Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABK11029.5.5                        95 END     1           7        1                LOC496346 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 97%

 1012155534 Xt7.1-CBWN4626.5.5 - 14 ESTs
                                                                       ....-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CBWN4626.5.5                                                                                                                                                                                                                                                                                                                                                                                                                     CCTTGGGATTGTTTACATTGTAGAAAAGGTGCTCAAGGAGCATTTCATAACTAGATATGTATAAGGGGACTAATCTGCACCACAAAAGGAGGGTGCTGCATTTTTAATTCAAGTATTTTAGTTGTGTATTTTTTTCCTTAGTGAATGTGCTTTTTTAGGCTTCTTAGTTGCTTGCTGGTTGTATTCCTATTTCCTGCAAATACCTATACCTGCACTTCAGGAGGAGTACAATGTTGTCACGCTGGACTGGGAGTGGGACAAGTCTGAAAGCTGAACTCCGGAAAAGACAACACGTTCAAAAAAGGAGCCTAAAACTCAAGATTACTTATGGTCAGTCTTTTTTATTCTCCAATAAAAGTAGAAGCTGCGAGCAAGTAACACAACATGCCACAGAAAACTTCAGATTGCAATACACACCATCCACCATTGCGTATCTTTATAAGCGTATGACAGTGACGCACTACTACACTCAATTCTAGCGCGTCACTCCCTCTACTAGACTACGTGCTGCATATTACGTGCAGATGTGACGTCACCATCTCGCGAGATGAGACTTGCGGCGGCGAGGTTAGCTGTCAGACTGGAGCCAAGGAGCTAGACATTAGTCGTTTAGCGGGACGTTTAAAGAAGCTATTCTGGAATGTTGGGTGATACGGAGGAAGACAGACTTGGTCGCTGCCGAAGTGTAAAGGAGTTTGAGAAATTAAATCGCATTGGTGAAGGAACATATGGTATAGTATATCGTGCCAGGGATACCAAGAGTAATGAAATAGTAGCATTGAAGAAGGTTAGAATGGACAAAGAGAAGGATGGTATCCCCATAAGCAGCCTGCGGGAGATAAATCTGCTACTCAGATTGCGACATCCCAACATTGTGGAGCTAAAGGAAGTAGTTGTTGGAAATCACTTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAGCAAGACCTGGCCAGTCTTTTGGAGAATATGCAAACCCCATTCTCTGAAGCCCAGGTGAAATGTATCTGCTTCCAGCTCCTCACTGGGCTGCAGTACCTTCATGAGAGCTTTATAGTACATAGAGATCTAAAAGTATCCAACCTGCTCATGACTGATAAAGGCTGTGTGAAGATTGCTGATTTTGGCCTGGCTCGTGCTTTCAGCATCCCGGCAAAGCAGATGACTCCTAAAGTGGTCACTCTATGGTACCGGGCCCCTGAACTTCTACTGGGAAGCACTACACAGACTACAGCCATAGACATGTGGGCTGTGGGTTGCATACTGGCTGAGCTCCTGGCTCACAAGCCCCTTCTTCCAGGAGGTTCAGAAATCCAGCAGATTGATCTGATCATACAGCTGCTTGGCACACCCAATGAAAACATCTGGCCAGGTTTCTCAAACCTGCCATTAGTTGGTCAGTACACAGTGCGTAAGCAACCTTACAACAATCTAAAACACAAGTTTCCCTGGCTGTCTGAAGCTGGACTTCGCTTACTCAATTTCCTTTTTATGTATGACCCCAAAAAGAGAGCAACAGCTGAGGACAGTCTTGCAAGTTCATATTTTAAGGAAAAGCCTTTGCCCTGTGAACCACAGTTGATGCCTACATTCCCACATCATCGGAACAAGAGAGCGAGTGGCACAGGAACGGAGAGCCAATGCAAGCGCAGCAAACCATAATTCCACAAATCCATCCACTTTATGAAGCAAATCACTCAATAGACTTTTGCGGGACTTCGATCAAGGCAGAAACTTGAATCAGGGCTCTATCTTTTTTTTTTTTTTTTTTAAATTTATATGTCTTGTAGGTTTAACAGGTACTGTAGAAGCACCACAATTAAGGAGATAGACTGGTGTATTTAACAGGAATCTTCTGTCTTCAAATACATGAAACTCCACTATTATTTTCTAGTGAGAGAAAGACGCTGACCTAGATTTTAGAGTCTCTTATGGGAAAATAAGGATATGTATGTGTCCTGTACTGATACTAATGTGCTGCATCAGCATAAATCATTGCATGACCTAAGTGTAGGAGGGCTGGCTGTGTCCCCTTGCTGTGCAGGTGATGGGTTATTTGTTAACCACAGCCACCTTTGGAAAAATTGTGCAGCAATCTTACACTTATAATTATTTCCTGAACTGATGTTAATGATATCTAATGTTGGTTATTATGAAAAATAAAGTATGTA
                                                  Xt7.1-CHK-1008266750                                                                                                                                                                                                                                                                                                                                                                                                                           GATTGTTTACATTGTAGAAAAGGTGCTCAAGGAGCATTTCATAACTAGATATGTATAAGGGGACTAATCTGCACCACAAAAGGAGGGTGCTGCATTTTTAATTCAAGTATTTTAGTTGTGTATTTTTTTCCTTAGTGAATGTGCTTTTTTAGGCTTCTTAGTTGCTTGCTGGTTGTATTCCTATTTCCTGCAAATACCTATACCTGCACTTCAGGAGGAGTACAATGTTGTCACGCTGGACTGGGAGTGGGACAAGTCTGAAAGCTGAACTCCGGAAAAGACAACACGTTCAAAAAAGGAGCCTAAAACTCAAGATTACTTATGGTCAGTCTTTTTTATTCTCCAATAAAAGTAGAAGCTGCGAGCAAGTAACACAACATGCCACAGAAAACTTCAGATTGCAATACACACCATCCACCATTGCGTATCTTTATAAGCGTATGACAGTGACGCACTACTACACTCAATTCTAGCGCGTCACTCCCTCTACTAGACTACGTGCTGCATATTACGTGCAGATGTGACGTCACCATCTCGCGAGATGAGACTTGCGGCGGCGAGGTTAGCTGTCAGACTGGAGCCAAGGAGCTAGACATTAGTCGTTTAGCGGGACGTTTAAAGAAGCTATTCTGGAATGTTGGGTGATACGGAGGAAGACAGACTTGGTCGCTGCCGAAGTGTAAAGGAGTTTGAGAAATTAAATCGCATTGGTGAAGGAACATATGGTATAGTATATCGTGCCAGGGATACCAAGAGTAATGAAATAGTAGCATTGAAGAAGGTTAGAATGGACAAAGAGAAGGATGGTATCCCCATAAGCAGCCTGCGGGAGATAAATCTGCTACTCAGATTGCGACATCCCAACATTGTGGAGCTAAAGGAAGTAGTTGTTGGAAATCACTTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAGCAAGACCTGGCCAGTCTTTTGGAGAATATGCAAACCCCATTCTCTGAAGCCCAGGTGAAATGTATCTGCTTCCAGCTCCTCACTGGGCTGCAGTACCTTCATGAGAGCTTTATAGTACATAGAGATCTAAAAGTATCCAACCTGCTCATGACTGATAAAGGCTGTGTGAAGATTGCTGATTTTGGCCTGGCTCGTGCTTTCAGCATCCCGGCAAAGCAGATGACTCCTAAAGTGGTCACTCTATGGTACCGGGCCCCTGAACTTCTACTGGGAAGCACTACACAGACTACAGCCATAGACATGTGGGCTGTGGGTTGCATACTGGCTGAGCTCCTGGCTCACAAGCCCCTTCTTCCAGGAGGTTCAGAAATCCAGCAGATTGATCTGATCATACAGCTGCTTGGCACACCCAATGAAAACATCTGGCCAGGTTTCTCAAACCTGCCATTAGTTGGTCAGTACACAGTGCGTAAGCAACCTTACAACAATCTAAAACACAAGTTTCCCTGGCTGTCTGAAGCTGGACTTCGCTTACTCAATTTCCTTTTTATGTATGACCCCAAAAAGAGAGCAACAGCTGAGGACAGTCTTGCAAGTTCATATTTTAAGGAAAAGCCTTTGCCCTGTGAACCACAGTTGATGCCTACATTCCCACATCATCGGAACAAGAGAGCGAGTGGCACAGGAACGGAGAGCCAATGCAAGCGCAGCAAACCATAATTCCACAAATCCATCCACTTTATGAAGCAAATCACTCAATAGACTTTTGCGGGACTTCGATCAAGGCAGAAACTTGAATCAGGGCTCTATCTTTTTTTTTTTTTTTTTTAAATTTATATGTCTTGTAGGTTTAACAGGTACTGTAGAAGCACCACAATTAAGGAGATAGACTGGTGTATTTAACAGGAATTTTCTGTCTTCAAATACATGAAACTCCACTATTATTTTCTAGTGAGAGAAAGACGCTGACCTAGATTTTAGAGTCTCTTATGGGAAAATAAGGATATGTATGTGTCCTGTACTGATACTAATGTGCTGCATCAGCATAAATCATTGCATGACCTAAGTGTAGGAGGGCTGGCTGTGTCCCCTTGCTGTGCAGGTGATGGGTTATTTGTTAACCACAGCCACCTTTGGAAAAATTGTGCAGCAATCTTACACTTATAATTATTTCCTGAACTGATGTTAATGATATCTAATGTTGGTTATTATGAAAAATAAAGTATGTATTTAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                          2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     6     6     7     7     7     7     8     8     8     8     8     8     8     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     4     4     4     4     4     4     4     4     3     3     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4
  5   1   2      ests                                 Xt7.1-CBWN4626.5                                                                                                                                                                                                                                                                                                                                                                                                                     CCTTGGGATTGTTTACATTGTAGAAAAGGTGCTCAAGGAGCATTTCATAACTAGATATGTATAAGGGGACTAATCTGCACCACAAAAGGAGGGTGCTGCATTTTTAATTCAAGTATTTTAGTTGTGTATTTTTTTCCTTAGTGAATGTGCTTTTTTAGGCTTCTTAGTTGCTTGCTGGTTGTATTCCTATTTCCTGCAAATACCTATACCTGCACTTCAGGAGGAGTACAATGTTGTCACGCTGGACTGGGAGTGGGACAAGTCTGAAAGCTGAACTCCGGAAAAGACAACACGTTCAAAAAAGGAGCCTAAAACTCAAGATTACTTATGGTCAGTCTTTTTTATTCTCCAATAAAAGTAGAAGCTGCGAGCAAGTAACACAACATGCCACAGAAAACTTCAGATTGCAATACACACCATCCACCATTGCGTATCTTTATAAGCGTATGACAGTGACGCACTACTACACTCAATTCTAGCGCGTCACTCCCTCTACTAGACTACGTGCTGCATATTACGTGCAGATGTGACGTCACCATCTCGCGAGATGAGACTTGCGGCGGCGAGGTTAGCTGTCAGACTGGAGCCAAGGAGCTAGACATTAGTCGTTTAGCGGGACGTTTAAAGAAGCTATTCTGGAATGTTGGGTGATACGGAGGAAGACAGACTTGGTCGCTGCCGAAGTGTAAAGGAGTTTGAGAAATTAAATCGCATTGGTGAAGGAACATATGGTATAGTATATCGTGCCAGGGATACCAAGAGTAATGAAATAGTAGCATTGAAGAAGGTTAGAATGGACAAAGAGAAGGATGGTATCCCCATAAGCAGCCTGCGGGAGATAAATCTGCTACTCAGATTGCGACATCCCAACATTGTGGAGCTAAAGGAAGTAGTTGTTGGAAATCACTTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAGCAAGACCTGGCCAGTCTTTTGGAGAATATGCAAACCCCATTCTCTGAAGCCCAGGTGAAATGTATCTGCTTCCAGCTCCTCACTGGGCTGCAGTACCTTCATGAGAGCTTTATAGTACATAGAGATCTAAAAGTATCCAACCTGCTCATGACTGATAAAGGCTGTGTGAAGATTGCTGATTTTGGCCTGGCTCGTGCTTTCAGCATCCCGGCAAAGCAGATGACTCCTAAAGTGGTCACTCTATGGTACCGGGCCCCTGAACTTCTACTGGGAAGCACTACACAGACTACAGCCATAGACATGTGGGCTGTGGGTTGCATACTGGCTGAGCTCCTGGCTCACAAGCCCCTTCTTCCAGGAGGTTC
  5   1   2      ests                               Xt7.1-TEgg042j16.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAGAAATCCAGCAGATTGATCTGATCATACAGCTGCTTGGCACACCCAATGAAAACATCTGGCCAGGTTTCTCAAACCTGCCATTAGTTGGTCAGTACACAGTGCGTAAGCAACCTTACAACAATCTAAAACACAAGTTTCCCTGGCTGTCTGAAGCTGGACTTCGCTTACTCAATTTCCTTTTTATGTATGACCCCAAAAAGAGAGCAACAGCTGAGGACAGTCTTGCAAGTTCATATTTTAAGGAAAAGCCTTTGCCCTGTGAACCACAGTTGATGCCTACATTCCCACATCATCGGAACAAGAGAGCGAGTGGCACAGGAACGGAGAGCCAATGCAAGCGCAGCAAACCATAATTCCACAAATCCATCCACTTTATGAAGCAAATCACTCAATAGACTTTTGCGGGACTTCGATCAAGGCAGAAACTTGAATCAGGGCTCTATCTTTTTTTTTTTTTTTTTTAAATTTATATGTCTTGTAGGTTTAACAGGTACTGTAGAAGCACCACAATTAAGGAGATAGACTGGTGTATTTAACAGGAATCTTCTGTCTTCAAATACATGAAACTCCACTATTATTTTCTAGTGAGAGAAAGACGCTGACCTAGATTTTAGAGTCTCTTATGGGAAAATAAGGATATGTATGTGTCCTGTACTGATACTAATGTGCTGCATCAGCATAAATCATTGCATGACCTAAGTGTAGGAGGGCTGGCTGTGTCCCCTTGCTGTGCAGGTGATGGGTTATTTGTTAACCACAGCCACCTTTGGAAAAATTGTGCAGCAATCTTACACTTATAATTATTTCCTGAACTGATGTTAATGATATCTAATGTTGGTTATTATGAAAAATAAAGTATGTATTTAAATATG
                                               BLH MIN     544     219                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH OVR     640     835                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               EST CLI     556       1                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               ORF LNG     640      77                                                                                                                                                                                                                                                                                                                                                                                                                     
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Br ---- 2e-011     ABD62778.1 Ret tyrosine-kinase receptor [Branchiostoma lanceolatum] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Bb ---- 7e-012     BAA84741.1 src-like A-1 [Branchiostoma belcheri] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Bf ---- 8e-021     AAM18889.1 unknown [Branchiostoma floridae] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Cs ==== 2e-036     BAB68351.1 NEMO-like kinase [Ciona savignyi] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ci ---- 2e-042     BAE06414.1 mitogen-activated protein kinase [Ciona intestinalis] ------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Sc ---- 2e-064     NP_012783.1 putative kinase subunit of the kinase complex that phosphorylates the RPO21 CTD(carboxy-terminal domain); also called CTDK-I alpha subunit; Ctk1p[Saccharomyces cerevisiae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ce ---- 1e-085     NP_495617.1 Cell division cycle 2-like 1 (83.6 kD) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Dr ---- 9e-123     NP_001017622.1 hypothetical protein LOC550285 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Dm ---- 9e-128     NP_523674.1 CG1362-PA [Drosophila melanogaster] --------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Sp ---- 3e-146     XP_783449.1 PREDICTED: similar to Cell division protein kinase 10 (Serine/threonine-protein kinase PISSLRE) [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 4e-170     NP_003665.2 cyclin-dependent kinase 10 isoform 1; serine/threonine protein kinase PISSLRE;CDC2-related protein kinase; cell division protein kinase 10; cyclin-dependentkinase related protein [Homo sapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Gg ---- 2e-170     XP_414201.1 PREDICTED: similar to Cell division protein kinase 10 (Serine/threonine-protein kinase PISSLRE) [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Mm ---- 3e-171     NP_919428.1 cyclin-dependent kinase 10 isoform 1 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xl ---- 0          AAI29671.1 Unknown (protein for MGC:160352) [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - ?? ---- 0          NP_001091165.1 hypothetical protein LOC100036925 [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xt ==== 0          CAJ81352.1 cyclin-dependent kinase (CDC2-like) 10 [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CBWN4626.