGAATCTGAGCTACACTTTGGTAGCATTTCAAACAAAGTGCCAGATCTCTTGCATCCCGCAGCCTGCAATTCAGCTGGGCCAACTGGCTCTACAAAACAGCATTATAAAAACCTAACCAGGGCAATAAAGGTCATTCAAAGTCAAACTGAAGAAGGATCCAATGCCAAGGGGGTACTTGAGCTTTGAGTGCAGTGGATTTTCACACTTTCAACCATATTGCAAAGTGTTCATTGAGTTGACTGTGCAGTAGAAGTGAAACCCAAGTATAAATGACTGTGGGCGTGGAGCCAAGTTTACTCATGTTGCCTTGAACCTATAGAACAGAACACCAAACATGCTTACCGCAATGGAATCCTGTGTACAGAGTCTAAAGTTTAGGCATGCTAGATGGTCTCGTAATGTACACAGTTTAAAGGGAGCACGCCTTGCCGTTACATGATGTTACAAGAGTTACATGATGTTTCCAAAGATGATGGAATATTTAGACATTTTACAAAATGATCCCACTGGCACCATGAGCAAAGATATAGTAAATACTCAGGGTTGCATTTCTACATTGGAAGAAACTACCTACAGAACTGATTGGTTTATTCCAGCCGATGACTGGAATTCTGATCAAAGACACATGTACACAGTAAGCTGTAATTAGAATAACATGAAGATACCAGGAGTCCGTGAAAGGGGTGACGGCAACATGCTATAGAATTGTTATAAGTGAGCGTTAGTTTCATTTATCATGGGGCTGCAGATTGCTATCGGTGTCACCTACAATGTTTATTTATTTTCCCG
  3  -1   2       bld Mus1      in                         CABH7046.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACGACAAAAACCACTTTATTTTTTGGCACGTGCCTAGGTTTCCCTGAATCTGAGCTACACTTTGGTAGCATTTCAAACAAAGTGCCAGATCTCTTGCATCCCGCAGCCTGCAATTCAGCTGGGCCAACTGGCTCTACAAAACAGCATTATAAAAACCTAACCAGGGCAATAAAGGTCATTCAAAGTCAAACTGAAGAAGGATCCAATGCCAAGGGGGTACTTGAGCTTTGAGTGCAGTGGATTTTCACACTTTCAACCATATTGCAAAGTGTTCATTGAGTTGACTGTGCAGTAGAAGTGAAACCCAAGTATAAATGACTGTGGGCGTGGAGCCAAGTTTACTCATGTTGCCTTGAACCTATAGAACAGAACACCAAACATGCTTACCGCAATGGAATCCTGTGTACAGAGTCTAAAGTTTAGGCATGCTAGATGGTCTCGTAATGTACACAGTTTAAAGGGACACGCCTTGCCGTTACATGATGTTACAAGAGTTACATGATGTTTCCAAAGATGATGGAATATTTAGACATTTTACAAAATGATCCCACTGGCACCATGAGCAAAGATATAGTAAATACTCAGGGTTG
  5  -1   2       bld Te5       in                         CAAO8353.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACAAAAACCACTTTATTTTTTGGCACGTGCCTAGGTTTCCCTGAATCTGAGCTACACTTTGGTAGCATTTCAAACAAAGTGCCAGATCTCTTGTATCCCGCAGCCTGCAATTCAGCTGGGCCAACTGGCTCTACAAAACAGCATTATAAAAACCTAACCAGGGCAATAAAGGTCATTCAAAGTCAAACTGAAGAAGGATCCAATGCCAAGGGGGTACTTGAGCTTTGAGTGCAGTGGATTTTCACACTTTCAACCATATTGCAAAGTGTTCATTGAGTTGACTGTGCAGTAGAAGTGAAACCCAAGTATAAATGACTGTGGGCGTGGAGCCAAGTTTACTCATGTTGCCTTGAACCTATAGAACAGAACACCAAACATGCTTACCGCAATGGAATCCTGTGTACAGAGTCTAAAGTTTAGGCATGCTAGATGGTCTCGTAATGTACACAGTTTAAAGGGAGCACGCCTTGCCGTTACATGATGTTACAAGAGTTACATGATGTTTCCAAAGATGATGGAATATTTAGACATTTTACAAAATGATCCCACTGGCACCATGAGCAAAGATATAGTAAATACTCAGGGTTGCATTTCTACATTGGAAGAAACTACCTACAGAACTGATTGGTTTATTCCAGCCGATGACTGGAATTCTGATCAAAGACACATGTACACAGTAAGCTGTAATTAGAATAACATGAAGATACCAGGAGTCCGTGAAAGGGGTGACGGCAACATGCTATAGAATTGTTATAAGTGAGCGTTAGTTTCATTTATCATGGGGCTGCAGATTGCTATCGGTGTCACCTACAATGTTT
  5  -1   2       bld Hrt1      in                         CAAQ6898.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAAAACAGCATATAAAAACCTACCAGGGGCATAAAGGGTCATTCAAAGTCAAACTGAAGAAGGATCCAATGCCAAGGGGGTACTTGAGCTTTGAGTGCAGTGGATTTTCACACTTTCAACCATATTGCAAAGTGTTCATTGAGTTGACTGTGCAGTAGAAGTGAAACCCAAGTATAAATGACTGTGGGCGTGGAGCCAAGTTTACTCATGTTGCCTTGAACCTATAGAACAGAACACCAAACATGCTTACCGCAATGGAATCCTGTGTACAGAGTCTAAAGTTTAGGCATGCTAGATGGTCTCGTAATGTACACAGTTTAAAGGGAGCACGCCTTGCCGTTACATGATGTTACAAGAGTTACATGATGTTTCCAAAGATGATGGAATATTTAGACATTTTACAAAATGATCCCACTGGCACCATGAGCAAAGATATAGTAAATACTCAGGGTTGCATTTCTACATTGGAAGAAACTACCTACAGAACTGATTGGTTTATTCCAGCCGATGACTGGAATTCTGATCAAAGACACATGTACACAGTAAGCTGTAATTAGAATAACATGAAGATACCAGGAGTCCGTGAAAGGGGTGACGGCAACATGCTATAGAATTGTTATAAGTGAGCGTTAGTTTCATTTATCATGGGGCTGCAGATTGCTATCGGTGTCACCTACAATGTTTATTTATTTTCCCGGTTGTTTCCATTCTATGTCAACACATGGTATGAAGTATAGGGCAAATTTCACTTTGTTGGCTGGGTTCTCCACTAGACATTTTTTTGTAAGATTGCCCTGCACATCCACCCAGTGCCTTATACATTAAGTAAGGGCCACAGTATACCTCTTGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)