Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAL21046.3.5                        64 END     1           5        1                (no blast hit)
     2   2.0    0Xt7.1-CAAL7360.3                           34 END     1           5        2                neurofilament protein
     3   2.0    0Xt7.1-CAAJ17096.5                          12 END     5          26       50                Unknown (protein for MGC:121838) [Xenopus tropicalis]
     4   2.0    0Xt7.1-CAAL18189.3                          11 END     1           5        9                Unknown (protein for MGC:121838) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012155044 Xt7.1-CAAJ20045.3.5 - 19 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CAAJ20045.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAACCACAAGCAGTTACCTCATCGCCGAGTGACGTTCTCAACGTCCAATCAGGCACCTGATATTCAAGACCCATCTCAGCACAGTTACTATGACAGTGGGCTGGAGGAGTCTGAGACCCCTAGCAGCAAGTCCTCATCCGGGCCAAGAATAGGGCCATTAGCACTACCAGAGGACCATTACGAGCGTACCACCCCTGATGGTAGCATTGGTGAGATGGAGCATCCTGAAACTGATCTCAGACCACTGCCTGATGTAGCCATGACAGGAAACTGCACGCGGGAATGCACAGAATATGGACACTCAGATACATGCTGGATGCCTGGCCAGCCTTCCCCCAACCGCAGGCCCAAAAATGCCCTCAAGCTCTCCACTTTTGTGCCTTACCAAGACAAGGGGAGTCAAGAGCAAATTGGCAATGGGAACCCCAGAATTCCAGAGGAGCGCATTGGAGGCAACAACAACAGCACCACCAAAATGGCTAACATCCAGCTGTTACCGACTTACAGTGCCTTTACAAGTAACAGCCATGAATCATGTACGGACTCCCCAATGGAGGAAATCCCACTCACCCAAACCGCTGACTTCCAGCATGCCACAACTCCTTCCTCTCAATCTGCCAAGAGGGAAATATACCTGTGAGATTTATATGACCTTATATTGGCATGTATTGGACCGAAGGAGTATAGAAAAAAATTGGATGTTGCCGATTTTATCCAGGAACCTAAACCAAGCTGTCTTTTAAATGAAGGAAATTGAACAGAAAAGTGATGACAAATTAATGCTTTATGGTTCATGCAAATGCTTTTGGGGTTGAGCCTACATAACGTGTAGTGGGTTTTTCTGTTTTATTTTATTTTTGTATTTCAATGTAAAACTCCTAATCACCCTCAACATAGACAATTCAGTGTCATAAAGGTCAGAACTGGATTTTGAGAGGGGAAGCACATTTTTTAAGGAGTAGTTTTTATAAAGGGAACATGTGCATTGGGTTTCTCTGCCCAGAAGAGAAACTGGAAATGGAAGGAGGACTCAATAAGCCATTATGGTTTGGTATTTGTGATTCTGAACAGGGGGGAATGATACATTATTTTGGTGCTGTCATGTTTTCTGGTAAAGAGCAATGAAAATGCTCATTGATACGAATTCCTGTCTAGCCATAATGGCTAATTCATAATTGAAGGCTTTTGTAGCTATAGAGTCAATCCTAGAGCGGTTTGGAACCATTTTGTTCCATAAACATTTGCTCACTAGACAAAATGTCCGCCATTAACGCACTGCATGCTACAGATTTCTCCTTTTGGAAGTAACAATGAGTCTATTATGATGAGAACTGCAGAGCAACATTTATCATACATCTTCCAGCAAATACTCATTCTGAAATTCCAGGGGGTTTTATTATTTTTCTAAGACACCTTCCATATAATATATATAATGGGGACCCTACAAGCTCATGCCAACATGTAACTGGATCCCTCTATTTTTTATATTTTGTTCAACAAGGTTTTATGTTTGAAACATTGCATGCTAATTTAATTTGAGCAAACAGTAGGTATGGCAGATGGGATGGTTTGATCACTCCTTCTTGGGTCGGAAACCCTGAAAGCCAGCAAGCATAGGCACAGGCATGTTATTTGGGGTGATAATAGCAGCCCTCCTGTGACCTGCAGTGGGAAACAGCTTCCACCAAGTAGCTGATGTTTGGTTTCCGCTTCAGTAATGTTGATCAAAACTACCCATGAGCTATAGTAATTACCACTGTAAACATAAGCAGTAGCATATTGTCACATCACAAGCCATATTACGTGGCACAAAAGGTGAAAATTAATATCTCTGCCTTGAAGGGGATTCCCATCTGCTTTCAGATCAGTTGACTTAATGCCCAATTATGGACTATCTGTAAGATGGTTCAGCTCACCTAAGAGGATTCTCAGATCACTTCTTCCAGACCATTTTATAGTCCCATGTAATTTCAACATCTAGTTAATTTTTCACTTCAACAAAAAAAGTCAGTAATATTTATATATGATGCCAGTTGCATCTTCAGTTTCTGTAGCTAGACAGTAGAAAGTTTTTGGGAGAATCATTGTGGAGTAAATACCAAAGGTGCCATCTGATCATGTGGATGAATGCTTAGGACAGCCAGATGGGGACCAAACTATAACTGCATATCCAACGCATCCATAACAGGGTAAGCTGCGAGTTTGATCGGCCTTTTCATGTAGACTTCTGTAAATACAATCCCTTTGAATGATGATCAAGTCTGCCTGATTTCAGCTTTTTATTGTTGTAAGGAGCATTTGTTTATTTATTGTAGTTTCCGTTCAACTCTGCAAGTGTTCCACAGCAGCTGGGCCACTTTGGACAACTTTGGGTAGGATTGCATGGAGACAGCTGTAGATGGTGTTCATGGTTTTTGTCCGTATTTCCATTTAATTTAGTTTGTTCTT
                                                  Xt7.1-CHK-1008267458                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGCAGTTACCTCATCGCCGAGTGACGTTCTCAACGTCCAATCAGGCACCTGATATTCAAGACCCATCTCAGCACAGTTACTATGACAGTGGGCTGGAGGAGTCTGAGACCCCTAGCAGCAAGTCCTCATCCGGGCCAAGAATAGGGCCATTAGCACTACCAGAGGACCATTACGAGCGTACCACCCCTGATGGTAGCATTGGTGAGATGGAGCATCCTGAAACTGATCTCAGACCACTGCCTGATGTAGCCATGACAGGAAACTGCACGCGGGAATGCACAGAATATGGACACTCAGATACATGCTGGATGCCTGGCCAGCCTTCCCCCAACCGCAGGCCCAAAAATGCCCTCAAGCTCTCCACTTTTGTGCCTTACCAAGACAAGGGGAGTCAAGAGCAAATTGGCAATGGGAACCCCAGAATTCCAGAGGAGCGCATTGGAGGCAACAACAACAGCACCACCAAAATGGCTAACATCCAGCTGTTACCGACTTACAGTGCCTTTACAAGTAACAGCCATGAATCATGTACGGACTCCCCAATGGAGGAAATCCCACTCACCCAAACCGCTGACTTCCAGCATGCCACAACTCCTTCCTCTCAATCTGCCAAGAGGGAAATATACCTGTGAGATTTATATGACCTTATATTGGCATGTATTGGACCGAAGGAGTATAGAAAAAAATTGGATGTTGCCGATTTTATCCAGGAACCTAAACCAAGCTGTCTTTTAAATGAAGGAAATTGAACAGAAAAGTGATGACAAATTAATGCTTTATGGTTCATGCAAATGCTTTTGGGGTTGAGCCTACATAACGTGTAGTGGGTTTTTCTGTTTTATTTTATTTTTGTATTTCAATGTAAAACTCCTAATCACCCTCAACATAGACAATTCAGTGTCATAAAGGTCAGAACTGGATTTTGAGAGGGGAAGCACATTTTTTAAGGAGTAGTTTTTATAAAGGGAACATGTGCATTGGGTTTCTCTGCCCAGAAGAGAAACTGGAAATGGAAGGAGGACTCAATAAGCCATTATGGTTTGGTATTTGTGATTCTGAACAGGGGGGAATGATACATTATTTTGGTGCTGTCATGTTTTCTGGTAAAGAGCAATGAAAATGCTCATTGATACGAATTCCTGTCTAGCCATAATGGCTAATTCATAATTGAAGGCTTTTGTAGCTATAGAGTCAATCCTAGAGCGGTTTGGAACCATTTTGTTCCATAAACATTTGCTCACTAGACAAAATGTCCGCCATTAACGCACTGCATGCTACAGATTTCTCCTTTTGGAAGTAACAATGAGTCTATTATGATGAGAACTGCAGAGCAACATTTATCATACATCTTCCAGCAAATACTCATTCTGAAATTCCAGGGGGTTTTATTATTTTTCTAAGACACCTTCCATATAATATATATAATGGGGACCCTACAAGCTCATGCCAACATGTAACTGGATCCCTCTATTTTTTATATTTTGTTCAACAAGGTTTTATGTTTGAAACATTGCATGCTAATTTAATTTGAGCAAACAGTAGGTATGGCAGATGGGATGGTTTGATCACTCCTTCTTGGGTCGGAAACCCTGAAAGCCAGCAAGCATAGGCACAGGCATGTTATTTGGGGTGATAATAGCAGCCCTCCTGTGACCTGCAGTGGGAAACAGCTTCCACCAAGTAGCTGATGTTTGGTTTCCGCTTCAGTAATGTTGATCAAAACTACCCATGAGCTATAGTAATTACCACTGTAAACATAAGCAGTAGCATATTGTCACATCACAAGCCATATTACGTGGCACAAAAGGTGAAAATTAATATCTCTGCCTTGAAGGGGATTCCCATCTGCTTTCAGATCAGTTGACTTAATGCCCAATTATGGACTATCTGTAAGATGGTTCAGCTCACCTAAGAGGATTCTCAGATCACTTCTTCCAGACCATTTTATAGTCCCATGTAATTTCAACATCTAGTTAATTTTTCACTTCAACAAAAAAAGTCAGTAATATTTATATATGATGCCAGTTGCATCTTCAGTTTCTGTAGCTAGACAGTAGAAAGTTTTTGGGAGAATCATTGTGGAGTAAATACCAAAGGTGCCATCTGATCATGTGGATGAATGCTTAGGACAGCCAGATGGGGACCAAACTATAACTGCATATCCAACGCATCCATAACAGGGTAAGCTGCGAGTTTGATCGGCCTTTTCATGTAGACTTCTGTAAATACAATCCCTTTGAATGATGATCAAGTCTGCCTGATTTCAGCTTTTTATTGTTGTAAGGAGCATTTGTTTATTTATTGTAGTTTCCGTTCAACTCTGCAAGTGTTCCACAGCAGCTGGGCCACTTTGGACAACTTTGGGTAGGATTGCATGGAGACAGCTGTAGATGGTGTTCATGGTTTTTGTCCGTATTTCCATTTAATTTAGTTTGTTCTTTAAGAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     4     4     4     4     4     4     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     4     4     4     6     4     6     4     6     4     6     4     7     7     7    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12     7    12     7    12     7    12     7    12     7    12     7    12     7    12     7    12     7    12     7    11
  5   1   2      ests                                 Xt7.1-CAAK8854.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAACCACAAGCAGTTACCTCATCGCCGAGTGACGTTCTCAACGTCCAATCAGGCACCTGATATTCAAGACCCATCTCAGCACAGTTACTATGACAGTGGGCTGGAGGAGTCTGAGACCCCTAGCAGCAAGTCCTCATCCGGGCCAAGAATAGGGCCATTAGCACTACCAGAGGACCATTACGAGCGTACCACCCCTGATGGTAGCATTGGTGAGATGGAGCATCCTGAAACTGATCTCAGACCACTGCCTGATGTAGCCATGACAGGAAACTGCACGCGGGAATGCACAGAATATGGACACTCAGATACATGCTGGATGCCTGGCCAGCCTTCCCCCAACCGCAGGCCCAAAAATGCCCTCAAGCTCTCCACTTTTGTGCCTTACCAAGACAAGGGGAGTCAAGAGCAAATTGGCAATGGGAACCCCAGAATTCCAGAGGAGCGCATTGGAGGCAACAACAACAGCACCACCAAAATGGCTAACATCCAGCTGTTACCGACTTACAGTGCCTTTACAAGTAACAGCCATGAATCATGTACGGACTCCCCAATGGAGGAAATCCCACTCACCCAAACCGCTGACTTCCAGCATGCCACAACTCCTTCCTCTCAATCTGCCAAGAGGGAAATATACCTGTGAGATTTATATGACCTTATATTGGCATGTATTGGACCGAAGGAGTATAGAAAAAAATTGGATGTTGCCGATTTTATCCAGGAACCTAAACCAAGCTGTCTTTTAAATGAAGGAAATTGAACAGAAAAGTGATGACAAATTAATGCTTTATGGTTCATGCAAATGCTTTTGGGGTTGAGCCTACATAACGTGTAGTGGGTTTTTCTGTTTTATTTTATTTTTGTATTTCAATGTAAAACTCCTAATCACCCTCAACATAGACAATTCAGTGTCATAAAGGTCAGAACTGGATTTTGAGAGGGGAAGCACATTTTTTAAGGAGTAGTTTTTATAAAGGGAACATGTGCATTGGGTTTCTCTGCCCAGAAGAGAAACTGGAAATGGAAGGAGGACTCAATAAGCCATTATGGTTTGGTATTTGTGATTCTGAACAGGGGGGAATGATACATTATTTTGGTGCTGTCATGTTTTCTGGTAAAGAGCAATGAAAATGCTCATTGATACGAATTCCTGTCTAGCCATAATGGCTAATTCATAATTGAAGGCTTTTGTAGCTATAGAGTCAATCCTAGAGCGGTTTGGAACCATTTTGTTCCATAAACATTTGCTCACTAGACAAAATGTCCGCCATTAACGCACTGCATGCT
  5   1   2      ests                                Xt7.1-CAAJ20045.