Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.5    0Xt7.1-TNeu126f13.3                         68 END     2           5        2                kinesin-related protein [Xenopus laevis]
     2   2.0    0Xt7.1-CAAN7437.5                           21 END     3           8       14                kinesin-related protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 95%

 1012155232 Xt7.1-TEgg061h11.3.5 - 36 ESTs
                                                                       ......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TEgg061h11.3.5                                                                                                                                                                                                                                                       GAACCGCCGCCAAAAGGGACTAAGTGACAGAGACAGGGAGCGGTGTCGGTACCGATTTCTGCACTTATCGGACTCAAAATGTCCGAGGAAGACGCAGTGAAAGTGTGTGTGAGGGTCCGGCCGCTTATACAGAGAGAGCAAGGGGATCAATCCACCCTGCTATGGAAGGCTGGAAGCAACACCATTTCCCAGGTTGATGGGACAAAATCTTTCAGTTTTGATCGTGTATTTAATTCTCACGAATCAACAAGTCAAGTTTACCAAGAAATAGCAGTACCTATCATACAGTCAGCTTTGCAGGGATATAATGGCACAATATTTGCTTATGGACAGACATCTTCAGGCAAGACCTACACGATGATGGGAACACCAAATTCTTTGGGCATAATACCCCAAGCCATACAGGAAGTGTTTAAAATTATCCAGGAGATACCCAACAGAGAGTTTCTTCTAAGAGTTTCTTATATGGAAATTTACAATGAAACCGTGAAAGACCTCCTGTGTGATGACAGAAAAAAGAAGCCCTTGGAAATTCGCGAGGATATCAATAGAAACGTGTATGTTGCTGACTTAACAGAAGAACTTGTAATGGTTCCTGACCATGTAATTCAGTGGATCAAAAAGGGTGAAAAAAACAGGCATTATGGAGAGACTAAAATGAATGATCATAGTAGCCGTTCCCATACAATATTTCGAATGATTGTTGAAAGCAGAGACAGGAATGATTCTGCAAATTCAGAGAACTGCGATGGAGCTGTTATGGTATCTCACTTGAATCTGGTAGATCTTGCTGGCAGTGAAAGAGCAAGCCAAACTGGTGCTGAAGGTGTGAGACTTAAGGAAGGGTGCAACATCAACCGCAGCTTGTTTATCCTTGGCCAGGTTATTAAGAAGCTTAGCGATGGCCAGGCTGGTGGCTTTATAAACTACAGAGACAGCAAACTCACCAGAATTCTTCAAAATTCATTGGGAGGAAATGCCAAAACAGTTATCATTTGTACAATAACGCCAGTTTCTTTTGATGAAACTCTGAGTACACTTCAGTTTGCAAGTACTGCCAAACATATGAGAAATACTCCCCATGTTAATGAGGTCCTGGATGATGAAGCATTGCTAAAAAGGTACAGAAAGGAAATCCTGGAATTAAAGAAACAGTTAGAGGATTTAGAGACGTCATCTGAAATTAAAGCACAAGCCATGGCTAAAGAAGAGCATTCACAGTTATTGGCTGAAATCAAACTTCTACAGAAAGAAAGAGAGGATAGAATATGGCACTTGACAAATATTGTTGTTGCTTCATCCCAAGAATCTCAGCAAGACCAAAGGGTCAAACGAAAACGAAGAGTTACGTGGGCACCAGGAAAAATTCATAGTAGTTTACACGGTTCCAGTGTTTCTGATTTTGATATGCCATCCAGGTTACCTGGCAATTTTAGCAAGAAGGCAAAGTTCTCTGACTTGCCCGCATTTCCTGAAATTGATGACTCTGTTTGTACAGAGTTTTCTGATTTTGATGACCCAATCTCCATGATTGACAATAATGGAATAGATGCAGAATGGAATTTTGCCAGTAAAGTAACTCGTAGGGAAAAAGCATCACTTCATCAATCAATGATGGACTTTGAAGGACGGATTTCTGACAGTGTTCAGTTCCATGATTCTTCTAAAGAAATGGCTGAATGCAGAAGAGCTTCTTTTGAAAAGGAGATCACAAGCCTCCAACAGCAACTACAGTCAAAGGAGGAAGAAAAAAGACAACTTGTACAAAGCTTCGAGCTCAAGATAACAGAACTGGAAGGGCAGCTTAGGGACAGAGCTAAAAATCTAGAGATGGTTACAGACTTGCGAGAGCATTCCATTAATGCCGAAGTCCAAGTAGATTTTGAAAAGGAAGTTCTGAGAAAAGAAATGTCAGTACTTGGAGACTCTGGTTACAATGCATCAAGCAGTGGCCTACAGGATAGTTCTATTGATAGGAAACGTCTAAGCAGCTCCCACGATGAGTGCATAGAACACAAAAAAATGCTGGAACAAAAGATTGCTGATTTAGAAGAATTTATTAAAAATCTTAGCAAGAAAAGTGAGAATGATGCGCAAAAATCTCATGAGCAAGATTTCATGGAGAGTGTCCAACTGTGTGAAGCTTTAATAGCAGAAAAGGCAAATGCTTTGGAGGAACTGGCACTTATGCGAGATCAGTTTGACGGTGTTATTCTAGAGAATGAAACTCTTAAAAGGGAAATTGCAGATCTGGAACGTTCTCTCAAAGAGAATCAAGAAACCAATGAATTTGAAATACTGGAGAAGGAAACTCAAAAAGAACATGAGGCACAACTAATCCATGAGATTGGCAATTTAAAGAAATTAGTAGAGAATGCAGAGATGTACAATCAAAGTCTAGAGGAAGATCTAGACACTAAAACAAAACTTCTAAAAGAGCAGGAAATGCAGCTCGCAGAATTAAGGAAACACACAGATAACTTGCAGAAAAAAGTACGAAATTTTGATCTCTCTGTTTCCATGGGTGATAGTGAGAGACTTTGTGAAGAGGTCTTTCAACTAAAGCAGTCTCTATGTGATGCTGAAGCTGTGACTCGCGATGCTCAGAAGGAATGTGCTTTCCTTAGAAGTGAAAATCTAGAGCTGAAGGAGAAAATGGAGGACACCTCAGCCTGGTACAATCAAAAAGAAAAGGAGGCGTCTTTGTTTGAGAAGCAGCTGGAAACTGAAAAAGCAAACTACAAAAAAATGCAAACTGATTTGCAGAAAGAGTTGCAAAGTGCTTTTAATGAAATTAACTACTTGAATGGCCTAATGGCAGGCAAGGTTCCCAAAGATTTGCTTTGTCGTGTGGAGCTGGAGAAAAAAGTTTCTGAGTACTCAAAGCAGCTTGAGAAAGCACTGGAAGAAAAAAATGCTTTGGAGAATGAAGTGACTTGCTTATCAGAATACAAATCTTTGCCAAAGGAAGTTGATTTCTTAAAAGATCAGATCAGCAAGGCTTCTGATGAGATAATGTTATTAAAGCATGAAGGAGAACTTTCTTCGTCTACTATAAGCAAACAAGAGGTTATCCTGCAGGAGCAATCTGGGCAGATAGTAGAATTGACTGATAAAGTGACACAAACACAGTCAAAAGTGCAGCAAGCTGAAGAGCAGTATTTGGAGATGAAGAAAATGCATGATGATCTTTATGAAAAGTTTATCTGTACAACTGAAGAGACCACCAAAAACAAAAGAGAAGCTGAAGACCTTTTAAGGGAAATAGAGAACCTTAAAGGCACTATGGAGACACTGGAAGTCAAGCTTGCTGCCACAAAACATGAACTTGAAGAATGTCAAATGGATAAGGAGCAACTGCTTAATAAGAAAAACTTCCTTCTTCAAGCAATGCAGGCTGCATTTTCAGTTGCTTCTCTTTCAGACTCTTCACCTTCTCTCTCAGCATTAGTTGAAGAGAAGTCTCAAGACCCCATACAAACTGATGAATACCACAAATTAATATCCCTTGCTAAAGAAAGGACCAGCATTATGGTGTGTCTAGAGACTGAGAGAAACAGTCTTAAAGAACAAGTTATTGATTTGACCTCTGAAGTTCAAAGTCTTCAAGCACAAGGTATTGCAAAGTCTGATCTCCAAAAAGAAAAACAAGACTTGGAAGATAAATGGGTTAAATTAGTTTCAGAGATGGAACAACTGCAGGAACAACTAACTGAATCACAGTTATCTTTAGAGAAGATGCAGCTGGAGAATCTGGAAGTTACAGAAAAACTCCAATCACTTCAAGAAGAGATGAAAAACATT
                                                  Xt7.1-CHK-1008266675                                                                                                                                                                                                                                                             CCGCCAAAAGGGACTAAGTGACAGAGACAGGGAGCGGTGTCGGTACCGATTTCTGCACTTATCGGACTCAAAATGTCCGAGGAAGACGCAGTGAAAGTGTGTGTGAGGGTCCGGCCGCTTATACAGAGAGAGCAAGGGGATCAATCCACCCTGCTATGGAAGGCTGGAAGCAACACCATTTCCCAGGTTGATGGGACAAAATCTTTCAGTTTTGATCGTGTATTTAATTCTCACGAATCAACAAGTCAAGTTTACCAAGAAATAGCAGTACCTATCATACAGTCAGCTTTGCAGGGATATAATGGCACAATATTTGCTTATGGACAGACATCTTCAGGCAAGACCTACACGATGATGGGAACACCAAATTCTTTGGGCATAATACCCCAAGCCATACAGGAAGTGTTTAAAATTATCCAGGAGATACCCAACAGAGAGTTTCTTCTAAGAGTTTCTTATATGGAAATTTACAATGAAACCGTGAAAGACCTCCTGTGTGATGACAGAAAAAAGAAGCCCTTGGAAATTCGCGAGGATATCAATAGAAACGTGTATGTTGCTGACTTAACAGAAGAACTTGTAATGGTTCCTGACCATGTAATTCAGTGGATCAAAAAGGGTGAAAAAAACAGGCATTATGGAGAGACTAAAATGAATGATCATAGTAGCCGTTCCCATACAATATTTCGAATGATTGTTGAAAGCAGAGACAGGAATGATTCTGCAAATTCAGAGAACTGCGATGGAGCTGTTATGGTATCTCACTTGAATCTGGTAGATCTTGCTGGCAGTGAAAGAGCAAGCCAAACTGGTGCTGAAGGTGTGAGACTTAAGGAAGGGTGCAACATCAACCGCAGCTTGTTTATCCTTGGCCAGGTTATTAAGAAGCTTAGCGATGGCCAGGCTGGTGGCTTTATAAACTACAGAGACAGCAAACTCACCAGAATTCTTCAAAATTCATTGGGAGGAAATGCCAAAACAGTTATCATTTGTACAATAACGCCAGTTTCTTTTGATGAAACTCTGAGTACACTTCAGTTTGCAAGTACTGCCAAACATATGAGAAATACTCCCCATGTTAATGAGGTCCTGGATGATGAAGCATTGCTAAAAAGGTACAGAAAGGAAATCCTGGAATTAAAGAAACAGTTAGAGGATTTAGAGACGTCATCTGAAATTAAAGCACAAGCCATGGCTAAAGAAGAGCATTCACAGTTATTGGCTGAAATCAAACTTCTACAGAAAGAAAGAGAGGATAGAATATGGCACTTGACAAATATTGTTGTTGCTTCATCCCAAGAATCTCAGCAAGACCAAAGGGTCAAACGAAAACGAAGAGTTACGTGGGCACCAGGAAAAATTCATAGTAGTTTACACGGTTCCAGTGTTTCTGATTTTGATATGCCATCCAGGTTACCTGGCAATTTTAGCAAGAAGGCAAAGTTCTCTGACTTGCCCGCATTTCCTGAAATTGATGACTCTGTTTGTACAGAGTTTTCTGATTTTGATGACCCAATCTCCATGATTGACAATAATGGAATAGATGCAGAATGGAATTTTGCCAGTAAAGTAACTCGTAGGGAAAAAGCATCACTTCATCAATCAATGATGGACTTTGAAGGACGGATTTCTGACAGTGTTCAGTTCCATGATTCTTCTAAAGAAATGGCTGAATGCAGAAGAGCTTCTTTTGAAAAGGAGATCACAAGCCTCCAACAGCAACTACAGTCAAAGGAGGAAGAAAAAAGACAACTTGTACAAAGCTTCGAGCTCAAGATAACAGAACTGGAAGGGCAGCTTAGGGACAGAGCTAAAAATCTAGAGATGGTTACAGACTTGCGAGAGCATTCCATTAATGCCGAAGTCCAAGTAGATTTTGAAAAGGAAGTTCTGAGAAAAGAAATGTCAGTACTTGGAGACTCTGGTTACAATGCATCAAGCAGTGGCCTACAGGATAGTTCTATTGATAGGAAACGTCTAAGCAGCTCCCACGATGAGTGCATAGAACACAAAAAAATGCTGGAACAAAAGATTGCTGATTTAGAAGAATTTATTAAAAATCTTAGCAAGAAAAGTGAGAATGATGCGCAAAAATCTCATGAGCAAGATTTCATGGAGAGTGTCCAACTGTGTGAAGCTTTAATAGCAGAAAAGGCAAATGCTTTGGAGGAACTGGCACTTATGCGAGATCAGTTTGACGGTGTTATTCTAGAGAATGAAACTCTTAAAAGGGAAATTGCAGATCTGGAACGTTCTCTCAAAGAGAATCAAGAAACCAATGAATTTGAAATACTGGAGAAGGAAACTCAAAAAGAACATGAGGCACAACTAATCCATGAGATTGGCAATTTAAAGAAATTAGTAGAGAATGCAGAGATGTACAATCAAAGTCTAGAGGAAGATCTAGACACTAAAACAAAACTTCTAAAAGAGCAGGAAATGCAGCTCGCAGAATTAAGGAAACACACAGATAACTTGCAGAAAAAAGTACGAAATTTTGATCTCTCTGTTTCCATGGGTGATAGTGAGAGACTTTGTGAAGAGGTCTTTCAACTAAAGCAGTCTCTATGTGATGCTGAAGCTGTGACTCGCGATGCTCAGAAGGAATGTGCTTTCCTTAGAAGTGAAAATCTAGAGCTGAAGGAGAAAATGGAGGACACCTCAGCCTGGTACAATCAAAAAGAAAAGGAGGCGTCTTTGTTTGAGAAGCAGCTGGAAACTGAAAAAGCAAACTACAAAAAAATGCAAACTGATTTGCAGAAAGAGTTGCAAAGTGCTTTTAATGAAATTAACTACTTGAATGGCCTAATGGCAGGCAAGGTTCCCAAAGATTTGCTTTGTCGTGTGGAGCTGGAGAAAAAAGTTTCTGAGTACTCAAAGCAGCTTGAGAAAGCACTGGAAGAAAAAAATGCTTTGGAGAATGAAGTGACTTGCTTATCAGAATACAAATCTTTGCCAAAGGAAGTTGATTTCTTAAAAGATCAGATCAGCAAGGCTTCTGATGAGATAATGTTATTAAAGCATGAAGGAGAACTTTCTTCGTCTACTATAAGCAAACAAGAGGTTATCCTGCAGGAGCAATCTGGGCAGATAGTAGAATTGACTGATAAAGTGACACAAACACAGTCAAAAGTGCAGCAAGCTGAAGAGCAGTATTTGGAGATGAAGAAAATGCATGATGATCTTTATGAAAAGTTTATCTGTACAACTGAAGAGACCACCAAAAACAAAAGAGAAGCTGAAGACCTTTTAAGGGAAATAGAGAACCTTAAAGGCACTATGGAGACACTGGAAGTCAAGCTTGCTGCCACAAAACATGAACTTGAAGAATGTCAAATGGATAAGGAGCAACTGCTTAATAAGAAAAACTTCCTTCTTCAAGCAATGCAGGCTGCATTTTCAGTTGCTTCTCTTTCAGACTCTTCACCTTCTCTCTCAGCATTAGTTGAAGAGAAGTCTCAAGACCCCATACAAACTGATGAATACCACAAATTAATATCCCTTGCTAAAGAAAGGACCAGCATTATGGTGTGTCTAGAGACTGAGAGAAACAGTCTTAAAGAACAAGTTATTGATTTGACCTCTGAAGTTCAAAGTCTTCAAGCACAAGGTATTGCAAAGTCTGATCTCCAAAAAGAAAAACAAGACTTGGAAGATAAATGGGTTAAATTAGTTTCAGAGATGGAACAACTGCAGGAACAACTAACTGAATCACAGTTATCTTTAGAGAAGATGCAGCTGGAGAATCTGGAAGTTACAGAAAAACTCCAATCACTTCAAGAAGAGATGAAA
