Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA014d13.5                          5 END     2         100       66                MGC83377 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 370.0    0Xt7.1-CABD7242.5                           30 PI      100       659      852                RNA pseudouridylate synthase domain containing 4 [Xenopus tropicalis]
     3 271.0    0Xt7.1-TTpA014d13.5                          5 PI      99          1      147                MGC83377 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     4   0.0    0Xt7.1-CABD7242.5                           30 SPLT    0           0        0                RNA pseudouridylate synthase domain containing 4 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012159380 Xt7.1-TGas106i15.3 - 2 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas106i15.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAAGATCGGATGTTCCAACATCGCCTACCCAAAGCTGGTCATAGAACTCATGCCAAATGGTCTCCGTGGACTCATGCTGGCCGTGATGTTGGCCGCTCTCATGAGCAGCCTGGCATCCATATTTAATAGCAGTGGGACTCTCTTCACTATGGACGTCTGGAGGAGGATGAGGCCCCGGGCCGAGGAGAAGGAGCTGCTGTTGGTGGGAAGGGTGTGGACAGTCTGCCTCGTGGCACTGAGTATAGCGTGGATCCCTGTGGTTCAGGCTGCACAAGGGGGGCAGCTCTTTGATTATATTCAGTCGGTGGCAAGCTTCCTGGCTCCGCCCATTGCGGCTGTCTATTTCCTTGCGCTGTTTGTGAAGAGAGTCAATGAGCCGGGTGCATTCTGGGGACTGGTCGGCGGCCTGTTCCTGGGCTTGTGCCGTATGGTGCCCGAGTTTATATTCGGATCTGGAAGCTGCTCGGCCCCAAGCTCCTGCCCAACCATAATCTGTGGGGTTCACTATCTGTACTTTGCCATCATTCTCTTCCTGTGTTCTGGAGCCATCGTCCTGATCGTATCCCTGTGCACCCCTCCAATCCCAGAGAAGAAGCTCCATCGCTTGGTCTATAGTCTCCGGCACAGCCAGGAGCCGCGGGAAGAAATGGAGGAGACAGGGGTCAGCGATCCTCAGACCCAGGAGAAGCAGTTGTCCGACCTTCCAGATATCCGAGAGGACCCCAAGTATGCCCGCCTGGTGAATATCAACGCCTTGATTATGATGTCCTGCGCCATCTTCTTGTGGGCATATTTTGCATGACACAGTGCAGGGGAGGGTTTGTAATATATTAATTGCATTTAATAAATTG
                                                  Xt7.1-CHK-1008268044                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCGGATGTTCCAACATCGCCTACCCAAAGCTGGTCATAGAACTCATGCCAAATGGTCTCCGTGGACTCATGCTGGCCGTGATGTTGGCCGCTCTCATGAGCAGCCTGGCATCCATATTTAATAGCAGTGGGACTCTCTTCACTATGGACGTCTGGAGGAGGATGAGGCCCCGGGCCGAGGAGAAGGAGCTGCTGTTGGTGGGAAGGGTGTGGACAGTCTGCCTCGTGGCACTGAGTATAGCGTGGATCCCTGTGGTTCAGGCTGCACAAGGGGGGCAGCTCTTTGATTATATTCAGTCGGTGGCAAGCTTCCTGGCTCCGCCCATTGCGGCTGTCTATTTCCTTGCGCTGTTTGTGAAGAGAGTCAATGAGCCGGGTGCATTCTGGGGACTGGTCGGCGGCCTGTTCCTGGGCTTGTGCCGTATGGTGCCCGAGTTTATATTCGGATCTGGAAGCTGCTCGGCCCCAAGCTCCTGCCCAACCATAATCTGTGGGGTTCACTATCTGTACTTTGCCATCATTCTCTTCCTGTGTTCTGGAGCCATCGTCCTGATCGTATCCCTGTGCACCCCTCCAATCCCAGAGAAGAAGCTCCATCGCTTGGTCTATAGTCTCCGGCACAGCCAGGAGCCGCGGGAAGAAATGGAGGAGACAGGGGTCAGCGATCCTCAGACCCAGGAGAAGCAGTTGTCCGACCTTCCAGATATCCGAGAGGACCCCAAGTATGCCCGCCTGGTGAATATCAACGCCTTGATTATGATGTCCTGCGCCATCTTCTTGTGGGCATATTTTGCATGACACAGTGCAGGGGAGGGTTTGTAATATATTAATTGCATTTAATAAATTGCGGTTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                                                                                      PROTEIN --- Ce ---- 4e-008     NP_502539.1 choline transporter (62.4 kD) (cho-1) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 5e-071     XP_798065.