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACACCTTCCATATAATATATATAATGGGGACCCTACAAGCTCATGCCAACATGTAACTGGATCCCTCTATTTTTTATATTTTGTTCAACAAGGTTTTATGTTTGAAACATTGCATGCTAATTTAATTTGAGCAAACAGTAGGTATGGCAGATGGGATGGTTTGATCACTCCTTCTTGGGTCGGAAACCCTGAAAGCCAGCAAGCATAGGCACAGGCATGTTATTTGGGGTGATAATAGCAGCCCTCCTGTGACCTGCAGTGGGAAACAGCTTCCACCAAGTAGCTGATGTTTGGTTTCCGCTTCAGTAATGTTGATCAAAACTACCCATGAGCTATAGTAATTACCACTGTAAACATAAGCAGTAGCATATTGTCACATCACAAGCCATATTACGTGGCACAAAAGGTGAAAATTAATATCTCTGCCTTGAAGGGGATTCCCATCTGCTTTCAGATCAGTTGACTTAATGCCCAATTATGGACTATCTGTAAGATGGTTCAGCTCACCTAAGAGGATTCTCAGATCACTTCTTCCAGACCATTTTATAGTCCCATGTAATTTCAACATCTAGTTAATTTTTCACTTCAACAAAAAAAGTCAGTAATATTTATATATGATGCCAGTTGCATCTTCAGTTTCTGTAGCTAGACAGTAGAAAGTTTTTGGGAGAATCATTGTGGAGTAAATACCAAAGGTGCCATCTGATCATGTGGATGAATGCTTAGGACAGCCAGATGGGGACCAAACTATAACTGCATATCCAACGCATCCATAACAGGGTAAGCTGCGAGTTTGATCGGCCTTTTCATGTAGACTTCTGTAAATACAATCCCTTTGAATGATGATCAAGTCTGCCTGATTTCAGCTTTTTATTGTTGTAAGGAGCATTTGTTTATTTATTGTAGTTTCCGTTCAACTCTGCAAGTGTTCCACAGCAGCTGGGCCACTTTGGACAACTTTGGGTAGGATTGCATGGAGACAGCTGTAGATGGTGTTCATGGTTTTTGTCCGTATTTCCATTTAATTTAGTTTGTTCTTTAAG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----C------
                                                                       
                                                                       ...PREDICTED - Mm ---- 5e-011     XP_929657.1 PREDICTED: similar to Protocadherin 9 precursor isoform 3 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 6e-057     XP_420748.2 PREDICTED: similar to protocadherin 7c [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 5e-088     NP_115796.2 protocadherin 1 isoform 2 precursor; protocadherin 42; cadherin-like protein 1[Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CAAJ20045.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------TGA---------TGATGA---------------------ATG---ATG---------------------------TAG---------------------------------------------------------------------------------------------------TGA------------------TAA---------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------TGA---------------------------TAA------------------------------------------------------------------TAA------------TAG---------------------------ATG---------------------------------------ATGATG------------------------------------------------------------------------------TAA------------------------ATG------------------------ATGTAA---------------------------------------------------------ATG------TAA------------------ATG---------ATG---TGA------------------------------------------------------------------------------------------------------------------------TGA---------------------ATG------------------------TAGTAA---------TAA---TAA------------------------------------------------TGA------------------TGA------------------------------------ATG---------------------------------------------------------------------------------------------------TAG------------------------------TAA---------ATGATG---------------------------------TAG---------------------------TAA---------------------------------------------------------------------------------------TAA------------------TGA------------------------TAA------------TGAATGATG------------TGA------------------------------------------------------------------------------------------------------------------------------TAGATG------ATG---------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   2      ests                                 Xt7.1-CAAK8854.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAACCACAAGCAGTTACCTCATCGCCGAGTGACGTTCTCAACGTCCAATCAGGCACCTGATATTCAAGACCCATCTCAGCACAGTTACTATGACAGTGGGCTGGAGGAGTCTGAGACCCCTAGCAGCAAGTCCTCATCCGGGCCAAGAATAGGGCCATTAGCACTACCAGAGGACCATTACGAGCGTACCACCCCTGATGGTAGCATTGGTGAGATGGAGCATCCTGAAACTGATCTCAGACCACTGCCTGATGTAGCCATGACAGGAAACTGCACGCGGGAATGCACAGAATATGGACACTCAGATACATGCTGGATGCCTGGCCAGCCTTCCCCCAACCGCAGGCCCAAAAATGCCCTCAAGCTCTCCACTTTTGTGCCTTACCAAGACAAGGGGAGTCAAGAGCAAATTGGCAATGGGAACCCCAGAATTCCAGAGGAGCGCATTGGAGGCAACAACAACAGCACCACCAAAATGGCTAACATCCAGCTGTTACCGACTTACAGTGCCTTTACAAGTAACAGCCATGAATCATGTACGGACTCCCCAATGGAGGAAATCCCACTCACCCAAACCGCTGACTTCCAGCATGCCACAACTCCTTCCTCTCAATCTGCCAAGAGGGAAATATACCTGTGAGATTTATATGACCTTATATTGGCATGTATTGGACCGAAGGAGTATAGAAAAAAATTGGATGTTGCCGATTTTATCCAGGAACCTAAACCAAGCTGTCTTTTAAATGAAGGAAATTGAACAGAAAAGTGATGACAAATTAATGCTTTATGGTTCATGCAAATGCTTTTGGGGTTGAGCCTACATAACGTGTAGTGGGTTTTTCTGTTTTATTTTATTTTTGTATTTCAATGTAAAACTCCTAATCACCCTCAACATAGACAATTCAGTGTCATAAAGGTCAGAACTGGATTTTGAGAGGGGAAGCACATTTTTTAAGGAGTAGTTTTTATAAAGGGAACATGTGCATTGGGTTTCTCTGCCCAGAAGAGAAACTGGAAATGGAAGGAGGACTCAATAAGCCATTATGGTTTGGTATTTGTGATTCTGAACAGGGGGGAATGATACATTATTTTGGTGCTGTCATGTTTTCTGGTAAAGAGCAATGAAAATGCTCATTGATACGAATTCCTGTCTAGCCATAATGGCTAATTCATAATTGAAGGCTTTTGTAGCTATAGAGTCAATCCTAGAGCGGTTTGGAACCATTTTGTTCCATAAACATTTGCTCACTAGACAAAATGTCCGCCATTAACGCACTGCATGCT