                                                      consensus depths                                                                                                                                                                                                                                                            2     2     2     2     3     3     6     6     6     8     6    10     8    11     9    12     9    12    10    12    10    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    10    10    10    10    10    10    10     8     8     7     7     7     7     7     7     7     7     5     5     5     5     4     5     4     4     4     4     4     4     4     4     4     4     2     2     2     2     2     2     2     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     4     4     4     4     4     4     4     4     4     4     4     4     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10     9    10     9    10     8     9     8     9     8     9     8     8     8     8     8     8     6     7     6     7     6     7     6     7     6     7     6     7     5     6     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     9     9     9     9    10    10     7    10     7     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     7     8     7     8     7     7     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     5     5     5     5     5     4     5     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2
  5   1   2      ests                                Xt7.1-CAAM14694.5                                                                                                                                                                                                                                                       GAACCGCCGCCAAAAGGGACTAAGTGACAGAGACAGGGAGCGGTGTCGGTACCGATTTCTGCACTTATCGGACTCAAAATGTCCGAGGAAGACGCAGTGAAAGTGTGTGTGAGGGTCCGGCCGCTTATACAGAGAGAGCAAGGGGATCAATCCACCCTGCTATGGAAGGCTGGAAGCAACACCATTTCCCAGGTTGATGGGACAAAATCTTTCAGTTTTGATCGTGTATTTAATTCTCACGAATCAACAAGTCAAGTTTACCAAGAAATAGCAGTACCTATCATACAGTCAGCTTTGCAGGGATATAATGGCACAATATTTGCTTATGGACAGACATCTTCAGGCAAGACCTACACGATGATGGGAACACCAAATTCTTTGGGCATAATACCCCAAGCCATACAGGAAGTGTTTAAAATTATCCAGGAGATACCCAACAGAGAGTTTCTTCTAAGAGTTTCTTATATGGAAATTTACAATGAAACCGTGAAAGACCTCCTGTGTGATGACAGAAAAAAGAAGCCCTTGGAAATTCGCGAGGATATCAATAGAAACGTGTATGTTGCTGACTTAACAGAAGAACTTGTAATGGTTCCTGACCATGTAATTCAGTGGATCAAAAAGGGTGAAAAAAACAGGCATTATGGAGAGACTAAAATGAATGATCATAGTAGCCGTTCCCATACAATATTTCGAATGATTGTTGAAAGCAGAGACAGGAATGATTCTGCAAATTCAGAGAACTGCGATGGAGCTGTTATGGTATCTCACTTGAATCTGGTAGATCTTGCTGGCAGTGAAAGAGCAAGCCAAACTGGTGCTGAAGGT
  5   1   2      ests                               Xt7.1-TEgg061h11.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAGAGACAGCAAACTCACCAGAATTCTTCAAAATTCATTGGGAGGAAATGCCAAAACAGTTATCATTTGTACAATAACGCCAGTTTCTTTTGATGAAACTCTGAGTACACTTCAGTTTGCAAGTACTGCCAAACATATGAGAAATACTCCCCATGTTAATGAGGTCCTGGATGATGAAGCATTGCTAAAAAGGTACAGAAAGGAAATCCTGGAATTAAAGAAACAGTTAGAGGATTTAGAGACGTCATCTGAAATTAAAGCACAAGCCATGGCTAAAGAAGAGCATTCACAGTTATTGGCTGAAATCAAACTTCTACAGAAAGAAAGAGAGGATAGAATATGGCACTTGACAAATATTGTTGTTGCTTCATCCCAAGAATCTCAGCAAGACCAAAGGGTCAAACGAAAACGAAGAGTTACGTGGGCACCAGGAAAAATTCATAGTAGTTTACACGGTTCCAGTGTTTCTGATTTTGATATGCCATCCAGGTTACCTGGCAATTTTAGCAAGAAGGCAAAGTTCTCTGACTTGCCCGCATTTCCTGAAATTGATGACTCTGTTTGTACAGAGTTTTCTGATTTTGATGACCCAATCTCCATGATTGACAATAATGGAATAGATGCAGAATGGAATTTTGCCAGTAAAGTAACTCGTAGGGAAAAAGCATCACTTCATCAATCAATGATGGACTTTGAAGGACGGATTTCTGACAGTGTTCAGTTCCATGATTCTTCTAAAGAAATGGCTGAATGCAGAAGAGCTTCTTTTGAAAAGGAGATCACAAGCCTCCAACAGCAACTACAGTCAAAGGAGGAAGAAAAAAGACAACTTGTACAAAGCTTCGAGCTCAAGATAACAGAACTGGAAGGGCAGCTTAGGGACAGAGCTAAAAATCTAGAGATGGTTACAGACTTGCGAGAGCATTCCATTAATGCCGAAGTCCAAGTAGATTTTGAAAAGGAAGTTCTGAGAAAAGAAATGTCAGTACTTGGAGACTCTGGTTACAATGCATCAAGCAGTGGCCTACAGGATAGTTCTATTGATAGGAAACGTCTAAGCAGCTCCCACGATGAGTGCATAGAACACAAAAAAATGCTGGAACAAAAGATTGCTGATTTAGAAGAATTTATTAAAAATCTTAGCAAGAAAAGTGAGAATGATGCGCAAAAATCTCATGAGCAAGATTTCATGGAGAGTGTCCAACTGTGTGAAGCTTTAATAGCAGAAAAGGCAAATGCTTTGGAGGAACTGGCACTTATGCGAGATCAGTTTGACGGTGTTATTCTAGAGAATGAAACTCTTAAAAGGGAAATTGCAGATCTGGAACGTTCTCTCAAAGAGAATCAAGAAACCAATGAATTTGAAATACTGGAGAAGGAAACTCAAAAAGAACATGAGGCACAACTAATCCATGAGATTGGCAATTTAAAGAAATTAGTAGAGAATGCAGAGATGTACAATCAAAGTCTAGAGGAAGATCTAGACACTAAAACAAAACTTCTAAAAGAGCAGGAAATGCAGCTCGCAGAATTAAGGAAACACACAGATAACTTGCAGAAAAAAGTACGAAATTTTGATCTCTCTGTTTCCATGGGTGATAGTGAGAGACTTTGTGAAGAGGTCTTTCAACTAAAGCAGTCTCTATGTGATGCTGAAGCTGTGACTCGCGATGCTCAGAAGGAATGTGCTTTCCTTAGAAGTGAAAATCTAGAGCTGAAGGAGAAAATGGAGGACACCTCAGCCTGGTACAATCAAAAAGAAAAGGAGGCGTCTTTGTTTGAGAAGCAGCTGGAAACTGAAAAAGCAAACTACAAAAAAATGCAAACTGATTTGCAGAAAGAGTTGCAAAGTGCTTTTAATGAAATTAACTACTTGAATGGCCTAATGGCAGGCAAGGTTCCCAAAGATTTGCTTTGTCGTGTGGAGCTGGAGAAAAAAGTTTCTGAGTACTCAAAGCAGCTTGAGAAAGCACTGGAAGAAAAAAATGCTTTGGAGAATGAAGTGACTTGCTTATCAGAATACAAATCTTTGCCAAAGGAAGTTGATTTCTTAAAAGATCAGATCAGCAAGGCTTCTGATGAGATAATGTTATTAAAGCATGAAGGAGAACTTTCTTCGTCTACTATAAGCAAACAAGAGGTTATCCTGCAGGAGCAATCTGGGCAGATAGTAGAATTGACTGATAAAGTGACACAAACACAGTCAAAAGTGCAGCAAGCTGAAGAGCAGTATTTGGAGATGAAGAAAATGCATGATGATCTTTATGAAAAGTTTATCTGTACAACTGAAGAGACCACCAAAAACAAAAGAGAAGCTGAAGACCTTTTAAGGGAAATAGAGAACCTTAAAGGCACTATGGAGACACTGGAAGTCAAGCTTGCTGCCACAAAACATGAACTTGAAGAATGTCAAATGGATAAGGAGCAACTGCTTAATAAGAAAAACTTCCTTCTTCAAGCAATGCAGGCTGCATTTTCAGTTGCTTCTCTTTCAGACTCTTCACCTTCTCTCTCAGCATTAGTTGAAGAGAAGTCTCAAGACCCCATACAAACTGATGAATACCACAAATTAATATCCCTTGCTAAAGAAAGGACCAGCATTATGGTGTGTCTAGAGACTGAGAGAAACAGTCTTAAAGAACAAGTTATTGATTTGACCTCTGAAGTTCAAAGTCTTCAAGCACAAGGTATTGCAAAGTCTGATCTCCAAAAAGAAAAACAAGACTTGGAAGATAAATGGGTTAAATTAGTTTCAGAGATGGAACAACTGCAGGAACAACTAACTGAATCACAGTTATCTTTAGAGAAGATGCAGCTGGAGAATCTGGAAGTTACAGAAAAACTCCAATCACTTCAAGAAGAGATGAAAAACATTACTA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----------A
                                               BLH ATG      78     563                                                                                                                                                                                                                                                       
                                               BLH MIN      75     229                                                                                                                                                                                                                                                       
                                               BLH OVR      78      79                                                                                                                                                                                                                                                       
                                               CDS MIN      78      30                                                                                                                                                                                                                                                       
                                               EST CLI      33      30                                                                                                                                                                                                                                                       
                                               ORF LNG      78      20                                                                                                                                                                                                                                                       
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Cs ---- 1e-010     AAX84194.1 cytospin A [Ciona savignyi] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Bf ---- 1e-013     CAA11444.1 intermediate filament protein C1 [Branchiostoma floridae] -----===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Bb ==== 8e-043     BAC15545.1 KIF1-like protein [Branchiostoma belcheri] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Sc ---- 8e-061     NP_011299.1 Kinesin-related protein; Kip3p [Saccharomyces cerevisiae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---= 2e-075     NP_741473.1 kinesin-like protein (88.7 kD) (klp-11) [Caenorhabditis elegans] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Xt ==== 2e-076     AAI36118.1 Unknown (protein for MGC:122802) [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                               PREDICTED - Dr ---- 2e-081     XP_693107.1 PREDICTED: hypothetical protein XP_688015 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ci ---- 2e-084     NP_001011659.1 kinesin-like protein 2 [Ciona intestinalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Dm ---- 6e-093     NP_524993.2 CENP-meta CG6392-PA [Drosophila melanogaster] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Sp ==== 6e-135     XP_781622.2 PREDICTED: similar to kinesin-related protein [Strongylocentrotus purpuratus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Mm ==== 0          NP_776123.3 centromere protein E [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Hs ==== 0          NP_001804.2 centromere protein E [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Gg ==== 0          XP_420670.2 PREDICTED: similar to CENPE variant protein [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xl ==== 0          AAC60300.1 kinesin-related protein [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === ?? ==== 0          NP_001080954.1 centromere protein E (kinesin-related protein) [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TEgg061h11.3.5                                                                                                                                                                                                                                                                               TGA---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATGATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG---------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ...