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAA------TAA---------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------TAA---TAG------------------------------------------------------------------------------TAA------------------------------------------------------TAG------------------------------------------------ATG---------------------------------------------TAG------------TAG---------TAA---------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------TAA---------------------ATG---------------TAG------------------------------------------------------------------TAA------ATG------------------------------------------------------------TAA------------------------ATG------------------------------------TGA---------TAG------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------ATG---ATG---------------------------TAA---ATG---------ATGTAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  0   1   1           Egg  FL                     TEgg042j16.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGGACGTTTAAAGAAGCTATTCTGGAATGTTGGGTGATACGGAGGAAGACAGACTTGGTCGCTGCCGAAGTGTAAAGGAGTTTGAGAAATTAAATCGCATTGGTGAAGGAACATATGGTATAGTATATCGTGCCAGGGATACCAAGAGTAATGAAATAGTAGCATTGAAGAAGGTTAGAATGGACAAAGAGAAGGATGGTATCCCCATAAGCAGCCTGCGGGAGATAAATCTGCTACTCAGATTGCGACATCCCAACATTGTGGAGCTAAAGGAAGTAGTTGTTGGAAATCACTTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAGCAAGACCTGGCCAGTCTTTTGGAGAATATGCAAACCCCATTCTCTGAAGCCCAGGTGAAATGTATCTGCTTCCAGCTCCTCACTGGGCTGCAGTACCTTCATGAGAGCTTTATAGTACATAGAGATCTAAAAGTATCCAACCTGCTCATGACTGATAAAGGCTGTGTGAAGATTGCTGATTTTGGCCTGGCTCGTGCTTTCAGCATCCCGGCAAAGCAGATGACTCCTAAAGTGGTCACTCTATGGTACCGGGCCCCTGAACTTCTACTGGGAAGCACTACACAGACTACAGCCATAGACATGTGGGCTGTGGGTTGCATACTGGCTGAGCTCCTGGCTCACAAGCCCCTTCTTCCAGGAGGTTCAGAAATCCAGCAGATTGATCTGATCATACAGCTGCTTGGCACACCCAATGAAAACATCTGGCCAGGTTTCTCAAACCTGCCATTAGTTGGTCAGTACACAGTGCGTAAGCAACCTTACAACAATCTAAAACACAAGTTTCCCTGGCTGTCTGAAGCTGGACTTCGCTTACTCAATTTCCTTTTTATGTATGACCCCAAAAAGAGAGCAACAGCTGAGGACAGTCTTGCAAGTTCATATTTTAAGGAAAAGCCTTTGCCCTGTGAACCACAGTTGATGCCTACATTCCCACATCATCGGAACAAGAGAGCGAGTGGCACAGGAACGGAGAGCCAATGCAAGCGCAGCAAACCATAATTCCACAAATCCATCCACTTTATGAAGCAAATCACTCAATAGACTTCTGCGGGACTTCGATCAAGGCAGAAACTTGAATCAGGGCTCTATCTTTTTTTTTTTTTTTTTTAAATTTATATGTCTTGTAGGTTTAACAGGTACTGTAGAAGCACCACAATTAAGGAGATAGACTGGTGTATTTAACAGGAATCTTCTGTCTTCAAATACATGAAACTCCACTATTATTTTCTAGTGAGAGAAAGACGCTGACCTAGATTTTAGAGTCTCTTATGGGAAAATAAGGATATGTATGTGTCCTGTACTGATACTAATGTGCTGCATCAGCATAAATCATTGCATGACCTAAGTGTAGGAGGGCTGGCTGTGTCCCCTTGCTGTGCAGGTGATGGGTTATTTGTTAACCACAGCCACCTTTGGAAAAATTGTGCAGCAATCTTACACTTATAATTATTTCCTGAACTGATGTTAATGATATCTAATGTTGGTTATTATGAAAAATAAAGTATGTATTTAAATATGTAAAAAAAAAAAAAA
  5   1   2      ests                                 Xt7.1-CBWN4626.5                                                                                                                                                                                                                                                                                                                                                                                                                     CCTTGGGATTGTTTACATTGTAGAAAAGGTGCTCAAGGAGCATTTCATAACTAGATATGTATAAGGGGACTAATCTGCACCACAAAAGGAGGGTGCTGCATTTTTAATTCAAGTATTTTAGTTGTGTATTTTTTTCCTTAGTGAATGTGCTTTTTTAGGCTTCTTAGTTGCTTGCTGGTTGTATTCCTATTTCCTGCAAATACCTATACCTGCACTTCAGGAGGAGTACAATGTTGTCACGCTGGACTGGGAGTGGGACAAGTCTGAAAGCTGAACTCCGGAAAAGACAACACGTTCAAAAAAGGAGCCTAAAACTCAAGATTACTTATGGTCAGTCTTTTTTATTCTCCAATAAAAGTAGAAGCTGCGAGCAAGTAACACAACATGCCACAGAAAACTTCAGATTGCAATACACACCATCCACCATTGCGTATCTTTATAAGCGTATGACAGTGACGCACTACTACACTCAATTCTAGCGCGTCACTCCCTCTACTAGACTACGTGCTGCATATTACGTGCAGATGTGACGTCACCATCTCGCGAGATGAGACTTGCGGCGGCGAGGTTAGCTGTCAGACTGGAGCCAAGGAGCTAGACATTAGTCGTTTAGCGGGACGTTTAAAGAAGCTATTCTGGAATGTTGGGTGATACGGAGGAAGACAGACTTGGTCGCTGCCGAAGTGTAAAGGAGTTTGAGAAATTAAATCGCATTGGTGAAGGAACATATGGTATAGTATATCGTGCCAGGGATACCAAGAGTAATGAAATAGTAGCATTGAAGAAGGTTAGAATGGACAAAGAGAAGGATGGTATCCCCATAAGCAGCCTGCGGGAGATAAATCTGCTACTCAGATTGCGACATCCCAACATTGTGGAGCTAAAGGAAGTAGTTGTTGGAAATCACTTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAGCAAGACCTGGCCAGTCTTTTGGAGAATATGCAAACCCCATTCTCTGAAGCCCAGGTGAAATGTATCTGCTTCCAGCTCCTCACTGGGCTGCAGTACCTTCATGAGAGCTTTATAGTACATAGAGATCTAAAAGTATCCAACCTGCTCATGACTGATAAAGGCTGTGTGAAGATTGCTGATTTTGGCCTGGCTCGTGCTTTCAGCATCCCGGCAAAGCAGATGACTCCTAAAGTGGTCACTCTATGGTACCGGGCCCCTGAACTTCTACTGGGAAGCACTACACAGACTACAGCCATAGACATGTGGGCTGTGGGTTGCATACTGGCTGAGCTCCTGGCTCACAAGCCCCTTCTTCCAGGAGGTTC