                                                  Xt7.1-CHK-1008243468                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGCAGTTACCTCATCGCCGAGTGACGTTCTCAACGTCCAATCAGGCACCTGATATTCAAGACCCATCTCAGCACAGTTACTATGACAGTGGGCTGGAGGAGTCTGAGACCCCTAGCAGCAAGTCCTCATCCGGGCCAAGAATAGGGCCATTAGCACTACCAGAGGACCATTACGAGCGTACCACCCCTGATGGTAGCATTGGTGAGATGGAGCATCCTGAAACTGATCTCAGACCACTGCCTGATGTAGCCATGACAGGAAACTGCACGCGGGAATGCACAGAATATGGACACTCAGATACATGCTGGATGCCTGGCCAGCCTTCCCCCAACCGCAGGCCCAAAAATGCCCTCAAGCTCTCCACTTTTGTGCCTTACCAAGACAAGGGGAGTCAAGAGCAAATTGGCAATGGGAACCCCAGAATTCCAGAGGAGCGCATTGGAGGCAACAACAACAGCACCACCAAAATGGCTAACATCCAGCTGTTACCGACTTACAGTGCCTTTACAAGTAACAGCCATGAATCATGTACGGACTCCCCAATGGAGGAAATCCCACTCACCCAAACCGCTGACTTCCAGCATGCCACAACTCCTTCCTCTCAATCTGCCAAGAGGGAAATATACCTGTGAGATTTATATGACCTTATATTGGCATGTATTGGACCGAAGGAGTATAGAAAAAAATTGGATGTTGCCGATTTTATCCAGGAACCTAAACCAAGCTGTCTTTTAAATGAAGGAAATTGAACAGAAAAGTGATGACAAATTAATGCTTTATGGTTCATGCAAATGCTTTTGGGGTTGAGCCTACATAACGTGTAGTGGGTTTTTCTGTTTTATTTTATTTTTGTATTTCAATGTAAAACTCCTAATCACCCTCAACATAGACAATTCAGTGTCATAAAGGTCAGAACTGGATTTTGAGAGGGGAAGCACATTTTTTAAGGAGTAGTTTTTATAAAGGGAACATGTGCATTGGGTTTCTCTGCCCAGAAGAGAAACTGGAAATGGAAGGAGGACTCAATAAGCCATTATGGTTTGGTATTTGTGATTCTGAACAGGGGGGAATGATACATTATTTTGGTGCTGTCATGTTTTCTGGTAAAGAGCAATGAAAATGCTCATTGATACGAATTCCTGTCTAGCCATAATGGCTAATTCATAATTGAAGGCTTTTGTAGCTATAGAGTCAATCCTAGAGCGGTTTGGAACCATTTTGTTCCATAAACATTTGCTCACTAGACAAAATGTCCGCCATTAACGCACTGCATGCTACAGAT
  5   1   2      seed Brn3      in                         CAAK8854.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCCCGCGTATTCACCTTCCTTTGAATTACCCCCCAGGCAGCCCTGACTTGGGCCGTCACTATCGTTCAAACTCCCCTCTGCCATCAATTCAGCTGCAACCACAGTCCCCATCTGCCTCCAAGAAGCACCAGGTGGTGCAGGATCTTCCAGCCACTAACACTTTTGTTGGCACTGGGGACAACAATTCCACTGGCTCTGATCAGTACTCGGATTACAGCTACCGGACCAACACCCAGAAATACAACCACAAGCAGTTACCTCATCGCCGAGTGACGTTCTCAACGTCCAATCAGGCACCTGATATTCAAGACCCATCTCAGCACAGTTACTATGACAGTGGGCTGGAGGAGTCTGAGACCCCTAGCAGCAAGTCCTCATCCGGGCCAAGAATAGGGCCATTAGCACTACCAGAGGACCATTACGAGCGTACCACCCCTGATGGTAGCATTGGTGAGATGGAGCATCCTGAAACTGATCTCAGACCACTGCCTGATGTAGCCATGACAGGAAACTGCACGCGGGAATGCACAGAATATGGACACTCAGATACATCCTGGATGCCTGGCCAGCCTTCCCCCAACCGCAGGCCCAAAAATGCCCTCAAGCTCTCCACTTTTGTGCCTTACCAAGACAAGGGGAGTCAAGAGCAAATTGGCAATGGGAACCCCAGAATTCCAGAGGAGCGCATTGGAGGCAACAACAACAGCACCACCAAAATGGCTAACATCCAGCTGTTACCGACTTACAGTGCCTTTACAAGTAACAGCCATGAATCATGTACGGACTCCCCAATGGAGGAAATCCCACTCACCCAAACCGCTGACTTCCAGCATGCCACAACTCCTTCCCTCTCATCTGCCAAGAGGGAAATATACCTGTGAGATTTATATGACCTTATATTGGCATGTATTG
  5   1   2       bld Ova1      in                         CABE8365.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAACCACAAGCAGTTACCTCATCGCCGAGTGACGTTCTCAACGTCCAATCAGGCACCTGATATTCAAGACCCATCTCAGCACAGTTACTATGACAGTGGGCTGGAGGAGTCTGAGACCCCTAGCAGCAAGTCCTCATCCGGGCCAAGAATAGGGCCATTAGCACTACCAGAGGACCATTACGAGCGTACCACCCCTGATGGTAGCATTGGTGAGATGGAGCATCCTGAAACTGATCTCAGACCACTGCCTGATGTAGCCATGACAGGAAACTGCACGCGGGAATGCACAGAATATGGACACTCAGATACATGCTGGATGCCTGGCCAGCCTTCCCCCAACCGCAGGCCCAAAAATGCCCTCAAGCTCTCCACTTTTGTGCCTTACCAAGACAAGGGGAGTCAAGAGCAAATTGGCAATGGGAACCCCAGAATTCCAGAGGAGCGCATTGGAGGCAACAACAACAGCACCACCAAAATGGCTAACATCCAGCTGTTACCGACTTACAGTGCCTTTACAAGTAACAGCCATGAATCATGTACGGACTCCCCAATGGAGGAAATCCCACTCACCCAAACCGCTGACTTCCAGCATGCCACAACTCCTTCCTCTCAATCTGCCAAGAGGGAAATATACCTGTGAGATTTATATGACCTTATATTGGCATGTATTGGACCGAAGGAGTATAGAAAAAAATTGGATGTTGCCGATTTTATCCAGGAACCTAAACCAAGCTGTCTTTTAAATGAAGGAAATTGAACAGAAAAGTGATGACAAATTAATGCTTTATGGTTCATGCAAATGCTTTTGGGGTTGAGCCTACATAACGT
  3  -1   2       bld Int1      in                         CAAP8932.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGAACTGATCTCAGACCACTGCCTGATGGAGCCATGACAGGAAACTGCACGCGGGAATGCACAGAATATGGACACTCAGATACATGCTGGATGCCTGGCCAGCCTTCCCCCAACCGCAGGCCCAAAAATGCCCTCAAGCTCTCCACTTTTGTGCCTTACCAAGACAAGGGGAGTCAAGAGCAGATTGGCAATGGGAACCCCAGAATTCCAGAGGAGCGCATTGGAGGCAACAACAACAGCACCACCTAAATGGCTAACATCCAGCTGTTACCGACTTACAGTGCCTTTACAAGTAACAGCCATGAATCATGTACGGACTCCCCAATGGAGGAAATCCCACTCACCCAAACCGCTGACTTCCAGCATGCCACAACTCCTTCCTCTCAATCTGCCAAGAGGGAAATGTACCTGTGAGATTTATATGAGCTTATATTGGCCTGTATTGGACCGAAGGAGCTATAAAAAAAAATTGGATGTTGCCGATTTTATCCAGGAACCTAAACCAAGCTGTCTGTTAGATGAAGGAAATTGAACAGAAAAGTGATGACAAATTAATGCGTTATGGCTCATGCAAATGCTTTTGGGGTTGAGCCTA