  0   1   1           Egg  FLt3                   TEgg017c01.FL-Sanger                                                                                                                                                                                                                                                                                             AGCGGTGTCGGTACCGATTTCTGCACTTATCGGACTCAAAATGTCCGAGGAAGACGCAGTGAAAGTGTGTGTGAGGGTCCGGCCGCTTATACAGAGAGAGCAAGGGGATCAATCCACCCTGCTATGGAAGGCTGGAAGCAACACCATTTCCCAGGTTGATGGGACAAAATCTTTCAGTTTTGATCGTGTATTTAATTCTCACGAATCAACAAGTCAAGTTTACCAAGAAATAGCAGTACCTATCATACAGTCAGCTTTGCAGGGATATAATGGCACAATATTTGCTTATGGACAGACATCTTCAGGCAAGACCTACACGATGATGGGAACACCAAATTCTTTGGGCATAATACCCCAAGCCATACAGGAAGTGTTTAAAATTATCCAGGAGATACCCAACAGAGAGTTTCTTCTAAGAGTTTCTTATATGGAAATTTACAATGAAACCGTGAAAGACCTCCTGTGTGATGACAGAAAAAAGAAGCCCTTGGAAATTCGCGAGGATATCAATAGAAACGTGTATGTTGCTGACTTAACAGAAGAACTTGTAATGGTTCCTGACCATGTAATTCAGTGGATCAAAAAGGGTGAAAAAAACAGGCATTATGGAGAGACTAAAATGAATGATCATAGTAGCCGTTCCCATACAATATTTCGAATGATTGTTGAAAGCAGAGACAGGAATGATTCTGCAAATTCAGAGAACTGCGATGGAGCTGTTATGGTATCCCACTTGAATCTGGTAGATCTTGCTGGCAGTGAAAGAGCAAGCCAAACTGGTGCTGAAGGTGTGAGACTTAAGGAAGGGTGCAACATCAACCGCAGCTTGTTTATCCTTGGCCAGGTTATTAAGAAGCTTAGCGATGGCCAGGCTGGTGGCTTTATAAACTACAGAGACAGCAAACTCACCAGAATTCTTCAAAATTCATTGGGAGGAAATGCCAAAACAGTTATCATTTGTACAATAACGCCAGTTTCTTTTGATGAAACTCTGAGTACACTTCAGTTTGCAAGTACTGCCAAACATATGAGAAATACTCCCCATGTTAATGAGGTCCTGGATGATGAAGCATTGCTAAAAAGGTACAGAAAGGAAATCCTGGAATTAAAGAAACAGTTAGAGGATTTAGAGACGTCATCTGAAATTAAAGCACAAGCCATGGCTAAAGAAGAGCATTCACAGTTATTGGCTGAAATCAAACTTCTACAGAAAGAAAGAGAGGATAGAATATGGCACTTGACAAATATTGTTGTTGCTTCATCCCAAGAATCTCAGCAAGACCAAAGGGTCAAACGAAAACGAAGAGTTACGTGGGCACCAGGAAAAATTCATAGTAGTTTACACGGTTCCAGTGTTTCTGATTTTGATATGCCATCCAGGTTACCTGGCAATTTTAGCAAGAAGGCAAAGTTCTCTGACTTGCCCGCATTTCCTGAAATTGATGACTCTGTTTGTACAGAGTTTTCTGATTTTGATGACCCAATCTCCATGATTGACAATAATGGAATAGATGCAGAATGGAATTTTGCCAGTAAAGTAACTCGTAGGGAAAAAGCATCACTTCATCAATCAATGATGGACTTTGAAGGACGGATTTCTGACAGTGTTCAGTTCCATGATTCTTCTAAAGAAATGGCTGAATGCAGAAGAGCTTCTTTTGAAAAGGAGATCACAAGCCTCCAACAGCAACTACAGTCAAAGGAGGAAGAAAAAAGACAACTTGTACAAAGCTTCGAGCTCAAGATAACAGAACTGGAAGGGCAGCTTAGGGACAGAGCTAAAAATCTAGAGATGGTTACAGACTTGCGAGAGCATTCCATTAATGCCGAAGTCCAAGTAGATTTTGAAAAGGAAGTTCTGAGAAAAGAAATGTCAGTACTTGGAGACTCTGGTTACAATGCATCAAGCAGTGGCCTACAGGATAGTTCTATTGATAGGAAACGTCTAAGCAGCTCCCACGATGAGTGCATAGAACACAAAAAAATGCTGGAACAAAAGATTGCTGATTTAGAAGAATTTATTAAAAATCTTAGCAAGAAAAGTGAGAATGATGCGCAAAAATCTCATGAGCAAGATTTCATGGAGAGTGTCCAACTGTGTGAAGCTTTAATAGCAGAAAAGGCAAATGCTTTGGAGGAACTGGCACTTATGCGAGATCAGTTTGACGGTGTTATTCTAGAGAATGAAACTCTTAAAAGGGAAATTGCAGATCTGGAACGTTCTCTCAAAGAGAATCAAGAAACCAATGAATTTGAAATACTGGAGAAGGAAACTCAAAAAGAACATGAGGCACAACTAATCCATGAGATTGGCAATTTAAAGAAATTAGTAGAGAATGCAGAGATGTACAATCAAAGTCTAGAGGAAGATCTAGACACTAAAACAAAACTTCTAAAAAAAAAAAAAAAAA
  5   1   2      ests                                Xt7.1-CAAM14694.5                                                                                                                                                                                                                                                       GAACCGCCGCCAAAAGGGACTAAGTGACAGAGACAGGGAGCGGTGTCGGTACCGATTTCTGCACTTATCGGACTCAAAATGTCCGAGGAAGACGCAGTGAAAGTGTGTGTGAGGGTCCGGCCGCTTATACAGAGAGAGCAAGGGGATCAATCCACCCTGCTATGGAAGGCTGGAAGCAACACCATTTCCCAGGTTGATGGGACAAAATCTTTCAGTTTTGATCGTGTATTTAATTCTCACGAATCAACAAGTCAAGTTTACCAAGAAATAGCAGTACCTATCATACAGTCAGCTTTGCAGGGATATAATGGCACAATATTTGCTTATGGACAGACATCTTCAGGCAAGACCTACACGATGATGGGAACACCAAATTCTTTGGGCATAATACCCCAAGCCATACAGGAAGTGTTTAAAATTATCCAGGAGATACCCAACAGAGAGTTTCTTCTAAGAGTTTCTTATATGGAAATTTACAATGAAACCGTGAAAGACCTCCTGTGTGATGACAGAAAAAAGAAGCCCTTGGAAATTCGCGAGGATATCAATAGAAACGTGTATGTTGCTGACTTAACAGAAGAACTTGTAATGGTTCCTGACCATGTAATTCAGTGGATCAAAAAGGGTGAAAAAAACAGGCATTATGGAGAGACTAAAATGAATGATCATAGTAGCCGTTCCCATACAATATTTCGAATGATTGTTGAAAGCAGAGACAGGAATGATTCTGCAAATTCAGAGAACTGCGATGGAGCTGTTATGGTATCTCACTTGAATCTGGTAGATCTTGCTGGCAGTGAAAGAGCAAGCCAAACTGGTGCTGAAGGT
                                                  Xt7.1-CHK-1008233529                                                                                                                                                                                                                                                             CCGCCAAAAGGGACTAAGTGACAGAGACAGGGAGCGGTGTCGGTACCGATTTCTGCACTTATCGGACTCAAAATGTCCGAGGAAGACGCAGTGAAAGTGTGTGTGAGGGTCCGGCCGCTTATACAGAGAGAGCAAGGGGATCAATCCACCCTGCTATGGAAGGCTGGAAGCAACACCATTTCCCAGGTTGATGGGACAAAATCTTTCAGTTTTGATCGTGTATTTAATTCTCACGAATCAACAAGTCAAGTTTACCAAGAAATAGCAGTACCTATCATACAGTCAGCTTTGCAGGGATATAATGGCACAATATTTGCTTATGGACAGACATCTTCAGGCAAGACCTACACGATGATGGGAACACCAAATTCTTTGGGCATAATACCCCAAGCCATACAGGAAGTGTTTAAAATTATCCAGGAGATACCCAACAGAGAGTTTCTTCTAAGAGTTTCTTATATGGAAATTTACAATGAAACCGTGAAAGACCTCCTGTGTGATGACAGAAAAAAGAAGCCCTTGGAAATTCGCGAGGATATCAATAGAAACGTGTATGTTGCTGACTTAACAGAAGAACTTGTAATGGTTCCTGACCATGTAATTCAGTGGATCAAAAAGGGTGAAAAAAACAGGCATTATGGAGAGACTAAAATGAATGATCATAGTAGCCGTTCCCATACAATATTTCGAATGATTGTTGAAAGCAGAGACAGGAATGATTCTGCAAATTCAGAGAACTGCGATGGAGCTGTTATGGTATCTCACTTGAATCTGGTAGATCTTGCTGGCAGTGAAAGAGCAAGCCAAACTGGTGCTGAAGGTGTGAGA
  5   1   2       bld Brn3      out                        CAAK6654.5p                                                                                                                                                                               CGTGTCTCCAGGCGAGAAGGTCCAATCGGCATGTCGGGCGAGGGAAATTCAAACTGGTTATAGGACAGACTTGAACCGCCGCCAAAAGGGACTAAGTGACAGAGACAGGGAGCGGTGTCGGTACCGATTTCTGCACTTATCGGACTCAAAATGTCCGAGGAAGACGCAGTGAAAGTGTGTGTGAGGGTCCGGCCGCTTATACAGAGAGAGCAAGGGGATCAATCCACCCTGCTATGGAAGGCTGGAAGCAACACCATTTCCCAGGTTGATGGGACAAAATCTTTCAGTTTTGATCGTGTATTTAATTCTCACGAATCAACAAGTCAAGTTTACCAAGAAATAGCAGTACCTATCATACAGTCAGCTTTGCAGGGATATAATGGCACAATATTTGCTTATGGACAGACATCTTCAGGCAAGACCTACACGATGATGGGAACACCAAATTCTTTGGGCATAATACCCCAAGCCATACAGGAAGTGTTTAAAATTATCCAGGAGATACCCAACAGAGAGTTTCTTCTAAGAGTTTCTTATATGGAAATTTACAATGAAACCGTGAAAGACCTCCTGTGTGATGACAGAAAAAAGAAGCCCTTGGAAATTCGCGAGGATATCAATAGAAACGTGTATGTTGCTGACTTAACAGAAGAACTTGTAATGGTTCCTGACCATGTAATTCAGTGGATCANAAAGGGTGAAAAAAACAGGCATTATGGAGAGACTAAAATGAATGATCATAGTAGCCGTTCCCATACAATATTTCGAATGATTNNGTGAAGCAGAGACAGGAATGATTCTGCAAATTCAGAGAACTGCGATGGAGCTGTTATGGTATCTCACTTGAATC
  5   1   2       bld Egg       in                   TEgg077j17.p1kSP6                                                                                                                                                                                                                               CCGGGGAATTCCCCGGGCAGACTTGAACCGCCGCCAAAAGGGACTAAGTGACAGAGACAGGGAGCGGTGTCGGTACCGATTTCTGCACTTATCGGACTCAAAATGTCCGAGGAAGACGCAGTGAAAGTGTGTGTGAGGGTCCGGCCGCTTATACAGAGAGAGCAAGGGGATCAATCCACCCTGCTATGGAAGGCTGGAAGCAACACCATTTCCCAGGTTGATGGGACAAAATCTTTCAGTTTTGATCGTGTATTTAATTCTCACGAATCAACAAGTCAAGTTTACCAAGAAATAGCAGTACCTATCATACAGTCAGCTTTGCAGGGATATAATGGCACAATATTTGCTTATGGACAGACATCTTCAGGCAAGACCTACACGATGATGGGAACACCAAATTCTTTGGGCATAATACCCCAAGCCATACAGGAAGTGTTTAAAATTATCCAGGAGATACCCAACAGAGAGTTTCTTCTAAGAGTTTCTTATATGGAAATTTACAATGAAACCGTGAAAGACCTCCTGTGTGATGACAGAAAAAAGAAGCCCTTGGAAATTCGCGAGGATATCAATAGAAACGTGTATGTTGCTGACTTAACAGAAGAACTTGTAATGGTTCCTGACC