                                                  Xt7.1-CHK-1008235948                                                                                                                                                                                                                                                                                                                                                                                                                           GATTGTTTACATTGTAGAAAAGGTGCTCAAGGAGCATTTCATAACTAGATATGTATAAGGGGACTAATCTGCACCACAAAAGGAGGGTGCTGCATTTTTAATTCAAGTATTTTAGTTGTGTATTTTTTTCCTTAGTGAATGTGCTTTTTTAGGCTTCTTAGTTGCTTGCTGGTTGTATTCCTATTTCCTGCAAATACCTATACCTGCACTTCAGGAGGAGTACAATGTTGTCACGCTGGACTGGGAGTGGGACAAGTCTGAAAGCTGAACTCCGGAAAAGACAACACGTTCAAAAAAGGAGCCTAAAACTCAAGATTACTTATGGTCAGTCTTTTTTATTCTCCAATAAAAGTAGAAGCTGCGAGCAAGTAACACAACATGCCACAGAAAACTTCAGATTGCAATACACACCATCCACCATTGCGTATCTTTATAAGCGTATGACAGTGACGCACTACTACACTCAATTCTAGCGCGTCACTCCCTCTACTAGACTACGTGCTGCATATTACGTGCAGATGTGACGTCACCATCTCGCGAGATGAGACTTGCGGCGGCGAGGTTAGCTGTCAGACTGGAGCCAAGGAGCTAGACATTAGTCGTTTAGCGGGACGTTTAAAGAAGCTATTCTGGAATGTTGGGTGATACGGAGGAAGACAGACTTGGTCGCTGCCGAAGTGTAAAGGAGTTTGAGAAATTAAATCGCATTGGTGAAGGAACATATGGTATAGTATATCGTGCCAGGGATACCAAGAGTAATGAAATAGTAGCATTGAAGAAGGTTAGAATGGACAAAGAGAAGGATGGTATCCCCATAAGCAGCCTGCGGGAGATAAATCTGCTACTCAGATTGCGACATCCCAACATTGTGGAGCTAAAGGAAGTAGTTGTTGGAAATCACTTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAGCAAGACCTGGCCAGTCTTTTGGAGAATATGCAAACCCCATTCTCTGAAGCCCAGGTGAAATGTATCTGCTTCCAGCTCCTCACTGGGCTGCAGTACCTTCATGAGAGCTTTATAGTACATAGAGATCTAAAAGTATCCAACCTGCTCATGACTGATAAAGGCTGTGTGAAGATTGCTGATTTTGGCCTGGCTCGTGCTTTCAGCATCCCGGCAAAGCAGATGACTCCTAAAGTGGTCACTCTATGGTACCGGGCCCCTGAACTTCTACTGGGAAGCACTACACAGACTACAGCCATAGACATGTGGGCTGTGGGTTGCATACTGGCTGAGCTCCTGGCTCACAAGCCCCTTCTTCCAGGAGGTTCAGAAAT
  5   1   2       bld Tbd1      in                        CBXT16916.b1                                                                                                                                                                                      ATTTATTGTTGTACTTTGTATTTATCCATTATCTTTAACCCCCTGTCTGTATTAATGAATTCTACCGTACAGCGCTGCGTACATAAGTAGCGCTTTATAAAGAAAGATATACATACATATGGTAAAATAAGGGTACTGGGAAAAGGTCTGAATATACACTTAAGGGTGCTATATTGCTTTTCTCTAAATTGTGAATTGCCAATGGTCATGATTATGCAGGACACCTTGGGATTGTTTACATTGTAGAAAAGGTGCTCAAGGAGCATTTCATAACTAGATATGTATAAGGGGACTAATCTGCACCACAAAAGGAGGGTGCTGCATTTTTAATTCAAGTATTTTAGTTGTGTATTTTTTTCCTTAGTGAATGTGCTTTTTTAGGCTTCTTAGTTGCTTGCTGGTTGTATTCCTATTTCCTGCAAATACCTATACCTGCACTTCAGGAGGAGTACAATGTTGTCACGCTGGACTGGGAGTGGGACAAGTCTGAAAGCTGAACTCCGGAAAAGACAACACGTTCAAAAAAGGAGCCTAAAACTCAAGATTACTTATGGTCAGTCTTTTTTATTCTCCAATAAAAGTAGAAGCTGCGAGCAAGTAACACAACATGCCACAGAAAACTTCAGATTGCAATACACACCATCCACCATTGCGTATCTTTATAAGCGTATGACAGTGACGCACTACTACACTCAATTCTAGCGCGTCACTCCCTCTACTAGACTACGTGCTGCATATTACGTGCAGATGTGACGTCACCATCTCGCGAGATGAGACTTGCGGCGGCGAGGTTAGCTGTCAGAC
  3   1   2       bld Tbd1      in                        CBXT16916.g1                                                                                                                                                                                                                                                                                                                                                                                                         TATGCAGGACACCCTTGGGATTGTTTACATTGTAGAAAAGGTGCTCAAGGAGCATTTCATAACTAGATATGTATAAGGGGACTAATCTGCACCACAAAAGGAGGGTGCTGCATTTTTAATTCAAGTATTTTAGTTGTGTATTTTTTTCCTTAGTGAATGTGCTTTTTTAGGCTTCTTAGTTGCTTGCTGGTTGTATTCCTATTTCCTGCAAATACCTATACCTGCACTTCAGGAGGAGTACAATGTTGTCACGCTGGACTGGGAGTGGGACAAGTCTGAAAGCTGAACTCCGGAAAAGACAACACGTTCAAAAAAGGAGCCTAAAACTCAAGATTACTTATGGTCAGTCTTTTTTATTCTCCAATAAAAGTAGAAGCTGCGAGCAAGTAACACAACATGCCACAGAAAACTTCAGATTGCAATACACACCATCCACCATTGCGTATCTTTATAAGCGTATGACAGTGACGCACTACTACACTCAATTCTAGCGCGTCACTCCCTCTACTAGACTACGTGCTGCATATTACGTGCAGATGTGACGTCACCATCTCGCGAGATGAGACTTGCGGCGGCGAGGTTAGCTGTCAGACTGGAGCCAAGGAGCTAGACATTAGTCGTTTAGCGGGACGTTTAAAGAAGCTATTCTGGAATGTTGGGTGATACGGAGGAAGACAGAGTGAGTCTCCGGCGAATAAGGCACGATATCTAGTTGCAACTACCAGAGGCTTCCTGGAGTTAAATTCAGTGTTAATTCAATTAAAATATATTATATTCATGCACATCTAAAAAAAAAAAAAAA