  5   1   2       bld Brn4      out                        CAAL5566.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAAGAGGGAAATATACCTGTGAGATTTATATGACCTTATATTGGCATGTATTGGACCGAAGGAGTATAGAAAAAAATTGGATGTTGCCGATTTTATCCAGGAACCTAAACCAAGCTGTCTTTTAAATGAAGGAAATTGAACAGAAAAGTGATGACAAATTAATGCTTTATGGTTCATGCAAATGCTTTTGGGGTTGAGCCTACATAACGTGTAGTGGGTTTTTCTGTTTTATTTTATTTTTGTATTTCAATGTAAAACTCCTAATCACCCTCAACATAGACAATTCAGTGTCATAAAGGTCAGAACTGGATTTTGAGAGGGGAAGCACATTTTTTAAGGAGTAGTTTTTATAAAGGGAACATGTGCATTGGGTTTCTCTGCCCAGAAGAGAAACTGGAAATGGAAGGAGGACTCAATAAGCCATTATGGTTTGGTATTTGTGATTCTGAACAGGGGGGAATGATACATTATTTTGGTGCTGTCATGTTTTCTGGTAAAGAGCAATGAAAATGCTCATTGATACGAATTCCTGTCTAGCCATAATGGCTAATTCATAATTGAAGGCTTTTGTAGCTATAGAGTCAATCCTAGAGCGGTTTGGAACCATTTTGTTCCATAAACATTTGCTCACTAGACAAAATGTCCGCCATTAACGCACTGCATGCTACAGATTTCTCCTTTTGGAAGTAACAATGAGTCTATTATGATGAGAACTGCAGAGCAACATTTATCATACATCTTCCAGCAAATACTCATTTTGAAATTCCAGGGGGTTTTATTATTTTTTTAAGAC
  5   1   2       bld Gas7      in                         XZG57486.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGACCGAAGGAGNANAGAAAAAAATTGGATGTTGCCGATTTTATCCAGGAACCTAAACCAAGCTGTCTTTTAAATGAAGGAAATTGAACAGAAAAGTGATGACAAATTAATGCTTTATGGTTCATGCAAATGCTTTTGGGGTTGAGCCTACATAACGTGTAGTGGGTTTTTCTGTTTTATTTTATTTTTGTATTTCAATGTAAAACTCCTAATCACCCTCAACATAGACAATTCAGTGTCATAAAGGTCAGAACTGGTTTTTGAGAGGGGAAGCACATTTTTTAAGGAGTAGTTTTTATAAAGGGAACATGTGCATTGGGTTTCTCTGCCCAGAAGAGAAACTGGAAATGGAAGGAGGACTCAATAAGCCATTATGGTTTGGTATTTGTGATTCTGAACAGGGGGGAATGATACATTATTTTGGTGCTGTCATGTTTTCTGGTAAAGAGCAATGAAAATGCTCATTGATACGAATTCCTGTCTAGCCATAATGGCTAATTCATAATTGAAGGCTTTTGTAGCTATAGAGTCAATCCTAGAGCGGTTTGGAACCATTTTGTTCCATNAACATTTGCTCACTAGACAAAATGTCCGCCATTAACGCACTGCATGCTACAGAT
  5   1   2      ests                                Xt7.1-CAAJ20045.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACACCTTCCATATAATATATATAATGGGGACCCTACAAGCTCATGCCAACATGTAACTGGATCCCTCTATTTTTTATATTTTGTTCAACAAGGTTTTATGTTTGAAACATTGCATGCTAATTTAATTTGAGCAAACAGTAGGTATGGCAGATGGGATGGTTTGATCACTCCTTCTTGGGTCGGAAACCCTGAAAGCCAGCAAGCATAGGCACAGGCATGTTATTTGGGGTGATAATAGCAGCCCTCCTGTGACCTGCAGTGGGAAACAGCTTCCACCAAGTAGCTGATGTTTGGTTTCCGCTTCAGTAATGTTGATCAAAACTACCCATGAGCTATAGTAATTACCACTGTAAACATAAGCAGTAGCATATTGTCACATCACAAGCCATATTACGTGGCACAAAAGGTGAAAATTAATATCTCTGCCTTGAAGGGGATTCCCATCTGCTTTCAGATCAGTTGACTTAATGCCCAATTATGGACTATCTGTAAGATGGTTCAGCTCACCTAAGAGGATTCTCAGATCACTTCTTCCAGACCATTTTATAGTCCCATGTAATTTCAACATCTAGTTAATTTTTCACTTCAACAAAAAAAGTCAGTAATATTTATATATGATGCCAGTTGCATCTTCAGTTTCTGTAGCTAGACAGTAGAAAGTTTTTGGGAGAATCATTGTGGAGTAAATACCAAAGGTGCCATCTGATCATGTGGATGAATGCTTAGGACAGCCAGATGGGGACCAAACTATAACTGCATATCCAACGCATCCATAACAGGGTAAGCTGCGAGTTTGATCGGCCTTTTCATGTAGACTTCTGTAAATACAATCCCTTTGAATGATGATCAAGTCTGCCTGATTTCAGCTTTTTATTGTTGTAAGGAGCATTTGTTTATTTATTGTAGTTTCCGTTCAACTCTGCAAGTGTTCCACAGCAGCTGGGCCACTTTGGACAACTTTGGGTAGGATTGCATGGAGACAGCTGTAGATGGTGTTCATGGTTTTTGTCCGTATTTCCATTTAATTTAGTTTGTTCTTTAAG
                                                  Xt7.1-CHK-1008233099                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCCATATAATATATATAATGGGGACCCTACAAGCTCATGCCAACATGTAACTGGATCCCTCTATTTTTTATATTTTGTTCAACAAGGTTTTATGTTTGAAACATTGCATGCTAATTTAATTTGAGCAAACAGTAGGTATGGCAGATGGGATGGTTTGATCACTCCTTCTTGGGTCGGAAACCCTGAAAGCCAGCAAGCATAGGCACAGGCATGTTATTTGGGGTGATAATAGCAGCCCTCCTGTGACCTGCAGTGGGAAACAGCTTCCACCAAGTAGCTGATGTTTGGTTTCCGCTTCAGTAATGTTGATCAAAACTACCCATGAGCTATAGTAATTACCACTGTAAACATAAGCAGTAGCATATTGTCACATCACAAGCCATATTACGTGGCACAAAAGGTGAAAATTAATATCTCTGCCTTGAAGGGGATTCCCATCTGCTTTCAGATCAGTTGACTTAATGCCCAATTATGGACTATCTGTAAGATGGTTCAGCTCACCTAAGAGGATTCTCAGATCACTTCTTCCAGACCATTTTATAGTCCCATGTAATTTCAACATCTAGTTAATTTTTCACTTCAACAAAAAAAGTCAGTAATATTTATATATGATGCCAGTTGCATCTTCAGTTTCTGTAGCTAGACAGTAGAAAGTTTTTGGGAGAATCATTGTGGAGTAAATACCAAAGGTGCCATCTGATCATGTGGATGAATGCTTAGGACAGCCAGATGGGGACCAAACTATAACTGCATATCCAACGCATCCATAACAGGGTAAGCTGCGAGTTTGATCGGCCTTTTCATGTAGACTTCTGTAAATACAATCCCTTTGAATGATGATCAAGTCTGCCTGATTTCAGCTTTTTATTGTTGTAAGGAGCATTTGTTTATTTATTGTAGTTTCCGTTCAACTCTGCAAGTGTTCCACAGCAGCTGGGCCACTTTGGACAACTTTGGGTAGGATTGCATGGAGACAGCTGTAGATGGTGTTCATGGTTTTTGTCCGTATTTCCATTTAATTTAGTTTGTTCTTTAAGAGAGAG