  5   1   2       bld Egg       in                   TEgg022l15.p1kSP6                                                                                                                                                                                                                                                                               TGACAGAGACAGGGAGCGGTGTCGGTACCGATTTCTGCACTTATCGGACTCAAAATGTCCGAGGAAGACGCAGTGAAAGTGTGTGTGAGGGTCCGGCCGCTTATACAGAGAGAGCAAGGGGATCAATCCACCCTGCTATGGAAGGCTGGAAGCAACACCATTTCCCAGGTTGATGGGACAAAATCTTTCAGTTTTGATCGTGTATTTAATTCTCACGAATCAACAAGTCAAGTTTACCAAGAAATAGCAGTACCTATCATACAGTCAGCTTTGCAGGGATATAATGGCACAATATTTGCTTATGGACAGACATCTTCAGGCAAGACCTACACGATGATGGGAACACCAAATTCTTTGGGCATAATACCCCAAGCCATACAGGAAGTGTTTAAAATTATCCAGGAGATACCCAACAGAGAGTTTCTTCTAAGAGTTTCTTATATGGAAATTTACAATGAAACCGTGAAAGACCTCCTGTGTGATGACAGAAAAAAGAAGCCCTTGGAAATTCGCGAGGATATCAATAGAAACGTGTATGTTGCTGACTTAACAGAAGAACTTGTAATGGTTCCTGACCATGTAATTCAGTGGATC
  5   1   2      seed Te1       in                         CBWN2302.b1                                                                                                                                                                                                                                                                                    GAGACAGGGAGCGGTGTCGGTACCGATTTCTGCACTTATCGGACTCAAAATGTCCGAGGAAGACGCAGTGAAAGTGTGTGTGAGGGTCCGGCCGCTTATACAGAGAGAGCAAGGGGATCAATCCACCCTGCTATGGAAGGCTGGAAGCAACACCATTTCCCAGGTTGATGGGACAAAATCTTTCAGTTTTGATCGTGTATTTAATTCTCACGAATCAACAAGTCAAGTTTACCAAGAAATAGCAGTACCTATCATACAGTCAGCTTTGCAGGGATATAATGGCACAATATTTGCTTATGGACAGACATCTTCAGGCAAGACCTACACGATGATGGGAACACCAAATTCTTTGGGCATAATACCCCAAGCCATACAGGAAGTGTTTAAAATTATCCAGGAGATACCCAACAGAGAGTTTCTTCTAAGAGTTTCTTATATGGAAATTTACAATGAAACCGTGAAAGACCTCCTGTGTGATGACAGAAAAAAGAAGCCCTTGGAAATTCGCGAGGATATCAATAGAAACGTGTATGTTGCTGACTTAACAGAAGAACTTGTAATGGTTCCTGACCATGTAATTCAGTGGATCAAAAAGGGTGAAAAAAACAGGCATTATGGAGAGACTAAAATGAATGATCATAGTAGCCGTTCCCATACAATATTTCGAATGATTGTTGAAAGCAGAGACAGGAATGATTCTGCAAATTCAGAGAACTGCGATGGAGCTGTTATGGTATCTCAC
  5   1   2       bld Te3  PIPE out                       CAAM14694.5p                                                                                                                                                                                                                                                                                        CAGGGAGCGGTGTCGGTACCGATTTCTGCACTTATCGGACTCAAAATGTCCGAGGAAGACGCAGTGAAAGTGTGTGTGAGGGTCCGGCCGCTTATACAGAGAGAGCAAGGGGATCAATCCACCCTGCTATGGAAGGCTGGAAGCAACACCATTTCCCAGGTTGATGGGACAAAATCTTTCAGTTTTGATCGTGTATTTAATTCTCACGAATCAACAAGTCAAGTTTACCAAGAAATAGCAGTACCTATCATACAGTCAGCTTTGCAGGGATATAATGGCACAATATTTGCTTATGGACAGACATCTTCAGGCAAGACCTACACGATGATGGGAACACCAAATTCTTTGGGCATAATACCCCAAGCCATACAGGAAGTGTTTAAAATTATCCAGGAGATACCCAACAGAGAGTTTCTTCTAAGAGTTTCTTATATGGAAATTTACAATGAAACCGTGAAAGACCTCCTGTGTGATGACAGAAAAAAGAAGCCCTTGGAAATTCGCGAGGATATCAATAGAAACGTGTATGTTGCTGACTTAACAGAAGAACTTGTAATGGTTCCTGACCATGTAATTCAGTGGATCAAAAAGGGTGAAAAAAACAGGCATTATGGAGAGACTAAAATGAATGATCATAGTAGCCGTTCCCATACAATATTTCGAATGATTGTTGAAAGCAGAGACAGGAATGATTCTGCAAATTCAGAGAACTGCGATGGAGCTGTTATGGTATCTCACTTGAATCTGGTAGATCTTGCTGGCAGTGAAAGAGCAAGCCAAACTGGTGCTGAAGGTGTGAGACT
  5   1   2       bld Te3       in                          CAAM425.5p                                                                                                                                                                                                                                                                                        CAGGGAGCGGTGTCGGTACCGATTTCTGCACTTATCGGACTCAAAATGTCCGAGGAAGACGCAGTGAAAGTGTGTGTGAGGGTCCGGCCGCTTATACAGAGAGAGCAAGGGGATCAATCCACCCTGCTATGGAAGGCTGGAAGCAACACCATTTCCCAGGTTGATGGGACAAAATCTTTCAGTTTTGATCGTGTATTTAATTCTCACGAATCAACAAGTCAAGTTTACCAAGAAATAGCAGTACCTATCATACAGTCAGCTTTGCAGGGATATAATGGCACAATATTTGCTTATGGACAGACATCTTCAGGCAAGACCTACACGATGATGGGAACACCAAATTCTTTGGGCATAATACCCCAAGCCATACAGGAAGTGTTTAAAATTATCCAGGAGATACCCAACAGAGAGTTTCTTCTAAGAGTTTCTTATATGGAAATTTACAATGAAACCGTGAAAGACCTCCTGTGTGATGACAGAAAAAAGAAGCCCTTGGAAATTCGCGAGGATATCAATAGAAACGTGTATGTTGCTGACTTAACAGAAGAACTTGTAATGGTTCCTGACCATGTAATTCAGTGGATCANAAAGGGTGAAAAAAACAGGCATTATGGAGAGACTAAAATGAATGATCATAGTAGCCCGTCCCA
  5   1   2       bld Egg  FLt3 in                   TEgg017c01.p1kSP6                                                                                                                                                                                                                                                                                            AGCGGTGTCGGTACCGATTTCTGCACTTATCAGGACTCAAAATGTCCGAGGAAGACGCAGTGAAAGTGTGTGTGAGGGTCCGGCCGCTTATACAGAGAGAGCAAGGGGATCAATCCACCCTGCTATGGAAGGCTGGAAGCAACACCATTTCCCAGGTTGATGGGACAAAATCTTTCAGTTTTGATCGTGTATTTAATTCTCACGAATCAACAAGTCAAGTTTACCAAGAAATAGCAGTACCTATCATACAGTCAGCTTTGCAGGGATATAATGGCACAATATTTGCTTATGGACAGACATCTTCAGGCAAGACCTACACGATGATGGGAACACCAAATTCTTTGGGCATAATACCCCAAGCCATACAGGAAGTGTTTAAAATTATCCAGGAGATACCCAACAGAGAGTTTCTTCTAAGAGTTTCTTATATGGAAATTTACAATGAAACCGTGAAAGACCTCCTGTGTGATGACAGAAAAAAGAAGCCCTTGGAAATTCGCGAGGATATCAATAGAAACGTGTATGTTGCT
  5   1   2       bld Neu  5g                        TNeu018h15.p1kSP6                                                                                                                                                                                                                                                                                            GGAGCGGTGTCGGTACCGATTTCTGCACTTATCGGACTCAAATGTCCGAGGAAGACGCAGTGAAAGTGTGTGTGAGGGTCCGGCCGCTTATACAGAGAGAGCAAGGGGATCAATCCACCCTGCTATGGAAGGCTGGAAGCAACACCATTTCCCAGGTTGATGGGACAAAATCTTTCAGTTTTGATCGTGTATTTAATTCTCACGAATCAACAAGTCAAGTTTACCAAGAAATAGCAGTACCTATCATACAGTCAGCTTTGCAGGGATATAATGGCACAATATTTGCTTATGGACAGACATCTTCAGGCAAGACCTACACGATGATGGGAACACCAAATTCTTTGGGCATAATACCCCAAGCCATACAGGAAGTGTTTAAAATTATCCAGGAGATACCCAACAGAGAGTTTCTTCTAAGAGTTTCTTATATGGAAATTTACAATGAAACCGTGAAAGACCTCCTGTGTGATGACAGAAAAAAGAAGCCCTTGGAAATTCGCGAGGATATCAATAGAAACGTGTATGTTGCTGACTTAACAGAAGAACTTGTAATGGTTCCTGACCATGTAATTCAGTGGATCAAAAAGGGTGAAAAAAACAGGCATTATGGAGAGACTAAAATGAATGATCATAGTAGCCGTTCCCATACAATATNTCGAATGATTGTTGAAAGC
  5   1   2       bld Egg       in                   TEgg061h11.p1kSP6                                                                                                                                                                                                                                                                                                          TCTGCACTTATCGGACTCAAAAATGTCCCGAGGGAAGACGCAGTGAAAGTGTGTGTGAGGGTCCGGCCGCTTATACAGAGAGAGCAAGGGGATCATTCCACCCTGCTATGGAAGGCTGGAAACAACACCATTTCCCAGGTTGATGGGAACAAAATCTTTCAGTTTTGATCGTGTATTTAATTCTCACAAATCAACAAGTCAAGTTTACCAAAAAATACCAGTACCTATCATACAGTCAGCTTTGCAGGGATATAATGGCACAATATTTGCTTATGGACAAACATCTTCAGGCAAAACCTACACAATGAATGGGAACACCAAATTCTTTGGGCATAATACCCCAAGCCATACAGGAAGTGTTTAAAATTATCCAGAAAATACCCAACAAAGAAGTTTCTTCTAAAAGTTTCTTATATGGAAATTTACAATGAAACCGTGAAAGACCTCCTGTGTGATGACAGAAAAAAAAAGCCCTTGGAAATTCGCGAGGATATCAATAGAAACGTGTATGTTGCTGACTTAACAAAAGAACTTGTAATGGTTCCTGACCATGTAATTCAGTGGATCAAAAAGGGTGAAAA