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 1e-084     XP_415247.2 PREDICTED: similar to sodium-glucose cotransporter-like 1 [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 3e-102     NP_998091.1 hypothetical protein zgc:85792 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 8e-103     NP_003032.1 solute carrier family 5 (sodium/glucose cotransporter), member 2; solute carrierfamily 5 (sodium/glucose transporter), member 2 [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 9e-104     NP_573517.1 solute carrier family 5 (sodium/glucose cotransporter), member 2; low affinitysodium-dependent glucose cotransporter [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 5e-148     AAH81106.1 MGC83377 protein [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 5e-148     NP_001087699.1 MGC83377 protein [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas106i15.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATG---------------------ATG---------ATG------------ATG---------------------------------------------ATG---------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATGATG---------------------------------TGA---------------------TAA---------------TAATAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  3   1   2       bld TpA  FL   out                   TTpA014d13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAAGATCGGATGTTCCAACATCGCCTACCCAAAGCTGGTCATAGAACTCATGCCAAATGGTCTCCGTGGACTCATGCTGGCCGTGATGTTGGCCGCTCTCATGAGCAGCCTGGCATCCATATTTAATAGCAGTGGGACTCTCTTCACTATGGACGTCTGGAGGAGGATGAGGCCCCGGGCCGAGGAGAAGGAGCTGCTGTTGGTGGGAAGGGTGTGGACAGTCTGCCTCGTGGCACTGAGTATAGCGTGGATCCCTGTGGTTCAGGCTGCACAAGGGGGGCAGCTCTTTGATTATATTCAGTCGGTGGCAAGCTTCCTGGCTCCGCCCATTGCGGCTGTCTATTTCCTTGCGCTGTTTGTGAAGAGAGTCAATGAGCCGGGTGCATTCTGGGGACTGGTCGGCGGCCTGTTCCTGGGCTTGTGCCGTATGGTGCCCGAGTTTATATTCGGATCTGGAAGCTGCTCGGCCCCAAGCTCCTGCCCAACCATAATCTGTGGGGTTCACTATCTGTACTTTGCCATCATTCTCTTCCTGTGTTCTGGAGCCATCGTCCTGATCGTATCCCTGTGCACCCCTCCAATCCCAGAGAAGAAGCTCCATCGCTTGGTCTATAGTCTCCGGCACAGCCAGGAGCCGCGGGAAGAAATGGAGGAGACAGGGGTCAGCGATCCTCAGACCCAGGAGAAGCAGTTGTCCGACCTTCCAGATATCCGAGAGGACCCCAAGTATGCCCGCCTGGTGAATATCAACGCCTTGATTATGATGTCCTGCGCCATCTTCTTGTGGGCATATTTTGCATGACACAGTGCAGGGGAGGGTTTGTAATATATTAATTGCATTTAATAAATTGCGGTTATTTAA
  3   1   2       bld Gas  FLt5 out                   TGas106i15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGAGGAGAAGGAGCTGCTGTTGGTGGGAAGGGTGTGGACAGTCTGCCTCGTGGCACTGAGTATAGCGTGGATCCCTGTGGTTCAGGCTGCACAAGGGGGGCAGCTCTTTGATTATATTCAGTCGGTGGCAAGCTTCCTGGCTCCGCCCATTGCGGCTGTCTATTTCCTTGCGCTGTTTGTGAAGAGAGTCAATGAGCCGGGTGCATTCTGGGGACTGGTCGGCGGCCTGTTCCTGGGCTTGTGCCGTATGGTGCCCGAGTTTATATTCGGATCTGGAAGCTGCTCGGCCCCAAGCTCCTGCCCAACCATAATCTGTGGGGTTCACTATCTGTACTTTGCCATCATTCTCTTCCTGTGTTCTGGAGCCATCGTCCTGATCGTATCCCTGTGCACCCCTCCAATCCCAGAGAAGAAGCTCCATCGCTTGGTCTATAGTCTCCGGCACAGCCAGGAGCCGCGGGAAGAAATGGAGGAGACAGGGGTCAGCGATCCTCAGACCCAGGAGAAGCAGTTGTCCGACCTTCCAGATATCCGAGAGGACCCCAAGTATGCCCGCCTGGTGAATATCAACGCCTTGATTATGATGTCCTGCGCCATCTTCTTGTGGGCATATTTTGCATGACACAGTGCAGGGGAGGGTTTGTAATATATTAATTGCATTTAATAAATTGCGTGTTATTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)