  5   1   2       bld Gas       in                   TGas105f02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTGCTCACTAGACAAAATGTCCGCCATTAACGCACTGCATGCTACAGATTTTTCCTTTTGGAAGTAACAATGAGCCTATTATGATGAGAACTGCAGAGCAACATTTATCATACATCTTCCAGCAAATACTCATTCTGAAATTCCAGGGGGTTTTATTATTTTTCTAAGACACCTTCCATATAATATATATAATGGGGACCCTACAAGCTCATGCCAACATGTAACTGGATCCCTCTATTTTTTATATTTTGTTCAACAAGGTTTTATGTTTGAAACATTGCATGCTAATTTAATTTGAGCAAACAGTAGGTATGGCAGATGGGATGGTTTGATCACTCCTTCTTGGGTCGGAAACCCTGAAAGCCAGCAAGCATAGGCACAGGCATGTTATTTGGGGTGATAATAGCAGCCCTCCTGTGACCTGCAGTGGGAAACAGCTTCCACCAAGTAGCTGATGTTTGGTTTCCGCTTCAGTAATGTTGATCAAAACTACCCATGAGCTATAGTAATTACCACTGTAAACATAAGCAGTAGCATATTGTCACATCACAAGCCATATTACGTGGCACAAAAGGTGAAAATTAATATCTCTGCCTTGAAGGGGATTCCCATCTGCTT
  5  -1   2       bld Int1      in                         CAAP8932.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACACCTTCCATATAATATATATAATGGGGACCCTACAAGCTCATGCCAATATGTAACTGGATCCCTCTATTTTTTATATTNTGTTCAACAAGGTTTTATGTTTGAAACATTGCATGCTAATTTAATTTGAGCAAACAGTAGGTATGGCAGATGGGATGGTTTGATCACTCCTTCTTGGGTCGGAAACCCTGAAAGCCAGCAAGCATAGGCACAGGCATGTTATTTGGGGTGATAATAGCAGCCCTCCTGTGACCTGCAGTGGGAAACAGCTTCCACCAAGTAGCTGATGTTTGGTTTCCGCTTCAGTAATGTTGATCAAAACTACCCATGAGCTATAGTAATTACCACTGTAAACATAAGCAGTAGCATATTGTCACATCACAAGCCATATTACGTGGCACAAAAGGTGAAAATTAATATCTCTGCCTTGAAGGGGATTCCCATCTGCTTTCAGATCAGTTGACTTAATGCCCAATTATGGACTATCTGTAAGATGGTTCAGCTCACCTAAGAGGATTCTCAGATCACTTCTTCCAGACCATTTTATAGTCCCATGTAATTTCAACATCTAGTTAATTTTTCACTTCAACAAAAAAAGTCAGTAATATTTATATATGATGCCAGTTGCATCTTCAGTTTCTGTAGCTAGACAGTAGAAAGTTTTTGGGAGAATCATTGTGGAGTAAATACCAAAGGTGCCATCTGATCATGTGGATGAATGCTTAGGACAGCCAGATGGGGACCAAACTATAACTGCATATCCAACGCATCCATAACAGGGTAAGCTGCGAGTTTGACCGGCCTTTTCATGTAGACTTCTG
  3   1   2       bld Egg  5g3  ?                     TEgg019h12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGTTTGAAACATTGCATGCTAATTTAATTTGAGCAAACAGTAGGTATGGCAGATGGGATGGTTTGATCATTCCTTCTTGGGTCGGAAACCCTGAAAGCCAGCAAGCATAGGCACAGGCATGGTTATTTGGGGTGATAATAGCAGCCCTCCTGTGACCTGCAGTGGGAAACAGCTTCCACCAAGTAGCTGATGTTTGGTTTCCGCTTCAGTAATGTTGATCAAAACTACCCATGAGCTATAGTAATTACCACTGTAAACATAAGCAGTAGCATATTGTCACATCACAAGCCATATTACGTGGCACAAAAGGTGAAAATTAATATCTCTGCCTTGAAGGGGATTCCCATCTGCTTTCAGATCAGTTGACTTAATGCCCAATTATGGACTATCTGTAAGATGGTTCAGCTCACCTAAGAGGATTCTCAGATCACTTCTTCCAGACCATTTTATAGTCCCATGTAATTTCAACATCTAGTTAATTTTTCACTTCAACAAAAAAAGTCAGTAATATTTATATATGATGCCAGTTGCATCTTCAGTTTCTGTAGCTAGACAGTAGAAAGTTTTTGGGAGAATCATTGTGGAGTAAATACCAAAGGTGCCATCTGATCATGTGGATGAATGCTTAGGACAGCCAGATGGGGACCAAACTATAACTGCATATCCAACGCATCCATAACAGGGTAAGCTGCGAGTTTGACCGGCCTTTTCATGTAGACTTCTGTAAATACAATCCCTTTGAATGATGATCAAGTCTGCCTGATTTCAGCTTTTTATTGTTGTAAGGAGCATTTGTTTATTTATTGTAGTTTCCGTTCAACTCTGCAAAGTGTTCCACAGCAGCTGGGCCACTTTGGACAACTTTGGGTAGGATTGCATGGAGACAGCTGTAGATGGTGTTCATGGTTTTTGTCCGTATTTCCATTTAATTTAGT
  3   1   2       bld Gas       in                    TGas105f02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCAGCAAGCATAGGCACAGGCATGTTATTTGGGGTGATAATAGCAGCCCTCCTGTGACCTGCAGTGGGAAACAGCTTCCACCAAGTAGCTGATGTTTGGTTTCCGCTTCAGTAATGTTGATCAAAACTACCCATGAGCTATAGTAATTACCACTGTAAACATAAGCAGTAGCATATTGTCACATCACAAGCCATATTACGTGGCACAAAAGGTGAAAATTAATATCTCTGCCTTGAAGGGGATTCCCATCTGCTTTCAGATCAGTTGACTTAATGCCCAATTATGGACTATCTGTAAGATGGTTCAGCTCACCTAAGAGGATTCTCAGATCACTTCTTCCAGACCATTTTATAGTCCCATGTAATTTCAACATCTAGTTAATTTTTCACTTCAACAAAAAAAGTCAGTAATATTTATATATGATGCCAGTTGCATCTTCAGTTTCTGTAGCTAGACAGTAGAAAGTTTTTGGGAGAATCATTGTGGAGTAAATACCAAAGGTGCCATCTGATCATGTGGATGAATGCTTAGGACAGCCAGATGGGGACCAAACTATAACTGCATATCCAACGCATCCATAACAGGGTAAGCTGCGAGTTTGACCGGCCTTTTCATGTAGACTTCTGTAAATACAATCCCTTTGAATGATGATCAAGTCTGCCTGATTTCAGCTTTTTATTGTTGTAAGGAGCATTTGTTTATTTATTGTAGTTTCCGTTCAACTCTGCAAAGTGTTCCACAGCAGCTGGGCCACTTTGGACAACTTTGGGTAGGATTGCATGGAGACAGCTGTAGATGGTGTTCATGGTTTTTGTCGCGTATTTCCATTTAATTTAGTTTTTCTTAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Brn3      out                        CAAK3234.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGTGATAATAGCAGCCCTCCTGTGACCTGCAGTGGGAAACAGCTTCCACCAAGTAGCTGATGTTGGTTTCCGCTTCAGTAATGTTGATCAAAACTACCCATGAGCTATAGTAATTACCACTGTAAACATAAGCAGTAGCATATTGTCACATCACAAGCCATATTACGTGGCACAAAAGGTGAAAATTAATATCTCTGCCTTGAAGGGGATTCCCATCTGCTTTCAGATCAGTTGACTTAATGCCCAATTATGGACTATCTGTAAGATGGTTCAGCTCACCTAAGAGGATTCTCAGATCACTTCTTCCAGACCATTTTATAGTCCCATGTAATTTCAACATCTAGTTAATTTTTCACTTCAACAAAAAAAGTCAGTAATATTTATATATGATGCCAGTTGCATCTTCAGTTTCTGTAGCTAGACAGTAGAAAGTTTTTGGGAGAATCATTGTGGAGTAAATACCAAAGGTGCCATCTGATCATGTGGATGAATGCTTAGGACAGCCAGATGGGGACCAAACTATAACTGCATATCCAACGCATCCATAACAGGGTAAGCTGCGAGTTTGACCGGCCTTTTCATGTAGACTTCTGTAAATACAATCCCTTTGAATGATGATCAAGTCTGCCTGATTTCAGCTTTTTATTGTTGTAAGGAGCATTTGTTTATTTATTGTAGTTTCCGTTCAACTCTGCAAAGTGTTCCACAGCAGCTGGGCCACTTTGGACAACTTTGGGTAGGATTGCATGGAGACAGCTGTAGATGGTGTTCATGGTTTTTGTCCGTATTTCCATTTAATTTAGTTTGTTCTTTAAGAGAG