  5   1   2       bld Egg                            TEgg011c14.p1kSP6                                                                                                                                                                                                                                                                                                                 TAGGTGGTGCTGCGGGTGTATGTTGCTTTGTAAGAAATATTTGAGAGAGGCCTGATACTTATTTTGTTGTCTGCAGAGAGCAAGGGGATCAATCCACCCTGCTATGGAAGGCTGGAAGCAACACCATTTCCCAGGTTGATGGGACAAAATCTTTCAGTTTTGATCGTGTATTTAATTCTCACGAATCAACAAGTCAAGTTTACCAAGAAATAGCAGTACCTATCATACAGTCAGCTTTGCAGGGATATAATGGCACAATATTTGCTTATGGACAGACATCTTCAGGCAAGACCTACACGATGATGGGAACACCAAATTCTTTGGGCATAATACCCCAAGCCATACAGGAAGTGTTTAAAATTATCCAGGAGATACCCAACAGAGAGTTTCTTCTAAGAGTTTCTTATATGGAAATTTACAATGAAACCGTGAAAGACCTCCTGTGTGATGACAGAAAAAAGAAGCCCTTGGAAATTCGCGAGGATATCAATAGAAACGTGTATGTTGCTGACTTAACAGAAGAACTTGTAATGGTTCCTGACCATGTAATTCAGTGGATCAAAAAGGGTGAAAAAAACAGGCATTATGGAGAGACTAAAATGAATGATCATAGTAGCCG
  3   1   2       bld Egg       in                    TEgg022l15.q1kT7                                                                                                                                                                                                                                                                                                                               CTCAAAATGTCCGAGGAAGACGCAGTGAAAGTGTGTGTGAGGGTCCGGCCGCTTATACAGAGAGAGCAAGGGGATCAATCCACCCTGCTATGGAAGGCTGGAAGCAACACCATTTCCCAGGTTGATGGGACAAAATCTTTCAGTTTTGATCGTGTATTTAATTCTCACGAATCAACAAGTCAAGTTTACCAAGAAATAGCAGTACCTATCATACAGTCAGCTTTGCAGGGATATAATGGCACAATATTTGCTTATGGACAGACATCTTCAGGCAAGACCTACACGATGATGGGAACACCAAATTCTTTGGGCATAATACCCCAAGCCATACAGGAAGTGTTTAAAATTATCCAGGAGATACCCAACAGAGAGTTTCTTCTAAGAGTTTCTTATATGGAAATTTACAATGAAACCGTGAAAGACCTCCTGTGTGATGACAGAAAAAAGAAGCCCTTGGAAATTCGCGAGGATATCAATAGAAACGTGTATGTTGCTGACTTAACAGAAGAACTTGTAATGGTTCCTGACCATGTAATTCAGTGGATCAAAAAAAAAAAAAAAAAAGCGCCGCAG
  5   1   2       bld Egg       in                   TEgg048n04.p1kSP6                                                                                                                                                                                                                                                                                                                                          TCCGAGGAAGAGCAGTGAAATGTGTGTGAGGGTCCGGCCGCTTATACAGAGAGAGCAAGGGGATCAATCCACCCTGCTATGGAAGGCTGGAAGCAACACCATTTCCCAGGTTGATGGGACAAAATCTTTCACTTTTGATCGTGTATTTAATTCTCACGAATCAACAAGTCAAGTTTACCAAGAAATAGCAGTACCTATCATACAGTCAGCTTTGCACGGATACACTGGCACAATATTTGCTTATGGACAGACATCTTC
  5   1   2       bld Gas7      in                         XZG38662.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGTTCCTGACCATGTAATTCAGTGGATCAAAAAGGGTGAAAAAAACAGGCATTATGGAGAGACTAAAATGAATGATCATAGTAGCCGTTCCCATACAATATTTCGAATGATTGTTGAAAGCAGAGACAGGAATGATTCTGCAAATTCAGAGAACTGCGATGGAGCTGTTATGGTATCCCACTTGAATCTGGTAGATCTTGCTGGCAGTGAAAGAGCAAGCCAAACTGGTGCTGAAGGTGTGAGACTTAAGGAAGGGTGCAACATCAACCGCAGCTTGTTTATCCTTGGCCAGGTTATTAAGAAGCTTAGCGATGGCCAGGCTGGTGGCTTTATAAACTACAGAGACAGCAAACTCACCAGAATTCTTCAAAATTCATTGGGAGGAAATGCCAAAACAGTTATCATTTGTACAATAACGCCAGTTTCTTTTGATGAAACTCTGAGTACACTTCAGTTTGCAAGTACTGCCAAACATATGAGAAATACTCCCCATGTTAATGAGGTCCTGGATGATGAAGCATTGCTAAAAAGGTACAGAAAGGAAATCCTGGAATTAAAGAAACAGTTAGAGGATTTAGAGACGTCATCTGAAATTAAAGCACAAGCCATGGCTAAAGAAGAGCATTCACAGTTATTGGCTGAAATCAAACTTCTACAGAAAGAAAGAGAGGATAGAATATGGCACTTGACAAATATTGTTGTTGCTTCATCCCAAGAATCTCAGCAAGACCAAAGGGTCAAACGAAAACGAAGAGTTACGTGGGCACCAGGAAAAATTCATAGTAGTTTACACGGTTCCAGTGTTTCTGATTTTGATATGCCATCCAGGTTACCTGGCAATTTTAGCAAGAG
  5   1   2      ests                               Xt7.1-TEgg061h11.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAGAGACAGCAAACTCACCAGAATTCTTCAAAATTCATTGGGAGGAAATGCCAAAACAGTTATCATTTGTACAATAACGCCAGTTTCTTTTGATGAAACTCTGAGTACACTTCAGTTTGCAAGTACTGCCAAACATATGAGAAATACTCCCCATGTTAATGAGGTCCTGGATGATGAAGCATTGCTAAAAAGGTACAGAAAGGAAATCCTGGAATTAAAGAAACAGTTAGAGGATTTAGAGACGTCATCTGAAATTAAAGCACAAGCCATGGCTAAAGAAGAGCATTCACAGTTATTGGCTGAAATCAAACTTCTACAGAAAGAAAGAGAGGATAGAATATGGCACTTGACAAATATTGTTGTTGCTTCATCCCAAGAATCTCAGCAAGACCAAAGGGTCAAACGAAAACGAAGAGTTACGTGGGCACCAGGAAAAATTCATAGTAGTTTACACGGTTCCAGTGTTTCTGATTTTGATATGCCATCCAGGTTACCTGGCAATTTTAGCAAGAAGGCAAAGTTCTCTGACTTGCCCGCATTTCCTGAAATTGATGACTCTGTTTGTACAGAGTTTTCTGATTTTGATGACCCAATCTCCATGATTGACAATAATGGAATAGATGCAGAATGGAATTTTGCCAGTAAAGTAACTCGTAGGGAAAAAGCATCACTTCATCAATCAATGATGGACTTTGAAGGACGGATTTCTGACAGTGTTCAGTTCCATGATTCTTCTAAAGAAATGGCTGAATGCAGAAGAGCTTCTTTTGAAAAGGAGATCACAAGCCTCCAACAGCAACTACAGTCAAAGGAGGAAGAAAAAAGACAACTTGTACAAAGCTTCGAGCTCAAGATAACAGAACTGGAAGGGCAGCTTAGGGACAGAGCTAAAAATCTAGAGATGGTTACAGACTTGCGAGAGCATTCCATTAATGCCGAAGTCCAAGTAGATTTTGAAAAGGAAGTTCTGAGAAAAGAAATGTCAGTACTTGGAGACTCTGGTTACAATGCATCAAGCAGTGGCCTACAGGATAGTTCTATTGATAGGAAACGTCTAAGCAGCTCCCACGATGAGTGCATAGAACACAAAAAAATGCTGGAACAAAAGATTGCTGATTTAGAAGAATTTATTAAAAATCTTAGCAAGAAAAGTGAGAATGATGCGCAAAAATCTCATGAGCAAGATTTCATGGAGAGTGTCCAACTGTGTGAAGCTTTAATAGCAGAAAAGGCAAATGCTTTGGAGGAACTGGCACTTATGCGAGATCAGTTTGACGGTGTTATTCTAGAGAATGAAACTCTTAAAAGGGAAATTGCAGATCTGGAACGTTCTCTCAAAGAGAATCAAGAAACCAATGAATTTGAAATACTGGAGAAGGAAACTCAAAAAGAACATGAGGCACAACTAATCCATGAGATTGGCAATTTAAAGAAATTAGTAGAGAATGCAGAGATGTACAATCAAAGTCTAGAGGAAGATCTAGACACTAAAACAAAACTTCTAAAAGAGCAGGAAATGCAGCTCGCAGAATTAAGGAAACACACAGATAACTTGCAGAAAAAAGTACGAAATTTTGATCTCTCTGTTTCCATGGGTGATAGTGAGAGACTTTGTGAAGAGGTCTTTCAACTAAAGCAGTCTCTATGTGATGCTGAAGCTGTGACTCGCGATGCTCAGAAGGAATGTGCTTTCCTTAGAAGTGAAAATCTAGAGCTGAAGGAGAAAATGGAGGACACCTCAGCCTGGTACAATCAAAAAGAAAAGGAGGCGTCTTTGTTTGAGAAGCAGCTGGAAACTGAAAAAGCAAACTACAAAAAAATGCAAACTGATTTGCAGAAAGAGTTGCAAAGTGCTTTTAATGAAATTAACTACTTGAATGGCCTAATGGCAGGCAAGGTTCCCAAAGATTTGCTTTGTCGTGTGGAGCTGGAGAAAAAAGTTTCTGAGTACTCAAAGCAGCTTGAGAAAGCACTGGAAGAAAAAAATGCTTTGGAGAATGAAGTGACTTGCTTATCAGAATACAAATCTTTGCCAAAGGAAGTTGATTTCTTAAAAGATCAGATCAGCAAGGCTTCTGATGAGATAATGTTATTAAAGCATGAAGGAGAACTTTCTTCGTCTACTATAAGCAAACAAGAGGTTATCCTGCAGGAGCAATCTGGGCAGATAGTAGAATTGACTGATAAAGTGACACAAACACAGTCAAAAGTGCAGCAAGCTGAAGAGCAGTATTTGGAGATGAAGAAAATGCATGATGATCTTTATGAAAAGTTTATCTGTACAACTGAAGAGACCACCAAAAACAAAAGAGAAGCTGAAGACCTTTTAAGGGAAATAGAGAACCTTAAAGGCACTATGGAGACACTGGAAGTCAAGCTTGCTGCCACAAAACATGAACTTGAAGAATGTCAAATGGATAAGGAGCAACTGCTTAATAAGAAAAACTTCCTTCTTCAAGCAATGCAGGCTGCATTTTCAGTTGCTTCTCTTTCAGACTCTTCACCTTCTCTCTCAGCATTAGTTGAAGAGAAGTCTCAAGACCCCATACAAACTGATGAATACCACAAATTAATATCCCTTGCTAAAGAAAGGACCAGCATTATGGTGTGTCTAGAGACTGAGAGAAACAGTCTTAAAGAACAAGTTATTGATTTGACCTCTGAAGTTCAAAGTCTTCAAGCACAAGGTATTGCAAAGTCTGATCTCCAAAAAGAAAAACAAGACTTGGAAGATAAATGGGTTAAATTAGTTTCAGAGATGGAACAACTGCAGGAACAACTAACTGAATCACAGTTATCTTTAGAGAAGATGCAGCTGGAGAATCTGGAAGTTACAGAAAAACTCCAATCACTTCAAGAAGAGATGAAAAACATTACTA