  5   1   2       bld Egg  5g                        TEgg133c03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGCGTCACTCCCTCTACTAGACTACGTGCTGCATATTACGTGCAGATGTGACGTCACCATCTCGCGAGATGAGACTTGCGGCGGCGAGGTTAGCTGTCAGACTGGAGCCAAGGAGCTAGACATTAATCGTTTAGCGGGACGTTTAAAGAAGCTATTCTGGAATGTTGGGTGATACGGAGGAAGACAGACTTGGTCGCTGCCGAAGTGTAAAGGAGTTTGAGAAATTAAATCGCATTGGTGAAGGAACATATGGTATAGTATATCGTGCCAGGGATACCAAGAGTAATGAAATAGTAGCATTGAAGAAGGTTAGAATGGACAAAGAGAACGATGGTATCCCCATAAGCAGCCTGCGGGAGATAAATCTGCTACTCAGATTGCGACATCCCAACATTGTGGAGCTAAAGGAAGTAGTTGTTGGAAATCACTTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAGCAAGACCTGGCCAGTCTTTTGGAGAATATGCAAACCCCATTCTCTGAAGCCCAGGTGACATGTATCTGCTTCCAGCTCCTCACTGGGCTGCAGTACCTTCATGAGAGCTTTATAGTACATAGAGATCT
  5   1   2       bld Egg  5g3  in                   TEgg039a05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCCCTCTACTAGACTACGTGCTGCATATTACGTGCAGATGTGACGTCACCATCTCGCGAGATGAGACTTGCGGCGGCGAGGTTAGCTGTCAGACTGGAGCCAAGGAGCTAGACATTAGTCGTTTAGCGGGACGTTTAAAGAAGCTATTCTGGAATGTTGGGTGATACGGAGGAAGACAGACTTGGTCGCTGCCGAAGTGTAAAGGAGTTTGAGAAATTAAATCGCATTGGTGAAGGAACATATGGTATAGTATATCGTGCCAGGGATACCAAGAGTAATGAAATAGTAGCATTGAAGAAGGTTAGAATGGACAAAGAGAAGGATGGTATCCCCATAAGCAGCCTGCGGGAGATAAATCTGCTACTCAGATTGCGACATCCCAACATTGTGGAGCTAAAGGAAGTAGTTGTTGGAAATCACTTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAGCAAGACCTGGCCAGTCTTTTGGAGAATATGCAAACCCCATTCTCTGAAGCCCAGGTGAAATGTATCTGCTTCCAGCTCCTCACTGGGCTGCAGTACCTTCATGAGAGCTTTATAG
  5   1   2   10  bld Te1  PIPE in                         CBWN4626.b1 ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGGCGGCGAGGTTACCTGTCAGACTGGAGCCAAGGATCTAGACATTAGTCGTTTAGCGGGACGTTTAAAGAAGCTATTCTGGAATGTTGGGTGATACGGAGGAAGACAGACTTGGTCGCTGCCGAAGTGTAAAGGAGTTTGAGAAATTAAATCGCATTGGTGAAGGAACATATGGTATAGTATATCGTGCCAGGGATACCAAGAGTAATGAAATAGTAGCATTGAAGAAGGTTAGAATGGACAAAGAGAAGGATGGTATCCCCATAAGCAGCCTGCGGGAGATAAATCTGCTACTCAGATTGCGACATCCCAACATTGTGGAGCTAAAGGAAGTAGTTGTTGGAAATCACTTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAGCAAGACCTGGCCAGTCTTTTGGAGAATATGCAAACCCCATTCTCTGAAGCCCAGGTGAAATGTATCTGCTTCCAGCTCCTCACTGGGCTGCAGTACCTTCATGAGAGCTTTATAGTACATAGAGATCTAAAAGTATCCAACCTGCTCATGACTGATAAAGGCTGTGTGAAGATTGCTGATTTTGGCCTGGCTCGTGCTTTCAGCATCCCGGCAAAGCAGATGACTCCTAAAGTGGTCACTCTATGGTACCGGGCCCCTGAACTTCTACTGGGAAGCACTACACAGACTACAGCCATAGACATGTGGGCTGTGGGTTGCATACTGGCT
  5   1   2       bld HdA  5g3  in                  THdA025j16.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCTGTCAGACTGGAGCCAAGGAGCTAGACATTAGTCGTTTAGCGGGACGTTTAAAGAAGCTATTCTGGAATGTTGGGTGATACGGAGGAAGACAGACTTGGTCGCTGCCGAAGTGTAAAGGAGTTTGAGAAATTAAATCGCATTGGTGAAGGAACATATGGTATAGTATATCGTGCCAGGGATACCAAGAGTAATGAAATAGTAGCATTGAAGAAGGTTAGAATGGACAAAGAGAAGGATGGTATCCCCATAAGCAGCCTGCGGGAGATAAATCTGCTACTCAGATTGCGACATCCCAACATTGTGGAGCTAAAGGAAGTAGTTGTTGGAAATCACTTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAGCAAGACCTGGCCAGTCTTTTGGAGAATATGCAAACCCCATTCTCTGAAGCCCAGGTGAAATGTATCTGCTTCCAGCTCCTCACTGGGCTGCAGTACCTTCATGAGAGCTTTATAGTACATAGAGATCTAAAAGTATCCAACCTGCTCATGACTGATAAAGGCTGTGTGAAGATTGCTGATTTTGGCCTGGCTCGTGCTTTCAGCATCNCGGCAAAGCAGATGACTCCTAAAGTGGTCACTCTATGGTACCGGGCCCCTGAACTTCTA
  5   1   2   20  bld Te1  5g                              CBWN8187.b1 ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGAGCCAAGGATCTAGACATTAGTCGTTTAGCGGGACGTTTAAAGAAGCTATTCTGGAATGTTGGGTGATACGGAGGAAGACAGACTTGGTCGCTGCCGAAGTGTAAAGGAGTTTGAGAAATTAAATCGCATTGGTGAAGGAACATATGGTATAGTATATCGTGCCAGGGATACCAAGAGTAATGAAATAGTAGCATTGAAGAAGGTTAGAATGGACAAAGAGAAGGATGGTATCCCCATAAGCAGCCTGCGGGAGATAAATCTGCTACTCAGATTGCGACATCCCAACATTGTGGAGCTAAAGGAAGTAGTTGTTGGAAATCACTTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAGCAAGACCTGGCCAGTCTTTTGGAGAATATGCAAACCCCATTCTCTGAAGCCCAGGTGAAATGTATCTGCTTCCAGCTCCTCACTGGGCTGCAGTACCTTCATGAGAGCTTTATAGTACATAGAGATCTAAAAGTATCCAACCTGCTCATGACTGATAAAGGCTGTGTGAAGATTGCTGATTTTGGCCTGGCTCGTGCTTTCAGCATCCCGGCAAAGCAGATGACTCCTAAAGTGGTCACTCTATGGTACCGGGCCCCTGAACTTCTACTGGGAAGCACTACACAGACTACAGCCATAGACATGTGGGCTGTGGGTTGCATACTGGCTGAGCTCCTGGCTCACAAGCCCCTTCTTCCAGGAGGTTCAGAAAT