  3   1   2       bld Brn3      in                         CAAK8854.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATAATAGCAGCCCTCCTGTGACCTGCAGTGGGAAACAGCTTCCACCAAGTAGCTGATGTTTGGTTCCGCTTCAGTAATGTTGATCAAAACTACCCATGAGCTATAGTAATTACCACTGTAAACATAAGCAGTAGCATATTGTCACATCACAAGCCATATTACGTGGCACAAAAGGTGAAAATTAATATCTCTGCCTTGAAGGGGATTCCCATCTGCTTTCAGATCAGTTGACTTAATGCCCAATTATGGACTATCTGTAAGATGGTTCAGCTCACCTAAGAGGATTCTCAGATCACTTCTTCCAGACCATTTTATAGTCCCATGTAATTTCAACATCTAGTTAATTTTTCACTTCAACAAAAAAAGTCAGTAATATTTATATATGATGCCAGTTGCATCTTCAGTTTCTGTAGCTAGACAGTAGAAAGTTTTTGGGAGAATCATTGTGGAGTAAATACCAAAGGTGCCATCTGATCATGTGGATGAATGCTTAGGACAGCCAGATGGGGACCAAACTATAACTGCATATCCAACGCATCCATAACAGGGTAAGCTGCGAGTTTGACCGGCCTTTTCATGTAGACTTCTGTAAATACAATCCCTTTGAATGATGATCAAGTCTGCCTGATTTCAGCTTTTTATTGTTGTAAGGAGCATTTGTTTATTTATTGTAGTTTCCGTTCAACTCTGCAAAGTGTTCCACAGCAGCTGGGCCACTTTGGACAACTTTGGGTAGGATTGCATGGAGACAGCTGTAGATGGTGTTCATGGTTTTTGTCCGTATTTCCATTTAATTTAGTTTGTTCTTTAAGAG
  3   1   2       bld Brn2 5g3  out                       CAAJ20045.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGTAGCTGATGTTTGTTTCCGCTTCAGTAATGTTGATCAAAACTACCCATGAGCTATAGTAATTACCACTGTTAACATAAGCAGTGGCATATTGTCACATCACAAGCCATATTACGTGGCACAAAAGGTGAAAATTAATATCTCTGCCTTGAAGGGGATTCCCATCTGCTTTCAGATCAGTTGACTTAATGCCCAATTATGGACTATCTGTAAGATGGTTCAGCTCACCTAAGAGGATTCTCAGATCACTTCTTCCAGACCATTTTATAGTCCCATGTAATTTCAACATCTAGTTAATTTTTCACTTCAACAAAAAAAGTCAGTAATATTTATATATGATGCCAGTTGCATCTTCAGTTTCTGTAGCTAGACAGTAGAAAGTTTTTGGGAGAATCATTGTGGAGTAAATACCAAAGGTGCCATCTGATCATGTGGATGAATGCTTAGGACAGCCAGATGGGGACCAAACTATAACTGCATATCCAACGCATCCATAACAGGGTAAGCTGCGAGTTTGATCGGCCTTTTCATGTAGACTTCTGTAAATACAATCCCTTTGAATGATGATCAAGTCTGCCTGATTTCAGCTTTTTATTGTTGTAAGGAGCATTTGTTTATTTACTGTAGTTTCCGTTCAACTCTGCAAGTGTTCCACAGCAGCTGGGCCACTTTGGACAACTTTGGGTAGGATTGCATGGAGACAGCTGTAGATGGTGTTCATGGTTTTTGTCCGTATTTCCATTTAATTTAGTTTGTTCTTTAAGAG
  3   1   2       bld Ova1      in                         CABE8365.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGCTTCAGTAATGTTGATCAAAACTACCCATGAGCTATAGTAATTACCACTGTAAACATAAGCAGTAGCATATTGTCACATCACAAGCCATATTACGTGGCACAAAAGGTGAAAATTAATATCTCTGCCTTGAAGGGGATTCCCATCTGCTTTCAGATCAGTTGACTTAATGCCCAATTATGGACTATCTGTAAGATGGTTCAGCTCACCTAAGAGGATTCTCAGATCACTTCTTCCAGACCATTTTATAGTCCCATGTAATTTCAACATCTAGTTAATTTTTCACTTCAACAAAAAAAGTCAGTAATATTTATATATGATGCCAGTTGCATCTTCAGTTTCTGTAGCTAGACAGTAGAAAGTTTTTGGGAGAATCATTGTGGAGTAAATACCAAAGGTGCCATCTGATCATGTGGATGAATGCTTAGGACAGCCAGATGGGGACCAAACTATAACTGCATATCCAACGCATCCATAACAGGGTAAGCTGCGAGTTTGACCGGCCTTTTCATGTAGACTTCTGTAAATACAATCCCTTTGAATGATGATCAAGTCTGCCTGATTTCAGCTTTTTATTGTTGTAAGGAGCATTTGTTTATTTATTGTAGTTTCCGTTCAACTCTGCAAAGTGTTCCACAGCAGCTGGGCCACTTTGGACAACTTTGGGTAGGATTGCATGGAGACAGCTGTAGATGGTGTTCATGGTTTTTGTCCGTATTTCCATTTAATTTAGTTTGTTCTTTAAG
  3   1   2      seed Brn2 5g3  out                       CAAJ11809.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTTCAGTAATGTTGATCAAAACTACCCATGAGCTATAGTAATTACCACTGTTAACATAAGCAGTGGCATATTGTCACATCACAAGCCATATTACGTGGCACAAAAGGTGAAAATTAATATCTCTGCCTTGAAGGGGATTCCCATCTGCTTTCAGATCAGTTGACTTAATGCCCAATTATGGACTATCTGTAAGATGGTTCAGCTCACCTAAGAGGATTCTCAGATCACTTCTTCCAGACCATTTTATAGTCCCATGTAATTTCAACATCTAGTTAATTTTTCACTTCAACAAAAAAAGTCAGTAATATTTATATATGATGCCAGTTGCATCTTCAGTTTCTGTAGCTAGACAGTAGAAAGTTTTTGGGAGAATCATTGTGGAGTAAATACCAAAGGTGCCATCTGATCATGTGGATGAATGCTTAGGACAGCCAGATGGGGACCAAACTATAACTGCATATCCAACGCATCCATAACAGGGTAAGCTGCGAGTTTGATCGGCCTTTTCATGTAGACTTCTGTAAATACAATCCCTTTGAATGATGATCAAGTCTGCCTGATTTCAGCTTTTTATTGTTGTAAGGAGCATTTGTTTATTTACTGTAGTTTCCGTTCAACTCTGCAAGTGTTCCACAGCAGCTGGGCCACTTTGGACAACTTTGGGTAGGATTGCATGGAGACAGCTGTAGATGGTGTTCATGGTTTTTGTCCGTATTTCCATTTAATTTAGTTTGTTCTTTAAGAGAGAG