                                                  Xt7.1-CHK-1008229717                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACAGCAAACTCACCAGAATTCTTCAAAATTCATTGGGAGGAAATGCCAAAACAGTTATCATTTGTACAATAACGCCAGTTTCTTTTGATGAAACTCTGAGTACACTTCAGTTTGCAAGTACTGCCAAACATATGAGAAATACTCCCCATGTTAATGAGGTCCTGGATGATGAAGCATTGCTAAAAAGGTACAGAAAGGAAATCCTGGAATTAAAGAAACAGTTAGAGGATTTAGAGACGTCATCTGAAATTAAAGCACAAGCCATGGCTAAAGAAGAGCATTCACAGTTATTGGCTGAAATCAAACTTCTACAGAAAGAAAGAGAGGATAGAATATGGCACTTGACAAATATTGTTGTTGCTTCATCCCAAGAATCTCAGCAAGACCAAAGGGTCAAACGAAAACGAAGAGTTACGTGGGCACCAGGAAAAATTCATAGTAGTTTACACGGTTCCAGTGTTTCTGATTTTGATATGCCATCCAGGTTACCTGGCAATTTTAGCAAGAAGGCAAAGTTCTCTGACTTGCCCGCATTTCCTGAAATTGATGACTCTGTTTGTACAGAGTTTTCTGATTTTGATGACCCAATCTCCATGATTGACAATAATGGAATAGATGCAGAATGGAATTTTGCCAGTAAAGTAACTCGTAGGGAAAAAGCATCACTTCATCAATCAATGATGGACTTTGAAGGACGGATTTCTGACAGTGTTCAGTTCCATGATTCTTCTAAAGAAATGGCTGAATGCAGAAGAGCTTCTTTTGAAAAGGAGATCACAAGCCTCCAACAGCAACTACAGTCAAAGGAGGAAGAAAAAAGACAACTTGTACAAAGCTTCGAGCTCAAGATAACAGAACTGGAAGGGCAGCTTAGGGACAGAGCTAAAAATCTAGAGATGGTTACAGACTTGCGAGAGCATTCCATTAATGCCGAAGTCCAAGTAGATTTTGAAAAGGAAGTTCTGAGAAAAGAAATGTCAGTACTTGGAGACTCTGGTTACAATGCATCAAGCAGTGGCCTACAGGATAGTTCTATTGATAGGAAACGTCTAAGCAGCTCCCACGATGAGTGCATAGAACACAAAAAAATGCTGGAACAAAAGATTGCTGATTTAGAAGAATTTATTAAAAATCTTAGCAAGAAAAGTGAGAATGATGCGCAAAAATCTCATGAGCAAGATTTCATGGAGAGTGTCCAACTGTGTGAAGCTTTAATAGCAGAAAAGGCAAATGCTTTGGAGGAACTGGCACTTATGCGAGATCAGTTTGACGGTGTTATTCTAGAGAATGAAACTCTTAAAAGGGAAATTGCAGATCTGGAACGTTCTCTCAAAGAGAATCAAGAAACCAATGAATTTGAAATACTGGAGAAGGAAACTCAAAAAGAACATGAGGCACAACTAATCCATGAGATTGGCAATTTAAAGAAATTAGTAGAGAATGCAGAGATGTACAATCAAAGTCTAGAGGAAGATCTAGACACTAAAACAAAACTTCTAAAAGAGCAGGAAATGCAGCTCGCAGAATTAAGGAAACACACAGATAACTTGCAGAAAAAAGTACGAAATTTTGATCTCTCTGTTTCCATGGGTGATAGTGAGAGACTTTGTGAAGAGGTCTTTCAACTAAAGCAGTCTCTATGTGATGCTGAAGCTGTGACTCGCGATGCTCAGAAGGAATGTGCTTTCCTTAGAAGTGAAAATCTAGAGCTGAAGGAGAAAATGGAGGACACCTCAGCCTGGTACAATCAAAAAGAAAAGGAGGCGTCTTTGTTTGAGAAGCAGCTGGAAACTGAAAAAGCAAACTACAAAAAAATGCAAACTGATTTGCAGAAAGAGTTGCAAAGTGCTTTTAATGAAATTAACTACTTGAATGGCCTAATGGCAGGCAAGGTTCCCAAAGATTTGCTTTGTCGTGTGGAGCTGGAGAAAAAAGTTTCTGAGTACTCAAAGCAGCTTGAGAAAGCACTGGAAGAAAAAAATGCTTTGGAGAATGAAGTGACTTGCTTATCAGAATACAAATCTTTGCCAAAGGAAGTTGATTTCTTAAAAGATCAGATCAGCAAGGCTTCTGATGAGATAATGTTATTAAAGCATGAAGGAGAACTTTCTTCGTCTACTATAAGCAAACAAGAGGTTATCCTGCAGGAGCAATCTGGGCAGATAGTAGAATTGACTGATAAAGTGACACAAACACAGTCAAAAGTGCAGCAAGCTGAAGAGCAGTATTTGGAGATGAAGAAAATGCATGATGATCTTTATGAAAAGTTTATCTGTACAACTGAAGAGACCACCAAAAACAAAAGAGAAGCTGAAGACCTTTTAAGGGAAATAGAGAACCTTAAAGGCACTATGGAGACACTGGAAGTCAAGCTTGCTGCCACAAAACATGAACTTGAAGAATGTCAAATGGATAAGGAGCAACTGCTTAATAAGAAAAACTTCCTTCTTCAAGCAATGCAGGCTGCATTTTCAGTTGCTTCTCTTTCAGACTCTTCACCTTCTCTCTCAGCATTAGTTGAAGAGAAGTCTCAAGACCCCATACAAACTGATGAATACCACAAATTAATATCCCTTGCTAAAGAAAGGACCAGCATTATGGTGTGTCTAGAGACTGAGAGAAACAGTCTTAAAGAACAAGTTATTGATTTGACCTCTGAAGTTCAAAGTCTTCAAGCACAAGGTATTGCAAAGTCTGATCTCCAAAAAGAAAAACAAGACTTGGAAGATAAATGGGTTAAATTAGTTTCAGAGATGGAACAACTGCAGGAACAACTAACTGAATCACAGTTATCTTTAGAGAAGATGCAGCTGGAGAATCTGGAAGTTACAGAAAAACTCCAATCACTTCAAGAAGAGATGAAAAACA
  5   1   2       bld TbA       in                   TTbA055g18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCAAGCCAACTGGTGCTGAAGGTGTGAGACTTAAGGAAGGGTGCAACATCAACCGCAGCTTGTTTATCCTTGGCCAGGTTATTAAGAAGCTTAGCGATGGCCAGGCTGGTGGCTTTATAAACTACAGAGACAGCAAACTCACCAGAATTCTTCAAAATTCATTGGGAGGAAATGCCAAAACAGTTATCATTTGTACAATAACGCCAGTTTCTTTTGATGAAACTCTGAGTACACTTCAGTTTGCAAGTACTGCCAAACATATGAGAAATACTCCCCATGTTAATGAGGTCCTGGATGATGAAGCATTGCTAAAAAGGTACAGAAAGGAAATCCTGGAATTAAAGAAACAGTTAGAGGATTTAGAGACGTCATCTGAAATTAAAGCACAAGCCATGGCTAAAGAAGAGCATTCACAGTTATTGGCTGAAATCAAACTTCTACAGAAAGAAAGAGAGGATAGAATATGGCACTTGACAAATATTGTTGTTGCTTCATCCCAAGAATCTCAGCAAGACCAAAGGGTCAAACGAAAACGAAGAGTTACGTGGGCACCAGGAAAAATTCATAGTAGTTTACACGGTTCCAGTGTTTCTGATTTTGATATGCCATCCAGGTTACCTGGCAATTTTAGCAAGAAGGCAAAGTTCTCTGACTTGCCCGCATTTCCTGANATTGATGACTCTGGTTGTACAGAGTTTTCTG
  5   1   2       bld Egg                            TEgg088k23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAGAGACAGCAAACTCACCAGAATTCTTCAAAATTCATTGGGAGGAAATGCCAAAACAGTTATCATTTGTACAATAACGCCAGTTTCTTTTGATGAAACTCTGAGTACACTTCAGTTTGCAAGTACTGCCAAACATATGAGAAATACTCCCCATGTTAATGAGGTCCTGGATGATGAAGCATTGCTAAAAAGGTACAGAAAGGAAATCCTGGAATTAAAGAAACAGTTAGAGGATTTAGAGACGTCATCTGAAATTAAAGCACAAGCCATGGCTAAAGAAGAGCATTCACAGTTATTGGCTGAAATCAAACTTCTACAGAAAGAAAGAGAGGATAGAATATGGCACTTGACAAATATTGTTGTTGCTTCATCCCAAGAATCTCAGCAAGACCAAAGGGTCAAACGAAAACGAAGAGTTACGTGGGCACCAGGAAAAATTCATAGTAGTTTACACGGTTCCAGTGTTTCTGATTTTGATATGCCATCCAGGTTACCTGGCAATTTTAGCAAGAAGGCAAAGTTCTCTGACTTGCCCGCATTTCCTGAAATTGATGACTCTGTTTGTACAGAGTTTTCTGATTTTGATGACCCAATCTCCATGATTGACAATAATGGAATAGATGCAGAATGGAATTTTGCCAGT
  5   1   2       bld Egg                            TEgg088l03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAGAGACAGCAAACTCACCAGAATTCTTCAAAATTCATTGGGAGGAAATGCCAAAACAGTTATCATTTGTACAATAACGCCAGTTTCTTTTGATGAAACTCTGAGTACACTTCAGTTTGCAAGTACTGCCAAACATATGAGAAATACTCCCCATGTTAATGAGGTCCTGGATGATGAAGCATTGCTAAAAAGGTACAGAAAGGAAATCCTGGAATTAAAGAAACAGTTAGAGGATTTAGAGACGTCATCTGAAATTAAAGCACAAGCCATGGCTAAAGAAGAGCATTCACAGTTATTGGCTGAAATCAAACTTCTACAGAAAGAAAGAGAGGATAGAATATGGCACTTGACAAATATTGTTGTTGCTTCATCCCAAGAATCTCAGCAAGACCAAAGGGTCAAACGAAAACGAAGAGTTACGTGGGCACCAGGAAAAATTCATAGTAGTTTACACGGTTCCAGTGTTTCTGATTTTGATATGCCATCCAGGTTACCTGGCAATTTTAGCAAGAAGGCAAAGTTCTCTGACTTGCCCGCATTTCCTGAATTGATGACTCTGTTTGTACAGAGTTTTCTGATTTTGATGACCCAATCTCCATGATTGACAATAATGG
  5   1   2       bld Egg       in                   TEgg006d06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAGTTTCTTTTGATGAAACTCTGAGTACACTTCAGTTTGCAAGTACTGCCAAACATATGAGAAATACTCCCCATGTTAATGAGGTCCTGGATGATGAAGCATTGCTAAAAAGGTACAGAAAGGAAATCCTGGAATTAAAGAAACAGTTAGAGGATTTAGAGACGTCATCTGAAATTAAAGCACAAGCCATGGCTAAAGAAGAGCATTCACAGTTATTGGCTGAAATCAAACTTCTACAGAAAGAAAGAGAGGATAGAATATGGCACTTGACAAATATTGTTGTTGCTTCATCCCAAGAATCTCAGCAAGACCAAAGGGTCAAACGAAAACGAAGAGTTACGTGGGCACCAGGAAAAATTCATAGTAGTTTACACGGTTCCAGTGTTTCTGATTTTGATATGCCATCCAGGTTACCTGGCAATTTTAGCAAGAAGGCAAAGTTCTCTGACTTGCCCGCATTTCCTGAAATTGATGACTCTGTTTGTACAGAGTTTTCTGATTTTGATGACCCAATCTCCATGATTGACAATAATGGAATAGATGCAGAATGGAATTTTGCCAGTAAAGTAACTCGTAGGGAAAAAGCATCACTTCATCAATCAATGATGGACTTTGAAGGACGGATTTCTGACAGTGTTCAGT
  5   1   2       bld Egg       in                   TEgg006d15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAGTTTCTTTTGATGAAACTCTGAGTACACTTCAGTTTGCAAGTACTGCCAAACATATGAGAAATACTCCCCATGTTAATGAGGTCCTGGATGATGAAGCATTGCTAAAAAGGTACAGAAAGGAAATCCTGGAATTAAAGAAACAGTTAGAGGATTTAGAGACGTCATCTGAAATTAAAGCACAAGCCATGGCTAAAGAAGAGCATTCACAGTTATTGGCTGAAATCAAACTTCTACAGAAAGAAAGAGAGGATAGAATATGGCACTTGACAAATATTGTTGTTGCTTCATCCCAAGAATCTCAGCAAGACCAAAGGGTCAAACGAAAACGAAGAGTTACGTGGGCACCAGGAAAAATTCATAGTAGTTTACACGGTTCCAGTGTTTCTGATTTTGATATGCCATCCAGGTTACCTGGCAATTTTAGCAAGAAGGCAAAGTTCTCTGACTTGCCCGCATTTCCTGAAATTGATGACTCTGTTTGTACAGAGTTTTCTGATTTTGATGACCCAATCTCCATGATTGACAATAATGGAATAGATGCAGAATGGAATTTTGCCAGTAAGTAACTCGTAGGGAAAAAGCATCACTTCATCATCATGATGGACTTTGAAGGACGGATTTCTGACAGTGTTCAGTTCCATGATTCTTCTAAAGAAAT
  5   1   2       bld Egg       in                   TEgg026o14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAGTTTCTTTTGATGAAACTCTGAGTACACTTCAGTTTGCAAGTACTGCCAAACATATGAGAAATACTCCCCATGTTAATGAGGTCCTGGATGATGAAGCATTGCTAAAAAGGTACAGAAAGGAAATCCTGGAATTAAAGAAACAGTTAGAGGATTTAGAGACGTCATCTGAAATTAAAGCACAAGCCATGGCTAAAGAAGAGCATTCACAGTTATTGGCTGAAATCAAACTTCTACAGAAAGAAAGAGAGGATAGAATATGGCACTTGACAAATATTGTTGTTGCTTCATCCCAAGAATCTCAGCAAGACCAAAGGGTCAAACGAAAACGAAGAGTTACGTGGGCACCAGGAAAAATTCATAGTAGTTTACACGGTTCCAGTGTTTCTGATTTTGATATGCCATCCAGGTTACCTGGCAATTTTAGCAAGAAGGCAAAGTTCTCTGACTTGCCCGCATTTCCTGAAATTGATGACTCTGTTTGTACAGAGTTTTCTGATTTTGATGACCCAATCTCCATGATTGACAATAATGGAATAGATGCAGAATGGAATTTTGCCAGTAAAGTAACTCGTAGGGAAAAAGCATCACTTCTTCAATCAATGATGGACTTTGAAGGACGGATTTCTGACAGTGTTCAGTTCCATG