  5   1   2       bld Egg  5g                        TEgg128e07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAGACATTAGTCGTTTAGCGGGACGTTTAAAGAAGCTATTCTGGAATGTTGGGTGATACGGAGGAAGACAGACTTGGTCGCTGCCGAAGTGTAAAGGAGTTTGAGAAATTAAATCGCATTGGTGAAGGAACATATGGTATAGTATATCGTGCCAGGGATACCAAGAGTAATGAAATAGTAGCATTGAAGAAGGTTAGAATGGACAAAGAGAAGGATGGTATCCCCATAAGCAGCCTGCGGGAGATAAATCTGCTACTCAGATTGCGACATCCCAACATTGTGGAGCTAAAGGAAGTAGTTGTTGGAAATCACTTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAGCAAGACCTGGCCAGTCTTTTGGAGAATATGCAAACCCCATTCTCTGAAGCCCAGGTGAAATGTATCTGCTTCCAGCTCCTCACTGGGCTGCAGTACCTTCATGAGAGCTTTATAGTACATAGAGATCTAAAAGTATCCAACCTGCTCATGACTGATAAAGGCTGTGTGAAGATTGCTGATTTTGGCCTGGCTCGTGCTTTCAGCATCCCGGCAAAGCAGATGACTCCTAAAGTGGTCACTCTATG
  5   1   2      seed Egg  FL   in                   TEgg042j16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGGACGTTTAAAGAAGCTATTCTGGAATGTTGGGTGATACGGAGGAAGACAGACTTGGTCGCTGCCGAAGTGTAAAGGAGTTTGAGAAATTAAATCGCATTGGTGAAGGAACATATGGTATAGTATATCGTGCCAGGGATACCAAGAGTAATGAAATAGTAGCATTGAAGAAGGTTAGAATGGACAAAGAGAAGGATGGTATCCCCATAAGCAGCCTGCGGGAGATAAATCTGCTACTCAGATTGCGACATCCCAACATTGTGGAGCTAAAGGAAGTAGTTGTTGGAAATCACTTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAGCAAGACCTGGCCAGTCTTTTGGAGAATATGCAAACCCCATTCTCTGAAGCCCAGGTGAAATGTATCTGCTTCCAGCTCCTCACTGGGCTGCAGTACCTTCATGAGAGCTTTATAGTACATAGAGATCTAAAAGTATCCAACCTGCTCATGACTGATAAAGGCTGTGTGAAGATTGCTGATTTTGGCCTGGCTCGTGCTTTCAGCATCCCGGCAAAGCAGATGACTCCTAAAGTGGTCACTCTATGGTACCGGGCCCCTGAACTTCTACTGGGAAGCACTACACAGACTACAGCCATAGACATGTGGGCTGTGGG
  3  -1   2       bld Te5       out                       CAAO12635.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCGCGATCTAGAACTAGTTATGGGATACTGTGAGCAAGACCTGGCCAGTCTTTTGGAGAATATGCAAACCCCATTCTCTGAAGCCCAGGTGAAATGTATCTGCTTCCAGCTCCTCACTGGGCTGCAGTACCTTCATGAGAGCTTTATAGTACATAGAGATCTAAAAGTATCCAACCTGCTCATGACTGATAAAGGCTGTGTGAAGATTGCTGATTTTGGCCTGGCTCGTGCTTTCAGCATCCCGGCAAAGCAGATGACTCCTAAAGTGGTCACTCTATGGTACCGGGCCCCTGAACTTCTACTGGGAAGCACTACACAGACTACAGCCATAGACATGTGGGCTGTGGGTTGCATACTGGCTGAGCTCCTGGCTCACAAGCCCCTTCTTCCAGGAGGTTCAGAAATCCAGCAGATTGATCTGATCATACAGCTGCTTGGCACACCCAATGAAAACATCTGGCCAGGTTTCTCAAACCTGCCATTAGTTGGTCAGTACACAGTGCGTAAGCAACCTTACAACAATCTAAAACACAAGTTTCCCTGGCTGTCTGAAGCTGGACTTCGCTTACTCAATTTCCTTTTTATGTATGACCCCAAAAAGAGAGCAACAGCTGAGGACAGTCTTGCAAGTTCATATTTTAAGGAAAAGCCTTTGCCCTGTGAACCACAGTTGATGCCTACATTCCCACATCATCGGAACAAGAGAGCGAGTGGCACAGGAACGGAGAGCCAATGCAAGCGCAGCAAACCATAATTCCACAAATCCATCCACTTTATGAAGCAAATCACTCAATAGACTTCTGCGGGACTTCGATCAAGGC
  5   1   2      ests                               Xt7.1-TEgg042j16.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAGAAATCCAGCAGATTGATCTGATCATACAGCTGCTTGGCACACCCAATGAAAACATCTGGCCAGGTTTCTCAAACCTGCCATTAGTTGGTCAGTACACAGTGCGTAAGCAACCTTACAACAATCTAAAACACAAGTTTCCCTGGCTGTCTGAAGCTGGACTTCGCTTACTCAATTTCCTTTTTATGTATGACCCCAAAAAGAGAGCAACAGCTGAGGACAGTCTTGCAAGTTCATATTTTAAGGAAAAGCCTTTGCCCTGTGAACCACAGTTGATGCCTACATTCCCACATCATCGGAACAAGAGAGCGAGTGGCACAGGAACGGAGAGCCAATGCAAGCGCAGCAAACCATAATTCCACAAATCCATCCACTTTATGAAGCAAATCACTCAATAGACTTTTGCGGGACTTCGATCAAGGCAGAAACTTGAATCAGGGCTCTATCTTTTTTTTTTTTTTTTTTAAATTTATATGTCTTGTAGGTTTAACAGGTACTGTAGAAGCACCACAATTAAGGAGATAGACTGGTGTATTTAACAGGAATCTTCTGTCTTCAAATACATGAAACTCCACTATTATTTTCTAGTGAGAGAAAGACGCTGACCTAGATTTTAGAGTCTCTTATGGGAAAATAAGGATATGTATGTGTCCTGTACTGATACTAATGTGCTGCATCAGCATAAATCATTGCATGACCTAAGTGTAGGAGGGCTGGCTGTGTCCCCTTGCTGTGCAGGTGATGGGTTATTTGTTAACCACAGCCACCTTTGGAAAAATTGTGCAGCAATCTTACACTTATAATTATTTCCTGAACTGATGTTAATGATATCTAATGTTGGTTATTATGAAAAATAAAGTATGTATTTAAATATG
                                                  Xt7.1-CHK-1008247094                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCCAGCAGATTGATCTGATCATACAGCTGCTTGGCACACCCAATGAAAACATCTGGCCAGGTTTCTCAAACCTGCCATTAGTTGGTCAGTACACAGTGCGTAAGCAACCTTACAACAATCTAAAACACAAGTTTCCCTGGCTGTCTGAAGCTGGACTTCGCTTACTCAATTTCCTTTTTATGTATGACCCCAAAAAGAGAGCAACAGCTGAGGACAGTCTTGCAAGTTCATATTTTAAGGAAAAGCCTTTGCCCTGTGAACCACAGTTGATGCCTACATTCCCACATCATCGGAACAAGAGAGCGAGTGGCACAGGAACGGAGAGCCAATGCAAGCGCAGCAAACCATAATTCCACAAATCCATCCACTTTATGAAGCAAATCACTCAATAGACTTTTGCGGGACTTCGATCAAGGCAGAAACTTGAATCAGGGCTCTATCTTTTTTTTTTTTTTTTTTAAATTTATATGTCTTGTAGGTTTAACAGGTACTGTAGAAGCACCACAATTAAGGAGATAGACTGGTGTATTTAACAGGAATCTTCTGTCTTCAAATACATGAAACTCCACTATTATTTTCTAGTGAGAGAAAGACGCTGACCTAGATTTTAGAGTCTCTTATGGGAAAATAAGGATATGTATGTGTCCTGTACTGATACTAATGTGCTGCATCAGCATAAATCATTGCATGACCTAAGTGTAGGAGGGCTGGCTGTGTCCCCTTGCTGTGCAGGTGATGGGTTATTTGTTAACCACAGCCACCTTTGGAAAAATTGTGCAGCAATCTTACACTTATAATTATTTCCTGAACTGATGTTAATGATATCTAATGTTGGTTATTATGAAAAAxxAAGTATGTATTTA