  3   1   2       bld Brn3 5g3  out                        CAAK1404.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTTCAGTAATGTTGATCAAAACTACCCATGAGCTATAGTAATTACCACTGTTAACATAAGCAGTGGCATATTGTCACATCACAAGCCATATTACGTGGCACAAAAGGTGAAAATTAATATCTCTGCCTTGAAGGGGATTCCCATCTGCTTTCAGATCAGTTGACTTAATGCCCAATTATGGACTATCTGTAAGATGGTTCAGCTCACCTAAGAGGATTCTCAGATCACTTCTTCCAGACCATTTTATAGTCCCATGTAATTTCAACATCTAGTTAATTTTTCACTTCAACAAAAAAAGTCAGTAATATTTATATATGATGCCAGTTGCATCTTCAGTTTCTGTAGCTAGACAGTAGAAAGTTTTTGGGAGAATCATTGTGGAGTAAATACCAAAGGTGCCATCTGATCATGTGGATGAATGCTTAGGACAGCCAGATGGGGACCAAACTATAACTGCATATCCAACGCATCCATAACAGGGTAAGCTGCGAGTTTGATCGGCCTTTTCATGTAGACTTCTGTAAATACAATCCCTTTGAATGATGATCAAGTCTGCCTGATTTCAGCTTTTTATTGTTGTAAGGAGCATTTGTTTATTTACTGTAGTTTCCGTTCAACTCTGCAAGTGTTCCACAGCAGCTGGGCCACTTTGGACAACTTTGGGTAGGATTGCATGGAGACAGCTGTAGATGGTGTTCATGGTTTTTGTCCGTATTTCCATTTAATTTAGTTTGTTCTTTAAGAGAGAG
  3   1   2       bld Gas7      in                         XZG57486.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCTTCAGTAATGTTGATCAAAACTACNCATGAGCTATAGTAATTACCACTGTTAACATAAGCAGTGGCATATTGTCACATCACAAGCCATATTACGTGGCACAAAAGGTGAAAATTAATATCTCTGCCTTGAAGGGGATTCCCATCTGCTTTCAGATCAGTTGACTTAATGCCCAATTATGGACTATCTGTAAGATGGTTCAGCTCACCTAAGAGGATTCTCAGATCACTTCTTCCAGACCATTTTATAGTCCCATGTAATTTCAACATCTAGTTAATTTTTCACTTCAACAAAAAAGTCAGTAATATTTATATATGATGCCAGTTGCATCTTCAGTTTCTGTAGCTAGACAGTAGAAAGTTTTTGGGAGAATCATTGTGGAGTAAATACCAAAGGTGCCATCTGATCATGTGGATGAATGCTTAGGACAGCCAGATGGGGACCAAACTATAACTGCATATCCAACGCATCCATAACAGGGTAAGCTGCGAGTTTGATCGGCCTTTTCATGTAGACTTCTGTAAATACAATCCCTTTGAATGATGATCAAGTCTGCCTGATTTCAGCTTTTTATTGTTGTAAGGAGCATTTGTTTATTTATTGTAGTTTCCGTTCAACTCTGCAAGTGTTCCACAGCAGCTGGGCCACTTTGGACAACTTTGGGTAGGATTGCATGGAGACAGCTGTAGATGGTGTTCATGGTTTTTGTCCGTATTTCCATTTAATTTAGTTTGTTCTTTAAGAG
  3   1   2       bld Tad5 FL   out                        XZT64178.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTTCAGTAATGTTGATCAAAACTACCCATGAGCTATAGTAATTACCACTGTTAACATAAGCAGTGGCATATTGTCACATCACAAGCCATATTACGTGGCACAAAAGGTGAAAATTAATATCTCTGCCTTGAAGGGGATTCCCATCTGCTTTCAGATCAGTTGACTTAATGCCCAATTATGGACTATCTGTAAGATGGTTCAGCTCACCTAAGAGGATTCTCAGATCACTTCTTCCAGACCATTTTATAGTCCCATGTAATTTCAACATCTAGTTAATTTTTCACTTCAACAAAAAAAGTCAGTAATATTTATATATGATGCCAGTTGCATCTTCAGTTTCTGTAGCTAGACAGTAGAAAGTTTTTGGGAGAATCATTGTGGAGTAAATACCAAAGGTGCCATCTGATCATGTGGATGAATGCTTAGGACAGCCAGATGGGGACCAAACTATAACTGCATATCCAACGCATCCATAACAGGGTAAGCTGCGAGTTTGATCGGCCTTTTCATGTAGACTTCTGTAAATACAATCCCTTTGAATGATGATCAAGTCTGCCTGATTTCAGCTTTTTATTGTTGTAAGGAGCATTTGTTTATTTACTGTAGTTTCCGTTCAACTCTGCAAGTGTTCCACAGCAGCTGGGCCACTTTGGACAACTTTGGGTAGGATTGCATGGAGACAGCTGTAGATGGTGTTCATGGTTTTTGTCCGTATTTCCATTTAATTTAGTTTGTTCTTTAAGAGAGAG
  3   1   2       bld Brn2                                CAAJ24192.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGGGATTCCCATCTGTTTTCAGATCAGTTGACTTAATGCCCAATTATGGACTATCTGTAAGATGGTTCAGCTCATCTAAGAGGATTCTCAGATCACTTCTTCCAGACCATTTTATAGTCCCATGTAATTTCAACATCTAGTTAATTTTTCACTTCAACAAAAAAAGTCAGTAATATTTATATATGATGCCAGTTGCATCTTCAGTTTCTGTAGCTAGACAGTAGAAAGTTTTTGGGAGAATCATTGTGGAGTAAATACCAAAGGTGCCATCTGATCATGTGGATGAATGCTTAGGACAGCCAGATGGGGACCAAACTATAACTGCATATCCAACGCATCCATAACAGGGTAAGCTGCGAGTTTGATCGGCCTTTTCATGTAGACTTCTGTAAATACAATCCCTTTGAATGATGATCAAGTCTGCCTGATTTCAGCTTTTTATTGTTGTAAGGAGCATTTGTTTATTTACTGTAGTTTCCGTTCAACTCTGCAAGTGTTCCACAGCAGCTGGGCCACTTTGGACAACTTTGGGTAGGATTGCATGGAGACAGCTGTAGATGGTGTTCATGGTTTTTGTCCGTATTTCCATTTAATTTAGTTTGTTCTTTAAGAGAGAG
  5   1   2       bld Brn3      out                        CAAK6021.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTAAATACAATCCCTTTGAATGATGATCAAGTCTGCCTGATTTCAGCTTTTTATTGTTGTAAGGAGCATTTGTTTATTTACTGTAGTTTCCGTTCAACTCTGCAAGTGTTCCACAGCAGCTGGGCCACTTTGGACAACTTTGGGTAGGATTGCATGGAGACAGCTGTAGATGGTGTTCATGGTTTTTGTCCGTATTTCCATTTAATTTAGTTTGTTCTTTAAGAGAGAGAAAAAAAAAAAAACGCTTGAAAGCCAGAGTAGAATGTTTAAGTTCCACGTGTACTGTTTGATCAGACACAGTGCACACACAAGGGTGGGAGTAATTCTGCCCTTATTGGAAACCAACTAGATCAGTGCTGTCTCTGATTTTCCATGTCGTGGGTTTCACATGTTTGGGGGCCAGATTCTAATAAAACAGTAGTGTCATACGAAAAGGTTCTGGGCGCATAGATTTTATAGGCGGCCACATCTGGTCCCTTGGGCTGAGCCTTGAGTTCATCAGTCTTGAACTAGTTACCGTTCTTTTTAAGGATCAAGCAGCATCCACCTTAACATTTCAAGACCCATCCGCATATGTTTAAACCCAATAAAAACACCTTTTATAAGTTAACCTTTAATGCACCGTATGGAAAGGGAATCAAAAGATGCATTGCATTGCTTAGACCCACAGAAGGCTTGTATTTATAATAGAAATCAGCACCCTTTGCCTGCCAAAGTCAGGGTCCTGGATTCAACAATGGCTGATGGTAATGGGTTGCACACTCCTGCCTAACATATAACGGGAGCTTGCAAATTCTGCATTGACTTGGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)