  3   1   2      seed Egg       in                    TEgg061h11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGATGAAGCATTGCTAAAAAGGTACAGAAAGGAAATCCTGGAATAAAGAAACAGTTAGAGGATTTAGAGACGTCATCTGAAATTAAAGCACAAGCCATGGCTAAAGAAGAGCATTCACAGTTATTGGCTGAAATCAAACTTCTACAGAAAGAAAGAGAGGATAGAATATGGCACTTGACAAATATTGTTGTTGCTTCATCCCAAGAATCTCAGCAAGACCAAAGGGTCAAACGAAAACGAAGAGTTACGTGGGCACCAGGAAAAATTCATAGTAGTTTACACGGTTCCAGTGTTTCTGATTTTGATATGCCATCCAGGTTACCTGGCAATTTTAGCAAGAAGGCAAAGTTCTCTGACTTGCCCGCATTTCCTGAAATTGATGACTCTGTTTGTACAGAGTTTTCTGATTTTGATGACCCAATCTCCATGATTGACAATAATGGAATAGATGCAGAATGGAATTTTGCCAGTAAAGTAACTCGTAGGGAAAAAGCATCACTTCATCAATCAATGATGGACTTTGAAGGACGGATTTCTGACAGTGTTCAGTTCCATGATTCTTCTAAAGAAATGGCTGAATGCAGAAGAGCTTCTTTTGAAAAGGAGATCACAAGCCTCCAACAGCAACTACAGTCAAAGGAGGAAGAAAAAAGACAACTTGTACAAAGCTTCGAGCTCAAGATAACAGAACTGGAAGGGCAGCTTAGGGACAGAGCTAAAAATCTAGAGATGGTTACAGACTTGCGAGAGCATTCCATTAATGCCGAAGTCCAAGTAGATTTTGAAAAGGAAGTTCTGAGAAAAGAAATGTCAGTACTTGGAGACTCTGGTTACAATGCATCAAGCAGTGGCCTACAGGATAGTTCTATTGATAGGAAACGTCTAAGCAGCTCCCACGATGAGTGCATAGAACACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg026o14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATAGAATATGGCACTTGACAAATATTGTTGTTGCTTCATCCCAAGAATCTCAGCAAGACCAAAGGGTCAAACGAAAACGAAGAGTTACGTGGGCACCAGGAAAAATTCATAGTAGTTTACACGGTTCCAGTGTTTCTGATTTTGATATGCCATCCAGGTTACCTGGCAATTTTAGCAAGAAGGCAAAGTTCTCTGACTTGCCCGCATTTCCTGAAATTGATGACTCTGTTTGTACAGAGTTTTCTGATTTTGATGACCCAATCTCCATGATTGACAATAATGGAATAGATGCAGAATGGAATTTTGCCAGTAAAGTAACTCGTAGGGAAAAAGCATCACTTCATCAATCAATGATGGACTTTGAAGGACGGATTTCTGACAGTGTTCAGTTCCATGATTCTTCTAAAGAAATGGCTGAATGCAGAAGAGCTTCTTTTGAAAAGGAGATCACAAGCCTCCAACAGCAACTACAGTCAAAGGAGGAAGAAAAAAGACAACTTGTACAAAGCTTCGAGCTCAAGATAACAGAACTGGAAGGGCAGCTTAGGGACAGAGCTAAAAATCTAGAGATGGTTACAGACTTGCGAGAGCATTCCATTAATGCCGAAGTCCAAGTAGATTTTGAAAAGGAAGTTCTGAGAAAAGAAATGTCAGTACTTGGAGACTCTGGTTACAATGCATCAAGCAGTGGCCTACAGGATAGTTCTATTGATAGGAAACGTCTAAGCAGCTCCCACGATGAGTGCATAGAACACAAAAAAATGCTGGAACAAAAGATTGCTGATTTAGAAGAATTTATTAAAAATCTTAGCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg006d06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACCTGGCAATTTTAGCAAGAAGGCAAAGTTCTCTGACTTGCCCGCATTTCCTGAAATTGATGACTCTGTTTGTACAGAGTTTTCTGATTTTGATGACCCAATCTCCATGATTGACAATAATGGAATAGATGCAGAATGGAATTTTGCCAGTAAAGTAACTCGTAGGGAAAAAGCATCACTTCATCAATCAATGATGGACTTTGAAGGACGGATTTCTGACAGTGTTCAGTTCCATGATTCTTCTAAAGAAATGGCTGAATGCAGAAGAGCTTCTTTTGAAAAGGAGATCACAAGCCTCCAACAGCAACTACAGTCAAAGGAGGAAGAAAAAAGACAACTTGTACAAAGCTTCGAGCTCAAGATAACAGAACTGGAAGGGCAGCTTAGGGACAGAGCTAAAAATCTAGAGATGGTTACAGACTTGCGAGAGCATTCCATTAATGCCGAAGTCCAAGTAGATTTTGAAAAGGAAGTTCTGAGAAAAGAAATGTCAGTACTTGGAGACTCTGGTTACAATGCATCAAGCAGTGGCCTACAGGATAGTTCTATTGATAGGAAACGTCTAAGCAGCTCCCACGATGAGTGCATAGAACACAAAAAAATGCTGGAACAAAAGATTGCTGATTTAGAAGAATTTATTAAAAATCTTAGCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg006d15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTAGCAAGAAGGCAAAGTTCTCTGACTTGCCCGCATTTCCTGAAATTGATGACTCTGTTTGTACAGAGTTTTCTGATTTTGATGACCCAATCTCCATGATTGACAATAATGGAATAGATGCAGAATGGAATTTTGCCAGTAAAGTAACTCGTAGGGAAAAAGCATCACTTCATCAATCAATGATGGACTTTGAAGGACGGATTTCTGACAGTGTTCAGTTCCATGATTCTTCTAAAGAAATGGCTGAATGCAGAAGAGCTTCTTTTGAAAAGGAGATCACAAGCCTCCAACAGCAACTACAGTCAAAGGAGGAAGAAAAAAGACAACTTGTACAAAGCTTCGAGCTCAAGATAACAGAACTGGAAGGGCAGCTTAGGGACAGAGCTAAAAATCTAGAGATGGTTACAGACTTGCGAGAGCATTCCATTAATGCCGAAGTCCAAGTAGATTTTGAAAAGGAAGTTCTGAGAAAAGAAATGTCAGTACTTGGAGACTCTGGTTACAATGCATCAAGCAGTGGCCTACAGGATAGTTCTATTGATAGGAAACGTCTAAGCAGCTCCCACGATGAGTGCATAGAACACAAAAAAATGCTGGAACAAAAGATTGCTGATTTAGAAGAATTTATTAAAAATCTTAGCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG38662.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAGAAATGGCTGAATGCAGAAGAGCTTCTTTTGAAAAGGAGATCACAAGCCTCCAACAGCAACTACAGTCAAAGGAGGAAGAAAAAAGACAACTTGTACAAAGCTTCGAGCTCAAGATAACAGAACTGGAAGGGCAGCTTAGGGACAGAGCTAAAAATCTAGAGATGGTTACAGACTTGCGAGAGCATTCCATTAATGCCGAAGTCCAAGTAGATTTTGAAAAGGAAGTTCTGAGAAAAGAAATGTCAGTACTTGGAGACTCTGGTTACAATGCATCAAGCAGTGGCCTACAGGATAGTTCTATTGATAGGAAACGTCTAAGCAGCTCCCCCGATGAGTGCATAGAACACAAAAAAATGCTGGAACAAAAGATTGCTGATTTAGAAGAATTTATTAAAAATCTTAGCAAGAAAAGTGAGAATGATGCGCAAAAAGTGAGTTACTGTTTTTTTAAAGAATTTTGTTTTCATATGTTATGAAAGGGAGCTACCTATCTTTCATTTCTTGGTCATCTTACTCCCGGGTCCCTACGGTAAAGCATCTGCACACTGTGCTTTAGGATGTTTTGCCAAACTAACGGATCTTCTGAAAACATCAAAAAGAGATGAAATTGAAGTTACGTCCAGCCAATTTAACCTTTATCCAAAATGATTAAATGCTTTAACCCCCTT
  3   1   2       bld Egg  FLt3 in                    TEgg017c01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACTGGAAGGGCAGCTTAGGGACAGAGCTAAAAATCTAGAGATGGTTACAGACTTGCGAGAGCATTCCATTAATGCCGAAGTCCAAGTAGATTTTGAAAAGGAAGTTCTGAGAAAAGAAATGTCAGTACTTGGAGACTCTGGTTACAATGCATCAAGCAGTGGCCTACAGGATAGTTCTATTGATAGGAAACGTCTAAGCAGCTCCCACGATGAGTGCATAGAACACAAAAAAATGCTGGAACAAAAGATTGCTGATTTAGAAGAATTTATTAAAAATCTTAGCAAGAAAAGTGAGAATGATGCGCAAAAATCTCATGAGCAAGATTTCATGGAGAGTGTCCAACTGTGTGAAGCTTTAATAGCAGAAAAGGCAAATGCTTTGGAGGAACTGGCACTTATGCGAGATCAGTTTGACGGTGTTATTCTAGAGAATGAAACTCTTAAAAGGGAAATTGCAGATCTGGAACGTTCTCTCAAAGAGAATCAAGAAACCAATGAATTTGAAATACTGGAGAAGGAAACTCAAAAAGAACATGAGGCACAACTAATCCATGAGATTGGCAATTTAAAGAAATTAGTAGAGAATGCAGAGATGTACAATCAAAGTCTAGAGGAAGATCTAGACACTAAAACAAAACTTCTAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg048n04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAGATGGTTACAGACTGCNGAGAGCATTCCATTAATGCCGAAGTCCAAGTAGATTTTGAAAAGGAAGTTCTGAGAAAAGAAATGTCAGTACTTGGAGACTCTGGTTACAATGCATCAAGCAGTGGCCTACAGGATAGTTCTATTGATAGGAAACGTCTAAGCAGCTCCCACGATGAGTGCATAGAACACAAAAAAATGCTGGAACAAAAGATTGCTGATTTAGAAGAATTTATTAAAAATCTTAGCAAGAAAAGTGAGAATGATGCGCAAAAATCTCATGAGCAAGATTTCATGGAGAGTGTCCAACTGTGTGAAGCTTTAATAGCAGAAAAGGCAAATGCTTTGGAGGAACTGGCACTTATGCGAGATCAGTTTGACGGTGTTATTCTAGAGAATGAAACTCTTAAAAGGGAAATTGCAGATCTGGAACGTTCTCTCAAAGAGAATCAAGAAACCAATGAATTTGAAATACTGGAGAAGGAAACTCAAAAAGAACATGAGGCACAACTAATCCATGAGATTGGCAATTTAAAGAAATTAGTAGAGAATGCAGAGATGTACAATCAAAGTCTAGAGGAAGATCTAGACACTAAAACAAAACTTCTAAAAGAGCAGGAAATGCAGCTCGCAGAATTAAGGAAACACACAGATAACTTGCAGAAAAAAGTACGAAATTTTGATCTCTCTGTTTCCATGGGTGATAGTGAGAGACTTTGTGAAGAGGTCTTTCAACTAAAGCAGTCTCTATGTGATGCTGAAGCTGTGACTCGCGATGCTCAGAAGGAATGTGCTTTCCTTAGAAGTGAAAATCTAGAGCTGAAGGAGAAAATGGAGGACACCTCAGCCTGGTACAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA055g18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGAAATGTCAGTACTTGGAGACTCTGGTTACAATGCATCAAGCAGTGGCCTACAGGATAGTTCTATTGATAGGAAACGTCTAAGCAGCTCCCACGATGAGTGCATAGAACACAAAAAAATGCTGGAACAAAAGATTGCTGATTTAGAAGAATTTATTAAAAATCTTAGCAAGAAAAGTGAGAATGATGCGCAAAAATCTCATGAGCAAGATTTCATGGAGAGTGTCCAACTGTGTGAAGCTTTAATAGCAGAAAAGGCAAATGCTTTGGAGGAACTGGCACTTATGCGAGATCAGTTTGACGGTGTTATTCTAGAGAATGAAACTCTTAAAAGGGAAATTGCAGATCTGGAACGTTCTCTCAAAGAGAATCAAGAAACCAATGAATTTGAAATACTGGAGAAGGAAACTCAAAAAGAACATGAGGCACAACTAATCCATGAGATTGGCAATTTAAAGAAATTAGTAGAGAATGCAGAGATGTACAATCAAAGTCTAGAGGAAGATCTAGACACTAAAACAAAACTTCTAAAAGAGCAGGAAATGCAGCTCGCAGAATTAAGGAAACACACAGATAACTTGCAGAAAAAAGTACGAAATTTTGATCTCTCTGTTTCCATGGGTGATAGTGAGAGACTTTGTGAAGAGGTCTTTCAACTAAAGCAGTCTCTATGTGATGCTGAAGCTGTGACTCGCGATGCTCAGAAGGAATGTGCTTTCCTTAGAAGTGAAAATCTAGAGCTGAAGGAGAAAATGGAGGACACCTCAGCCTGGTCAATCAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Egg       in                    