  3   1   2      seed Egg  FL   in                    TEgg042j16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAGAAATCCAGCAGATTGATCTGATCATACAGCTGCTTGGCACACCCAATGAAAACATCTGGCCAGGTTTCTCAAACCTGCCATTAGTTGGTCAGTACACAGTGCGTAAGCAACCTTACAACAATCTAAAACACAAGTTTCCCTGGCTGTCTGAAGCTGGACTTCGCTTACTCAATTTCCTTTTTATGTATGACCCCAAAAAGAGAGCAACAGCTGAGGACAGTCTTGCAAGTTCATATTTTAAGGAAAAGCCTTTGCCCTGTGAACCACAGTTGATGCCTACATTCCCACATCATCGGAACAAGAGAGCGAGTGGCACAGGAACGGAGAGCCAATGCAAGCGCAGCAAACCATAATTCCACAAATCCATCCACTTTATGAAGCAAATCACTCAATAGACTTTTGCGGGACTTCGATCAAGGCAGAAACTTGAATCAGGGCTCTATCTTTTTTTTTTTTTTTTTTAAATTTATATGTCTTGTAGGTTTAACAGGTACTGTAGAAGCACCACAATTAAGGAGATAGACTGGTGTATTTAACAGGAATCTTCTGTCTTCAAATACATGAAACTCCACTATTATTTTCTAGTGAGAGAAAGACGCTGACCTAGATTTTAGAGTCTCTTATGGGAAAATAAGGATATGTATGTGTCCTGTACTGATACTAATGTGCTGCATCAGCATAAATCATTGCATGACCTAAGTGTAGGAGGGCTGGCTGTGTCCCCTTGCTGTGCAGGTGATGGGTTATTTGTTAACCACAGCCACCTTTGGAAAAATTGTGCAGCAATCTTACACTTATAATTATTTCCTGAACTGATGTTAATGATATCTAATGTTGGTTATGATGAAAAATAAAGTATGTATTTAAATATGTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg039a05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATCCAGCAGATTGATCTGATCATACAGCTGCTTGGCACACCCAATGAAAACATCTGGCCAGGTTTCTCAAACCTGCCATTAGTTGGTCAGTACACAGTGCGTAAGCAACCTTACAACAATCTAAAACACAAGTTTCCCTGGCTGTCTGAAGCTGGACTTCGCTTACTCAATTTCCTTTTTATGTATGACCCCAAAAAGAGAGCAACAGCTGAGGACAGTCTTGCAAGTTCATATTTTAAGGAAAAGCCTTTGCCCTGTGAACCACAGTTGATGCCTACATTCCCACATCATTGGAACAAGAGAGCGAGTGGCACAGGAACGGAGAGCCAATGCAAGCGCAGCAAACCATAATTCCACAAATCCATCCACTTTATGAAGCAAATCACTCAATAGACTTTTGCGGGACTTCGATCAAGGCAGAAACTTGAATCAGGGCTCTATCTTTTTTTTTTTTTTTTTTAAATTTATATGTCTTGTAGGTTTAACAGGTACTGTAGAAGCACCACAATTAAGGAGATAGACTGGTGTATTTAACAGGAATTTTCTGTCTTCAAATACATGAAACTCCACTATTATTTTTTAGTGAGAGAAAGACGCTGACCTAGATTTTAGAGTCTCTTATGGGAAAATAAGGATATGTATGTGTCCTGTACTGATACTAATGTGCTGCATCAGCATAAATCATTGCATGACCTAAGTGTAGGAGGGCTGGCTGTGTCCCCTTGCTGTGCAGGTGATGGGTTATTTGTTAACCACAGCCACCTTTGGAAAAATTGTGCAGCAATCTTACACTTATAATTATTTCCTGAACTGATGTTAATGATATCTAATGTTGGTTATTATGAAAAAATAAAGTANNTGTATTTAAATTTGAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld HdA  5g3  in                   THdA025j16.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCGGTTACTCAATTTCCTTTTTATGTATGACCCCAAAAAGAGAGCAACAGCTGAGGACAGTTTTGCAAGTTCATATTTTAAGGAAAAGCCTTTGCCCTGGGAACCACAGTTGATGCCTACATTTCCCCATTTTTGGAACAAGAGAGGGAGTGGCACAGGAACGGGGAGCCAATGCAAGGGCGGCAAACCATAATTCCACAAATCCATCCCCTTTTTGAAGCAAATCACTCAATAGAATTTTGGGGGAGTTTGATCAAGGCGGAAACTTGAATCAGGGGTCTATTTTTTTTTTTTTTTTTTTAAAATTAAAAGTTTTGTAGGTTTAACAGGTACTGTGGAAGCCCCCCAATTAAGGGGATTGACTGGGGTATTTAACAGGAATTTTTTTTTTTTAAATACATGAAAATCCCCTATTATTTTTTTGTGAGAGAAAGACGGTGACCTAGATTTTAGAGTTTTTTTTGGGAAAATAAGGATAAGTATGTGTCCTGTATTGATAATAATGTGGTGCATCAGCATAAATCATTGCATGACCTAAGTGTAGGGGGGGTGGGTGTGTCCCCTTGCTGTGCAGGGGATGGGTTATTTGTTAACCCCAGCCCCCTTTGGAAAAATTGTGCAGCAATTTTACACTTATAATTATTTCCTGAAATGATGTTAATGATATTTAATGTTGGTTTTTTTGAAAAATAAAGTATGTTTTTTATTTTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te1  PIPE in                         CBWN4626.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTACTCAATTTCCTTTTTATGTATGACCCCAAAAAGAGAGCAACAGCTGAGGACAGTCTTGCAAGTTCATATTTTAAGGAAAAGCCTTTGCCCTGTGAACCACAGTTGATGCCTACATTCCCACATCATCGGAACAAGAGAGCGAGTGGCACAGGAACGGAGAGCCAATGCAAGCGCAGCAAACCATAATTCCACAAATCCATCCACTTTATGAAGCAAATCCCTCAATAGACTTCTGCGGGACTTCGATCAAGGCAGAAACTTGAATCAGGGCTCTATCTTTTTTTTTTTTTTTTTTAAATTTATATGTCTTGTAGGTTTAACAGGTACTGTAGAAGCACCACAATTAAGGAGATAGACTGGTGTATTTAACAGGAATCTTCTGTCTTCAAATACATGAAACTCCACTATTATTTTCTAGTGAGAGAAAGACGCTGACCTAGATTTTAGAGTCTCTTATGGGAAAATAAGGATATGTATGTGTCCTGTACTGATACTAATGTGCTGCATCAGCATAAATCATTGCATGACCTAAGTGTAGGAGGGCTGGCTGTGTCCCCTTGCTGTGCAGGTGATGGGTTATTTGTTAACCACAGCCACCTTTGGAAAAATTGTGCAGCAATCTTACACTTATAATTATTTCCTGAACTGATGTTAATGATATCTAATGTTGGTTATTATGAAAAATAAAGTATGTATTTAAATATGTAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)