TEgg077j17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AATGCATCAAGCAGTGCCCTACAGGATAGTTCTATTGATAGGAAACGTCTAAGCAGCTCCCACGATGAGTGCATAGAACACAAAAAAATGCTGGAACAAAAGATTGCTGATTTAGAAGAATTTATTAAAAATCTTAGCAAGAAAAGTGAGAATGATGCGCAAAAATCTCATGAGCAAGATTTCATGGAGAGTGTCCAACTGTGTGAAGCTTTAATAGCAGAAAAGGCAAATGCTTTGGAGGAACTGGCACTTATGCGAGATCAGTTTGACGGTGTTATTCTAGAGAATGAAACTCTTAAAAGGGAAATTGCAGATCTGGAACGTTCTCTCAAAGAGAATCAAGAAACCAATGAATTTGAAATACTGGAGAAGGAAACTCAAAAAGAACATGAGGCACAACTAATCCATGAGATTGGCAATTTAAAGAAATTAGTAGAGAATGCAGAGATGTACAATCAAAGTCTAGAGGAAGATCTAGACACTAAAACAAAACTTCTAAAAGAGCAGGAAATGCAGCTCGCAGAATTAAGGAAACACACAGATAACTTGCAGAAAAAAGTACGAAATTTTGATCTCTCTGTTTCCATGGGTGATAGTGAGAGACTTTGTGAAGAGGTCTTTCAACTAAAGCAGTCTCTATGTGATGCTGAAGCTGTGACTCGCGATGCTCAGAAGGAATGTGCTTTCCTTAGAAGTGAAAATCTAGAGCTGAAGGAGAAAATGGAGGACACCTCAGCCTGGTACAATCAAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Egg       out                  TEgg009c19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATTGCTGATTTAGAAGAATTTATTAAAAATCTTAGCAAGAAAAGTGAGAATGATGCGCAAAAATCTCATGAGCAAGATTTCATGGAGAGTGTCCAACTGTGTGAAGCTTTAATAGCAGAAAAGGCAAATGCTTTGGAGGAACTGGCACTTATGCGAGATCAGTTTGACGGTGTTATTCTAGAGAATGAAACTCTTAAAAGGGAAATTGCAGATCTGGAACGTTCTCTCAAAGAGAATCAAGAAACCAATGAATTTGAAATACTGGAGAAGGAAACTCAAAAAGAACATGAGGCACAACTAATCCATGAGATTGGCAATTTAAAGAAATTAGTAGAGAATGCAGAGATGTACAATCAAAGTCTAGAGGAAGATCTAGACACTAAAACAAAACTTCTAAAAGAGCAGGAAATGCAGCTCGCAGAATTAAGGAAACACACAGATAACTTGCAGAAAAAAGTACGAAATTTTGATCTCTCTGTTTCCATGGGTGATAGTGAGAGACTTTGTGAAGAGGTCTTTCAACTAAAGCAGTCTCTATGTGATGCTGAAGCTGTGACTCGCGATGCTCAGAAGGAATGTGCTTTCCTTAGAAGTGAAAATCTAGAGCTGAAGGAGAAAATGGAGGACACCTCAGCCTGGTACAATCAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Neu       out                  TNeu111b05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAAATCTTAGCAAGAAAAGTGAGAATGATGCGCAAAAATCTCATGAGCAAGATTTCATGGAGAGTGTCCAACTGTGTGAAGCTTTAATAGCAGAAAAGGCAAATGCTTTGGAGGAACTGGCACTTATGCGAGATCAGTTTGACGGTGTTATTCTAGAGAATGAAACTCTTAAAAGGGAAATTGCAGATCTGGAACGTTCTCTCAAAGAGAATCAAGAAACCAATGAATTTGAAATACTGGAGAAGGAAACTCAAAAAGAACATGAGGCACAACTAATCCATGAGATTGGCAATTTAAAGAAATTAGTAGAGAATGCAGAGATGTACAATCAAAGTCTAGAGGAAGATCTAGACACTAAAACAAAACTTCTAAAAGAGCAGGAAATGCAGCTCGCAGAATTAAGGAAACACACAGATAACTTGCAGAAAAAAGTACGAAATTTTGATCTCTCTGTTTCCATGGGTGATAGTGAGAGACTTTGTGAAGAGGTCTTTCAACTAAAGCAGTCTCTATGTGATGCTGAAGCTGTGACTCGCGATGCTCAGAAGGAATGTGCTTTCCTTAGAAGTGAAATCTAGAGCTGAAGGAGAAAATGGAGGACA
  3   1   2       bld Te3       in                          CAAM425.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAACTGGCACTTATGCGAGATCAGTTTGACGGTGTTATTCTAGAGAATGAAACTCTTAAAAGGGAAATTGCAGATCTGGAACGTTCTCTCAAAGAGAATCAAGAAACCAATGAATTTGAAATACTGGAGAAGGAAACTCAAAAAGAACATGAGGCACAACTAATCCATGAGATTGGCAATTTAAAGAAATTAGTAGAGAATGCAGAGATGTACAATCAAAGTCTAGAGGAAGATCTAGACACTAAAACAAAACTTCTAAAAGAGCAGGAAATGCAGCTCGCAGAATTAAGGAAACACACAGATAACTTGCAGAAAAAAGTACGAAATTTTGATCTCTCTGTTTCCATGGGTGATAGTGAGAGACTTTGTGAAGAGGTCTTTCAACTAAAGCAGTCTCTATGTGATGCTGAAGCTGTGACTCGCGATGCTCAGAAGGAATGTGCTTTCCTTAGAAGTGAAAATCTAGAGCTGAAGGAGAAAATGGAGGACACCTCAGCCCTGGTACAATC
  5   1   2       bld Te3       out                        CAAM4034.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTAGACACTAAAACAAAACTTCTAAAAGAGCAGGAAATGCAGCTCGCAGAATTAAGGAAACACACAGATAACTTGCAGAAAAAAGTACGAAATTTTGATCTCTCTGTTTCCATGGGTGATAGTGAGAGACTTTGTGAAGAGGTCTTTCAACTAAAGCAGTCTCTATGTGATGCTGAAGCTGTGACTCGCGATGCTCAGAAGGAATGTGCTTTCCTTAGAAGTGAAAATCTAGAGCTGAAGGAGAAAATGGAGGACACCTCAGCCTGGTACAATCAAAAAGAAAAGGAGGCGTCTTTGTTTGAGAAGCAGCTGGAAACTGAAAAAGCAAACTACAAAAAAATGCAAACTGATTTGCAGAAAGAGTTGCAAAGTGCTTTTAATGAAATTAACTACTTGAATGGCCTAATGGCAGGCAAGGTTCCCAAAGATTTGCTTTGTCGTGTGGAGCTGGAGAAAAAAGTTTCTGAGTACTCAAAGCAGCTTGAGAAAGCACTGGAAGAAAAAAATGCTTTGGAGAATGAAGTGACTTGCTTATCAGAATACAAATCTTTGCCAAAGGAAGTTGATTTCTTAAAAGATCAGATCAGCAAGGCTTCTGATGAGATAATGTTATTAAAGCATGAAGGAGAACTTTCTTCGTCTACTATAAGCAAACAAGAGGTTATCCTGCAGGAGCAATCTGGGCAGATAGTAGAATTGACTGATAAAGTGACACAAACACAGTCAAAAGTGCAGCAAGCTGAAGAGCAGTATTTGGAGATGAAGAANATGCATGATGATCTTTATGAAAAGTTTATCTGTACAACTGAAGAGAC
  3   1   2       bld Te1       in                         CBWN2302.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTGTTTCCATGGGTGATAGTGAGAGACTTTGTGAAGAGGTCTTTCAACTAAAGCAGTCTCTATGTGATGCTGAAGCTGTGACTCGCGATGCTCAGAAGGAATGTGCTTTCCTTAGAAGTGAAAATCTAGAGCTGAAGGAGAAAATGGAGGACACCTCAGCCTGGTACAATCAAAAAGAAAAGGAGGCGTCTTTGTTTGAGAAGCAGCTGGAAACTGAAAAAGCAAACTACAAAAAAATGCAAACTGATTTGCAGAAAGAGTTGCAAAGTGCTTTTAATGAAATTAACTACTTGAATGGCCTAATGGCAGGCAAGGTTCCCAAAGATTTGCTTTGTCGTGTGGAGCTGGAGAAAAAAGTTTCTGAGTACTCAAAGCAGCTTGAGAAAGCACTGGAAGAAAAAAATGCTTTGGAGAATGAAGTGACTTGCTTATCAGAATACAAATCTTTGCCAAAGGAAGTTGATTTCTTAAAAGATCAGATCAGCAAGGCTTCTGATGAGATAATGTTATTAAAGCATGAAGGAGAACTTTCTTCGTCTACTAGAAGCAAACAAGAGGTTATCCTGCAGGAGCAATCTGGGCAGATAGTAGAATTGACAGATAAAGTAACACAAACACAGTCAAAAGTGCAGCAAGCTGAAGAGCAGTATTTGGAGATGAAGAAAATGCATGATGATCTTTATGAAAAGTTTATCTGTACAACTGAAGAGACCACCAAAAAAAAAAAAAAA
  5   1   2       bld Te3       out                       CAAM15047.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGAACTTTCTTCGTCTACTATAAGCAAACAAGAGGTTATCCTGCAGGAGCAATCTGGGCAGATAGTAGAATTGACTGATAAAGTGACACAAACACAGTCAAAAGTGCAGCAAGCTGAAGAGCAGTATTTGGAGATGAAGAAAATGCATGATGATCTTTATGAAAAGTTTATCTGTACAACTGAAGAGACCACCAAAAACAAAAGAGAAGCTGAAGACCTTTTAAGGGAAATAGAGAACCTTAAAGGCACTATGGAGACACTGGAAGTCAAGCTTGCTGCCACAAAACATGAACTTGAAGAATGTCAAATGGATAAGGAGCAACTGCTTAATAAGAAAAACTTCCTTCTTCAAGCAATGCAGGCTGCATTTTCAGTTGCTTCTCTTTCAGACTCTTCACCTTCTCTCTCAGCATTAGTTGAAGAGAAGTCTCAAGACCCCATACAAACTGATGAATACCACAAATTAATATCCCTTGCTAAAGAAAGGACCAGCATTATGGTGTGTCTAGAGACTGAGAGAAACAGTCTTAAAGAACAAGTTATTGATTTGACCTCTGAAGTTCAAAGTCTTCAAGCACAAGGTATTGCAAAGTCTGATCTCCAAAAAGAAAAACAAGACTTGGAAGATAAATGGGTTAAATTAGTTTCAGAGATGGAACAACTGCAGGAACAACTAACTGAATCACAGTTATCTTTAGAGAAGATGCAGCTGGAGAATCTGGAAGTTACAGAAAAACTCCAATCACTTCAAGAAGAGATGAAAAACATTACTAAGGAGAGGAATGATCTTCAG
  5   1   1       add Egg       out                  TEgg052l18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAGATGAAGAACATGCATGATGATCTTTATGAGGAGTTTAGTCTGTACAATCTGAGGAGACCACCAAAAACAAAAGAGAAGCTGAAGACCTTTTAAGGGAAATACAGAACCTTAAAGGCACTATGGAGACACTGGAAGTCAAGCTTGCTGCCACAAAACATGAACTTGAAGAATGTCAAATGGATAAGGAGCAACTGCTTAATGAGAAAAACTTCCTTCTTCAAGCAATGCAGGCTGCATTTTCAGTTGCTTCTCTTTCAGACTCTTCACCTTCTCTCTCAGCATTAGTTGAAGAGAAGTCTCAAGACCCCATACTAACTGATGAATACCACAAATTAATATCCCTTGCTAAAGAAAGGACCAGCATTATGGTGTGTCTAGAGACTGAGAGAAACAGTCTTAAAGAACAAGTTATTGATTTGACCTCTGAAGTTCAAAGTCTTCAAGCACCAGGTATTGCAAAGTCTGATCTCCAAAAAGAAAAACGAGACTTGGAAGATAAATGGGTTAAATTAGTTTCAGAGATGGAACAACTGCAGGAACAACTAACTGAATCACAGTTATCTTTACAGAAGATGCAGCTGGAGAATCT
  5   1   1       add Egg                            TEgg052m20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAGATGAAGAAAATGCTGATGATCTTTATGAAAAGTTTATCTGTACAACTGAAGAGACCACCAAAAACAAAAGAGAAGCTGAAGACCTTTTAAGGGAAATAGAGAACCTTAAAGGCACTATGGAGACACTGGAAGTCAAGCTTGCTGCCACAAAACATGAACTTGAAGAATGTCAAATGGATAAGGAGCAACTGCTTAATAAGAAAAACTTCCTTCTTCAAGCAATGCAGGCTGCATTTTCAGTTGCTTCTCTTTCAGACTCTTCACCTTCTCTCTCAGCATTAGTTGAAGAGAAGTCTCAAGACCCCATACAAACTGATGAATACCACAAATTAATATCCCTTGCTAAAGAAAGGACCAGCATTATGGTGTGTCTAGAGACTGAGAGAAACAGTCTTAAAGAACAAGTTATTGATTTGACCTCTGAAGTTCAAAGTCTTCAAGCACAAGGTATTGCAAAGTCTGATCTCCAAAAAGAAAAACAAGACTTGGAAGATAAATGGGTTAAATTAGTTTCAGAGATGGAACAACTGCAGGAACAACTAACTGAATCACAGTTATCTTTAGAGAAGATGCAGCTGGAGAATCTGGAAGTTACAGAAAAACTCCAATCACTTCAAGAAGAGATGAAAAACATTACTAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)